Trypsin-Mediated Sensitization to Ferroptosis Increases the Severity of Pancreatitis in Mice

Trypsin Increases the Sensitivity of Pancreatic Acinar Cells to Ferroptosis

In patients with acute pancreatitis or in the acute phase of chronic pancreatitis, serum trypsin levels reportedly increase to 500–1000 ng/mL.^33,34 To determine the effects of trypsin on cell death, we treated the mouse pancreatic acinar cell line 266-6 and mouse primary pancreatic acinar cells (mPACs) with cell culture–grade trypsin, which was devoid of endotoxin or other biological contaminants. Trypsin used in the reported pathogenic range (500 or 1000 ng/mL) did not trigger significant cell death in 266-6 cells and mPACs, but higher doses (>1000 ng/mL) resulted in cell killing (Figure 1A). Next, we exposed 266-6 cells and mPACs to pancreatitis-inducing toxins, including cerulein, L-arginine, or alcohol, in the absence or presence of trypsin (500 ng/mL). Of note, trypsin increased the sensitivity of acinar cells to cell death induction by these pancreatitis-related stimuli, while a widely used trypsin inhibitor, namely soybean trypsin inhibitor (STI),³⁵ reduced cell killing by cerulein, L-arginine, or alcohol (Figure 1B). These findings indicate that trypsin sensitizes pancreatic acinar cells to cell death.

To elucidate the mechanism of trypsin-enhanced acinar cell death, we monitored the levels of oxidative stress by means of the quantitation of malondialdehyde (MDA), a product of lipid peroxidation.³⁶ Cerulein-, L-arginine-, or alcohol-induced MDA production was increased by addition of trypsin to the cell culture (Figure 1C). This increased MDA production was blocked by addition of the trypsin inhibitor STI (Figure 1C). Of note, trypsin-mediated cell death sensitivity and MDA production were completely reverted by ferroptosis inhibitors (eg, ferrostatin-1, liproxstatin-1, or 2-mercaptoethanol),³⁷ but not by inhibitors of apoptosis (eg, Z-VAD-FMK) or necroptosis (eg, necrosulfonamide) (Figure 1B and C). As a positive control, Z-VAD-FMK or necrosulfonamide inhibited cell death initiated by staurosporine (an apoptosis inducer³⁸) or CCT137690 (a necroptosis inducer³⁹) in 266-6 cells and mPACs, respectively (Figure 1D). Trypsin enhanced the cell death and MDA production triggered by classic ferroptosis inducers (eg, erastin or RSL3)³⁷ in 266-6 cells or mPACs, and these processes were blocked by ferrostatin-1, liproxstatin-1, 2-mercaptoethanol, or STI (Figure 1B and C). Altogether, these results indicate that the presence of trypsin sensitizes pancreatic acinar cells to the induction of ferroptosis.

Proteasome 26S Subunit, Non–Adenosine Triphosphatase 4–Dependent Lipid Peroxidation Promotes Ferroptosis in Acinar Cells

The proteasome is a large protein complex composed of 43 different subunits, which are jointly responsible for the selective degradation of proteins by proteolysis. The proteasome plays a dual (inhibitory or facilitatory) role in ferroptosis, depending on the specific substrate protein involved in the process.40, 41, 42, 43 To define the core components of the proteasome responsible for ferroptosis modulation in acinar cells, we used quantitative polymerase chain reaction (qPCR) to measure the levels of messenger RNAs (mRNAs) coding for the 43 proteasome subunits in 266-6 cells treated with cerulein alone or together with trypsin. The proteasome 26S subunit, non–adenosine triphosphatase 4 (Psmd4) ranked as the most up-regulated gene in 266-6 cells after treatment with cerulein plus trypsin (Figure 2A). In contrast, cerulein or trypsin alone did not cause significant up-regulation of Psmd4 mRNA in 266-6 cells and mPACs (Figure 2B).

To determine whether the proteasome 26S subunit, non–adenosine triphosphatase 4 (PSMD4) is involved in ferroptosis, we suppressed Psmd4 expression by specific short hairpin RNAs (shRNAs) (Figure 2C). In the presence of trypsin, the knockdown of Psmd4 limited the death of 266-6 cells caused by cerulein, L-arginine, alcohol, erastin, or RSL3 (Figure 2D). In contrast, transfection-enforced overexpression of Psmd4 (Figure 2C) restored the sensitivity of Psmd4-depleted 266-6 cells to these ferroptosis inducers (Figure 2D), confirming that PSMD4 is a positive regulator of ferroptosis in acinar cells.

Lipid peroxidation plays a major role in promoting ferroptosis owing to its implication in membrane damage as well as in DNA damage.⁴⁴ Oxidized phosphatidylethanolamine-polyunsaturated fatty acids, such as arachidonic acid (C20:4) and adrenic acid (C22:4), play a direct role in promoting ferroptosis.⁴⁵ We examined the effects of PSMD4 on the production of lipid peroxidation products, including MDA (Figure 2E), 8-hydroxy-2-deoxyguanosine (a product of oxidative DNA damage) (Figure 2F), C20:4 (Figure 2G), and C22:4 (Figure 2H). Of note, Psmd4 depletion blocked the generation of these lipid peroxidation products in 266-6 cells after treatment with cerulein, L-arginine, alcohol, erastin, or RSL3 in the presence of trypsin (Figure 2E–H). The measurement of lipid peroxidation products by means of the boron dipyrromethene difluoride (BODIPY) 581/591 C11 assay confirmed the decrease in oxidative reactions in Psmd4-knockdown 266-6 cells (Figure 2I). In contrast, Psmd4 knockdown failed to affect staurosporine- or CCT137690-induced cell death (Figure 2J). Moreover, cell death induced by erastin or RSL3 alone was not influenced by Psmd4 knockdown in 266-6 cells (Figure 2J). Altogether, these findings support the interpretation that PSMD4 selectively promotes trypsin-related ferroptosis by inducing lipid peroxidation.

PSMD4-Dependent Glutathione Peroxidase 4 Degradation Promotes Ferroptosis in Acinar Cells

Glutathione peroxidase 4 (GPX4) is a key antioxidant enzyme that detoxifies lipid peroxides during ferroptosis.^46,47 Accordingly, GPX4 degradation by proteasomes or autophagy favors the induction of ferroptosis.^42,48 Driven by these considerations, we determined whether PSMD4 might affect GPX4 degradation in acinar cells. Western blot and qPCR analysis showed that, after treatment with cerulein in the presence of trypsin, the protein levels of GPX4 (but not the mRNA levels of Gpx4) were reduced in control cells, but not in Psmd4-depleted 266-6 cells (Figure 3A and B). These results indicate that, in acinar cells, PSMD4 inhibits cerulein-/trypsin-induced down-regulation of GPX4 protein, but not Gpx4 mRNA.

The selective autophagic degradation of the iron storage protein ferritin,⁴⁹ the circadian clock regulator aryl hydrocarbon receptor nuclear translocator-like (ARNTL, best known as brain and mMuscle ARNT-like 1 [BMAL1]),⁵⁰ and the iron export protein solute carrier family 40 member 1 (SLC40A1, also known as ferroportin-1)⁵¹ all promote ferroptosis. However, the knockdown of Psmd4 failed to affect the protein expression of ferritin heavy chain 1, ARNTL, and SLC40A1 during cerulein-/trypsin-induced ferroptosis (Figure 3C), indicating that PSMD4 is not required for autophagy-dependent ferroptosis.^51,52 Other important regulators of ferroptosis, such as apoptosis inducing factor mitochondria-associated 2 (an oxidoreductase involved in producing reduced coenzyme Q10 [CoQ10])53, 54, 55 and SLC7A11 (a subunit of the cystine/glutamate antiporter system xc^– that promotes cystine uptake and glutathione [GSH] biosynthesis),³⁷ also remained unaffected by PSMD4 (Figure 3C). Accordingly, the knockdown of Psmd4 failed to affect the intracellular levels of iron, GSH, and CoQ10, as well as the mRNA expression of Egln2 (an ARNTL-targeted gene involved in ferroptosis⁵⁰) in cerulein-/trypsin-treated 266-6 cells (Figure 3D–G).

In the early stages of the induction of ferroptosis by cerulein/trypsin, a protein complex containing PSMD4 and GPX4 was observed in 266-6 cells (Figure 3H). Functionally, the knockdown of Gpx4 by shRNAs (Figure 3I) restored the sensitivity of Psmd4-depleted 266-6 cells to ferroptosis (Figure 3J), which was associated with increased lipid peroxidation (Figure 3K), C20:4 (Figure 3L), or C22:4 (Figure 3M). Altogether, these findings indicate that PSMD4-mediated GPX4 degradation promotes lipid peroxidation-mediated ferroptosis in pancreatic acinar cells.

Olanzapine Is a New Ferroptosis Inhibitor in Acinar Cells

Most ferroptosis inhibitors are experimental drugs (eg, ferrostatin-1 or liproxstatin-1), but have not been characterized yet in clinical trials.⁵⁶ Driven by this consideration, we screened a library of 1080 Food and Drug Administration–approved drugs for their capacity to inhibit ferroptosis caused by cerulein/trypsin in 266-6 cells. The top 5 compounds that blocked cerulein-/trypsin-induced cell death included olanzapine (an antipsychotic drug), idebenone (a synthetic analogue of CoQ10), telmisartan (an angiotensin II receptor blocker), nisoldipine (a calcium channel blocker), and azelnidipine (a dihydropyridine calcium channel blocker) (Figure 4A). These top 5 drugs were evaluated further in 266-6 cells or mPACs challenged with trypsin combined with cerulein, L-arginine, alcohol, erastin, or RSL. These results confirmed that olanzapine and idebenone can suppress ferroptosis in various conditions (Figure 4B ). Given that CoQ10 already has been characterized as a ferroptosis inhibitor,^53,54 we focused on olanzapine in subsequent studies.

Although the mechanism of action of olanzapine is unknown, it has been proposed that its antipsychotic action involves the inhibition of serotonin type 2 (5-hydroxytryptamine 2) receptors, including HTR2A/5-HT2A, HTR2B/5-HT2B, and HTR2C/5-HT2C. Unlike olanzapine, selective antagonists of HTR2A (risperidone), HTR2B (SB204741), or HTR2C (SB242084) failed to inhibit cerulein-/trypsin-induced ferroptotic death in 266-6 cells or mPACs (Figure 4C), suggesting that olanzapine acts through off-target effects to block ferroptosis. Indeed, the knockdown of Htr2a, Htr2b, and Htr2c by shRNAs also failed to affect cerulein-/trypsin-induced cell death in 266-6 cells (Figure 4D and E). As a positive control, the knockdown of ferroptotic promoter Acsl4^45,57,58 inhibited cerulein-/trypsin-induced cell death in 266-6 cells (Figure 4D and E).

We used the 2,2-diphenyl-1-picrylhydrazyl (DPPH) free radical scavenging assay in a cell-free system to determine whether the off-target activity of olanzapine involves antioxidant effects. Similar to ferrostatin-1 (positive control), the olanzapine-mediated suppression of ferroptosis correlated with its antioxidant activity (Figure 4F). In contrast, the 5-hydroxytryptamine 2 antagonists (risperidone, SB204741, and SB242084) failed to show such antioxidant effects (Figure 4F). Moreover, olanzapine inhibited cerulein-/trypsin-induced lipid peroxidation (Figure 4G), C20:4 (Figure 4H), and C22:4 (Figure 4I). In contrast, olanzapine had no significant impact on cerulein-/trypsin-induced GPX4 degradation in 266-6 cells (Figure 4J). Collectively, these data suggest that olanzapine protects against ferroptotic cell death through antioxidant effects.

Ferroptotic Damage Increases the Severity of Acute Pancreatitis in Mice

We recently showed that the conditional knockout (KO) of Gpx4 within the pancreas of mice (termed KO mice) accelerated cerulein-induced acute pancreatitis by ferroptotic damage.³² We used this model to evaluate whether olanzapine protects against ferroptosis-induced acute pancreatitis. Histologic assessment of pancreatic damage showed exaggerated acinar cell death, leukocyte infiltration, and interstitial edema in the KO mice compared with control mice (termed wild-type [WT] mice) (Figure 5A). These histologic changes were accompanied by significantly increased levels of pancreatitis parameters, including the activation of the endoplasmic reticulum stress signaling pathway (as measured by mRNA expression of pancreatic heat shock protein family A member 5 [Hspa5, also known as Bip or Grp78]) (Figure 5B), serum amylase (Figure 5C), pancreatic trypsin activity (Figure 5D), pancreatic neutrophil recruitment (as measured by pancreatic myeloperoxidase [MPO] activity) (Figure 5E), pancreatic necrosis (as reflected by serum lactate dehydrogenase [LDH] and high mobility group box 1 [HMGB1]) (Figure 5F and G, respectively), and serum trypsin activity (Figure 5H). The pancreatic expression of biomarkers of ferroptosis (eg, Ptgs2 and Acsl4) (Figure 5I and J, respectively), but not biomarkers of apoptosis (eg, cleaved caspase-3) (Figure 5K) and necroptosis (eg, phosphorylated mixed-lineage kinase domain-like pseudokinase [p-MLKL]) (Figure 5L), were increased in cerulein-treated KO mice. As expected, the level of pancreatic MDA was increased in cerulein-treated KO mice (Figure 5M). The administration of olanzapine protected against all features of cerulein-induced acute pancreatitis in mice (especially KO mice), meaning that it prevented pancreatic dysfunction, tissue injury, inflammation, ferroptosis, and MDA production (Figure 5).

Ferroptotic Damage Accelerates the Development of Chronic Pancreatitis in Mice

Epidemiologic studies have shown that high alcohol consumption is associated with an increased risk of pancreatitis.⁵⁹ To further determine the interaction between ferroptosis and clinically relevant environmental insults, we first assessed the effects of pancreatic Gpx4 deletion on chronic pancreatitis initiated by a Lieber–DeCarli alcoholic liquid diet. Ethanol feeding caused histologic changes in the pancreas in 15% (3 of 20) of WT mice (Figure 6A). In contrast, ethanol feeding led to the development of chronic inflammatory changes and pancreatic tissue injury in 85% (17 of 20) of KO mice (Figure 6A). Pancreatic fibrosis, a feature of chronic pancreatitis, also was increased in KO mice (Figure 6A). Accordingly, serum amylase, LDH, HMGB1, pancreatic MPO and trypsin activity, serum trypsin activity, pancreatic Ptgs2 and Acsl4 mRNA expression, as well as serum cytokines (tumor necrosis factor, interleukin 6 [IL6], and IL1β [IL1B]) were increased in KO mice compared with WT mice (Figure 6B–M). This Gpx4 depletion-mediated chronic pancreatitis response was blocked by olanzapine, further supporting the hypothesis that ferroptotic damage promotes the development of chronic pancreatitis. As a control, Gpx4 depletion and olanzapine had no effects on biomarkers of apoptosis (cleaved caspase-3) or necroptosis (p-MLKL) (Figure 6N and O).

Reagents

Erastin (S7242), RSL3 (S8155), ferrostatin-1 (S7243), liproxstatin-1 (S7699), Z-VAD-FMK (S7023), necrosulfonamide (S8251), staurosporine (S1421), CCT137690 (S2744), olanzapine (S2493), idebenone (S2605), telmisartan (S1738), nisoldipine (S1748), azelnidipine (S3053), and risperidone (S1615) were obtained from Selleck Chemicals (Houston, TX). Cerulein (C9026), L-arginine (A5006), alcohol (PHR1373), 2-mercaptoethanol (M6250), trypsin (T1426), soybean trypsin inhibitor (650357), SB204741 (S0693), and SB242084 (5.06417) were obtained from Sigma-Aldrich (Burlington, MA). Dimethyl sulfoxide (472301; Sigma-Aldrich) was used to prepare the stock solution of most drugs. The final concentration of dimethyl sulfoxide in the drug working solution in the cells was less than 0.01%. In addition, 0.01% dimethyl sulfoxide was used as a vehicle control in the corresponding cell culture assays.

The antibodies to PSMD4 (sc-398033) and actin beta (ACTB, sc-8432) were obtained from Santa Cruz Biotechnology (Dallas, TX). The antibodies to GPX4 (ab125066) and SLC7A11 (ab175186) were obtained from Abcam (Cambridge, MA). The antibodies to ferritin heavy chain 1 (3998) and ARNTL (14020) were obtained from Abcam. The antibodies to SLC40A1 (NBP1-21502) and apoptosis inducing factor mitochondria-associated 2 (H00084883-D01P) were obtained from NOVUS (Saint Charles, MO).

Pancreatitis Models

The protocol for animal use was reviewed and approved by our institutional animal care and use committees. Pancreatic-specific Gpx4 knockout mice were produced and identified in our laboratory by crossing floxed Gpx4 (a gift from Dr Qitao Ran, University of Texas Health, San Antonio, TX) and Pdx1-Cre (014647; The Jackson Laboratory, Bar Harbor, ME) transgenic mice (C57BL/6J background) as previously described.³² Mouse were kept under standard pathogen-free conditions with an artificial 12-hour light/dark cycle (lights on: 8:00 AM) and constant 50%–60% humidity. Mice were allowed access to tap water and free (ad libitum) access to standard laboratory chow during the experimental period.

For cerulein-induced acute pancreatitis, male mice (age, 8–10 wk) received 7 hourly intraperitoneal injections of 50 μg/kg cerulein in sterile saline.⁸³ Olanzapine was repeatedly administered orally by gavage at a dose of 5 mg/kg to mice at 3 and 12 hours after the first cerulein injection, while controls were treated by oral administration with vehicle (smooth peanut butter).⁸⁴ The parameters of acute pancreatitis were assessed 12 hours after the last cerulein treatment. For the induction of chronic pancreatitis, male mice (age, 8–10 wk) were fed a Lieber–DeCarli ethanol (5% vol/vol) liquid diet for 4 weeks (F1258; Bio-Serv, Flemington, NJ).⁸⁵ In parallel, olanzapine was administered orally by gavage at a dose of 5 mg/kg to mice (3 times per week, over 4 weeks), while controls were treated by oral administration with vehicle. The parameters of chronic pancreatitis were assessed in mice 4 weeks after feeding them the Lieber–DeCarli ethanol liquid diet.

Animals were killed at the indicated time by CO₂ asphyxia, and a blood sample and tissue were collected. Serum was collected further immediately after centrifugation at 10,000 × g for 5 minutes at 4°C. Tissue samples were collected, snap-frozen in liquid nitrogen, and stored at -80°C. Formalin-fixed pancreas samples were processed, and 5-μm–thick paraffin sections were stained with H&E for histologic analysis. Pancreatitis was scored according to a revised scoring standard,⁸⁶ with an independent pathologist evaluating histologic scores for acinar cell death, leukocyte infiltration, or edema in a blind manner. Histologic images were acquired using an EVOS FL Auto Cell Imaging System (Thermo Fisher Scientific, Pittsburgh, PA).

Cell Culture

The 266-6 (CRL-2151) cell line was obtained from the American Type Culture Collection and cultured in Dulbecco's modified Eagle medium (11995073; Thermo Fisher Scientific) supplemented with 10% heat-inactivated fetal bovine serum (A3840001; Thermo Fisher Scientific) and 1% penicillin and streptomycin (15070-063; Thermo Fisher Scientific) at 37°C, 95% humidity, and 5% CO₂. Primary mouse acinar cells were cultured as described below. Briefly, the pancreas from male C57BL/6J mice (age, 8–10 wk) was removed and minced for 5 minutes in Hank's balanced salt solution (H8264; Sigma-Aldrich) plus 0.1% bovine serum albumin (05470; Sigma-Aldrich) and 10 mmol/L HEPES (PHG0001; Sigma-Aldrich). After washing, the pancreatic segments were incubated in 10 mL collagenase IA solution (Hank's balanced salt solution 1× containing 10 mmol/L HEPES, 200 U/mL of collagenase IA [C9891; Sigma-Aldrich], and 0.25 mg/mL of trypsin inhibitor) for 20–30 minutes at 37°C. The solution containing collagenase then was removed and replaced with Dulbecco's modified Eagle medium supplemented with 1% penicillin and streptomycin, 10% fetal bovine serum, 0.25 mg/mL trypsin inhibitor, and 25 ng/mL recombinant mouse epidermal growth factor (E5160; Sigma-Aldrich) at 37°C, 95% humidity, and 5% CO₂. Cell line identity was validated by short tandem repeat profiling, and routine mycoplasma testing was negative for contamination.

Western Blot Analysis

Cells were lysed 3 times with 1× cell lysis buffer (9803; Cell Signaling Technology, Danvers, MA) containing protease inhibitor cocktail (P8340; Sigma-Aldrich) on ice for 10 minutes. Protein was quantified using the bicinchoninic acid assay (23225; Thermo Fisher Scientific) and 20–30 μg of each sample was resolved on 4%–12% Criterion XT Bis-Tris gels (3450124; Bio-Rad) in XT MES running buffer (1610789; Bio-Rad) and transferred to polyvinylidene difluoride membranes (1620233; Bio-Rad) using the Trans-Blot Turbo Transfer Pack and System (1704150; Bio-Rad). Membranes were blocked with Tris-buffered saline with 0.1% Tween 20 detergent (TBST) containing 5% nonfat milk (9999; Cell Signaling Technology) for 1 hour and incubated overnight at 4°C with various primary antibodies (1:500–1:1000). After 3 washes in TBST, membranes were incubated with goat anti-rabbit or anti-mouse IgG horseradish peroxidase–conjugated secondary antibody (1:1000, 7074 or 7076; Cell Signaling Technology) at room temperature for 1 hour. After being washed with TBST, the signals were visualized using enhanced chemiluminescence (32106; Thermo Fisher Scientific) and then visualized and analyzed with a ChemiDoc Touch Imaging System (Bio-Rad).

Immunoprecipitation Analysis

Cells were lysed at 4°C in pre-cold radioimmunoprecipitation assay lysis buffer (9806; Cell Signaling Technology) and cell lysates were cleared by brief centrifugation (12,000 × g for 10 minutes).⁸⁷ Concentrations of proteins in the supernatant were determined by bicinchoninic acid assay (23225; Thermo Fisher Scientific). Before immunoprecipitation, samples containing equal amounts of proteins were precleared with protein A agarose beads (9863; Cell Signaling Technology) at 4°C for 3 hours and subsequently incubated with irrelevant IgG or specific antibodies (5 μg/mL) in the presence of protein A agarose beads overnight at 4°C with gentle shaking. After incubation, protein A agarose beads were washed extensively with phosphate-buffered saline and proteins were eluted by boiling in 2 × Laemmli sample buffer (161-0737; Bio-Rad) before sodium dodecyl sulfate–polyacrylamide gel electrophoresis.

Cytotoxicity Assays

A Countess II FL Automated Cell Counter (Thermo Fisher Scientific) was used to assay the percentage of dead cells after cell staining with 0.4% trypan blue solution (T10282; Thermo Fisher Scientific). Cells were suspended as single cells in buffered saline. If cell clumps (especially primary acinar cells) were seen in the sample tube, these samples were filtered with nylon mesh to remove aggregates. Samples then were prepared by adding 10 μL of cell suspension to 10 μL of 0.4% trypan blue stain.

Food and Drug Administration–Approved Drug Screening

The Food and Drug Administration–approved drug library was obtained from Selleck Chemicals (L1300). The 266-6 cells were seeded into 96-well plates and then treated with cerulein (100 nmol/L)/trypsin (500 ng/mL) in the absence or presence of a drug (10 μmol/L) for 24 hours. Subsequently, 100 μL fresh medium was added to cells containing 10 μL Cell Counting Kit-8 (CCK-8) solutions (CK04; Dojindo Laboratories, Rockville, MD) and incubated for 2 hours (37°C, 5% CO₂). Cell viability was measured at 450-nm absorbance using a microplate reader (Cytation 5 Cell Imaging Multi-Mode Reader, Winooski, VA). The effects of top drug candidates on cerulein-/trypsin-induced cell death in 266-6 cells were assayed further using a Countess II FL Automated Cell Counter.

Quantitative Real-Time Polymerase Chain Reaction Assay

Total RNA was extracted and purified from cultured cells using the RNeasy Plus Mini Kit (74136; QIAGEN, Germantown, MD). First-strand complementary DNA (cDNA) was synthesized from 1 μg RNA using the iScript cDNA Synthesis Kit (1708890; Bio-Rad). Briefly, 20-μL reactions were prepared by combining 4 μL iScript Select reaction mix, 2 μL gene-specific enhancer solution, 1 μL reverse transcriptase, 1 μL gene-specific assay pool (20×, 2 μmol/L), and 12 μL RNA diluted in RNase-free water. Then cDNA from various cell samples was amplified by real-time qPCR with specific primers using a CFX96 Touch Real-Time PCR Detection System (Bio-Rad) with CFX Manager software 2.0 (Bio-Rad). The data were normalized to Rna18S and the fold change was calculated via the 2-ΔΔCt method. The relative concentrations of mRNA were expressed in arbitrary units based on the untreated group, which was assigned a value of 1. The predesigned primers were obtained from OriGene Technologies (Rockville, Maryland, USA).

RNAi and Gene Transfection

Psmd4 shRNA (GTACCGGGAAACTAGCTAAACGCCTTAACTCGAGTTAAGGCGTTTAGCTAGTTTCTTTTTTG), Gpx4 shRNA (CCGGCCGGCTACAACGTCAAGTTTGCTCGAGCAAACTTGACGTTGTAGCCGGTTTTTG), Htr2a shRNA (CCGGCCCACTGGTATATACGTTGTTCTCGAGAACAACGTATATACCAGTGGGTTTTT), Htr2b shRNA (CCGGGCGGTGATAATACCCACCATTCTCGAGAATGGTGGGTATTATCACCGCTTTTT), Htr2c shRNA (CCGGGCTTCCAAAGTCCTTGGCATTCTCGAGAATGCCAAGGACTTTGGAAGCTTTTT), and Acsl4 shRNA (CCGGGCAGAAGATTATTGTGTTGATCTCGAGATCAACACAATAATCTTCTGCTTTTT) were obtained from Sigma-Aldrich. Psmd4 cDNA (MC200621) was obtained from OriGene Technologies. The shRNA or indicated cDNA were transfected into cells using Lipofectamine 3000 (L3000-015; Invitrogen, Pittsburgh, PA) or Lipofectamine RNAiMAX (13778030; Invitrogen) when cells were at approximately 60%–70% confluence. Puromycin (ant-pr-1; InvivoGen, San Diego, CA) was used to generate stable knockdown cell lines. The efficiency of RNAi and gene transfection was verified by reverse-transcription PCR or Western blot.

Enzyme-Linked Immunosorbent Assay Analysis

The concentrations or activity of amylase (ab102523; Abcam), MPO (EMMPO; Thermo Fisher Scientific), trypsin (ab102531; Abcam), 8-hydroxy-2-deoxyguanosine (K4160; BioVision, Milpitas, CA), HMGB1 (326054329; Sino-Test Corporation, Tokyo, Japan), LDH (ab102526; Abcam), cleaved-caspase3 (DYC835-2; R&D Systems, Minneapolis, MN), p-MLKL (PEL-MLKL-S345-1; RayBiotech Life, Norcross, GA), MDA (ab118970; Abcam), iron (MAK025; Sigma-Aldrich), GSH (CS0260; Sigma-Aldrich), CoQ10 (MBS7233016; MyBioSource, San Diego, CA), tumor necrosis factor (BMS607-3; Thermo Fisher Scientific), IL6 (BMS603-2; Thermo Fisher Scientific), and IL1B (BMS6002; Thermo Fisher Scientific) in the indicated samples were measured using enzyme-linked immunosorbent assay kits according to the manufacturer's guidelines. Data were normalized to protein or DNA concentration.

Lipid Peroxidation Assay

BODIPY 581/591 C11 probe (D3861; Thermo Fisher Scientific) was used to detect lipid peroxidation according to the manufacturer’s instructions. Briefly, cells were incubated with BODIPY 581/591 C11 at a final concentration of 5 μmol/L for 30 minutes at 37°C and washed 3 times with phosphate-buffered saline. Oxidation of the polyunsaturated butadienyl portion of the dye resulted in a shift of the fluorescence emission peak from approximately 590 nm to approximately 510 nm, which was measured in a Bio-Tek fluorescence microplate reader (Winooski, VA).

DPPH Radical Scavenging Assay

The free radical scavenging ability of the indicated drugs was tested by a DPPH radical scavenging assay. DPPH produces purple/violet in methanol solution and fades to yellow in the presence of antioxidants. Briefly, a reaction mixture containing 2.4 mL of 0.1 mmol/L DPPH in methanol and 1.6 mL of tested drugs (1 μmol/L ferrostatin-1, 10 μmol/L olanzapine, 10 μmol/L risperidone, 10 μmol/L SB204741, and 10 μmol/L SB242084) was incubated in a dark environment at 25°C for 30 minutes. The optical absorbance at 517 nm of the mixture was measured in triplicate after centrifugation. The DPPH radical scavenging activity was expressed in arbitrary units based on the untreated group, which was assigned a value of 1. Ferrostatin-1 was used as a positive control.

Liquid Chromatography with Tandem Mass Spectrometry Method for Lipid Analysis

Reverse-phase chromatography was selected for LC separation using the CSH C18 column (1.7 μm, 2.1 mm × 100 mm; Waters Corp, Milford, MD). The lipid extracts were re-dissolved in 200 μL 90% isopropanol/acetonitrile, centrifuged at 14,000 × g for 15 minutes, and finally 3 μL of sample was injected. Solvent A was acetonitrile–water (6:4, vol/vol) with 0.1% formic acid and 0.1 mmol/L ammonium formate and solvent B was acetonitrile–isopropanol (1:9, vol/vol) with 0.1% formic acid and 0.1 mmol/L ammonium formate. The initial mobile phase was 30% solvent B at a flow rate of 300 μL/min. It was held for 2 minutes, and then increased linearly to 100% solvent B in 23 minutes, followed by equilibrating at 5% solvent B for 10 minutes.

Mass spectra were acquired with Q-Exactive Plus (Pittsburgh, PA) in positive and negative mode, respectively. Electrospray ionization (ESI) parameters were optimized and preset for all measurements as follows: source temperature, 300°C; capillary temperature, 350°C; ion spray voltage, 3000 V; S-lens RF level, 50%; and the scan range of the instruments, 200–1800 m/z. LipidSearch Software 5.0 (Thermo Fisher Scientific) was used to identify lipid species based on MS/MS data. The control group was assigned a value of 1, and the treatment group then was calculated relative to the control group.

Statistical Analysis

Data are presented as means ± SD except where otherwise indicated. GraphPad Prism 8.4.3 (San Diego, CA) was used to collect and analyze data. A t test was used to compare the means of 2 groups. A 1-way or 2-way analysis of variance with the Tukey multiple comparisons test was used for comparison among the different groups. A P value less than .05 was considered statistically significant. We did not exclude samples or animals. For every figure in this article, statistical tests are justified when appropriate. All data meet the assumptions of the tests (eg, normal distribution).