Isolation of two E-box binding factors that interact with the rat tyrosine hydroxylase enhancer
- PMID: 7913462
Isolation of two E-box binding factors that interact with the rat tyrosine hydroxylase enhancer
Abstract
The enhancer of the rat tyrosine hydroxylase gene (TH) in PC8b cells is composed of the AP1 motif (TCATTCA, -205 to -199) and an overlapping 20-base pair dyad symmetry element (TCAGAGGCAGGTGCCTGTGA, -201 to -182) whose core is an E-box. We have isolated two partial cDNA clones that encode factors which bind the TH-dyad. One is rITF2 with a basic helix-loop-helix motif and the other is CDP2 with a homeodomain. rITF2 is a rat homolog of human ITF2 (or E2-2), and CDP2 is a member of a new family of homeoproteins defined by histidine as the 9th residue of the recognition helix and by unique 64 amino acid repeats related to those of the Drosophila cut gene. The binding affinity of CDP2 alone is relatively weak, but it enhances the binding of rITF2 to the TH-dyad. In transfected F9 cells, activation of a TH-driven reporter requires both rITF2 and CDP2, suggesting that the proteins may functionally interact. However, rITF2 and CDP2 are not restricted to TH-expressing tissues; hence they may not be involved in the tissue-specific expression of TH. In addition, CDP2 is phosphorylated in vitro and in vivo.
Similar articles
-
Helix-loop-helix transcriptional activators bind to a sequence in glucocorticoid response elements of retrovirus enhancers.J Virol. 1991 Nov;65(11):6084-93. doi: 10.1128/JVI.65.11.6084-6093.1991. J Virol. 1991. PMID: 1681116 Free PMC article.
-
Sequences distal to the AP1/E box motif are involved in the cell type-specific expression of the rat tyrosine hydroxylase gene.J Neurochem. 1994 May;62(5):1691-7. doi: 10.1046/j.1471-4159.1994.62051691.x. J Neurochem. 1994. PMID: 7908942
-
Regulation of human P2X1 promoter activity by beta helix-loop-helix factors in smooth muscle cells.Gene. 2001 May 16;269(1-2):167-75. doi: 10.1016/s0378-1119(01)00442-5. Gene. 2001. PMID: 11376948
-
A splice variant of the ITF-2 transcript encodes a transcription factor that inhibits MyoD activity.J Biol Chem. 1996 Feb 16;271(7):3555-61. doi: 10.1074/jbc.271.7.3555. J Biol Chem. 1996. PMID: 8631961
-
Murine helix-loop-helix transcriptional activator proteins binding to the E-box motif of the Akv murine leukemia virus enhancer identified by cDNA cloning.Mol Cell Biol. 1992 Aug;12(8):3449-59. doi: 10.1128/mcb.12.8.3449-3459.1992. Mol Cell Biol. 1992. PMID: 1321336 Free PMC article.
Cited by
-
Whole-Organism Developmental Expression Profiling Identifies RAB-28 as a Novel Ciliary GTPase Associated with the BBSome and Intraflagellar Transport.PLoS Genet. 2016 Dec 8;12(12):e1006469. doi: 10.1371/journal.pgen.1006469. eCollection 2016 Dec. PLoS Genet. 2016. PMID: 27930654 Free PMC article.
-
TCF4-mediated Fuchs endothelial corneal dystrophy: Insights into a common trinucleotide repeat-associated disease.Prog Retin Eye Res. 2021 Mar;81:100883. doi: 10.1016/j.preteyeres.2020.100883. Epub 2020 Jul 28. Prog Retin Eye Res. 2021. PMID: 32735996 Free PMC article. Review.
-
ZENON, a novel POZ Kruppel-like DNA binding protein associated with differentiation and/or survival of late postmitotic neurons.Mol Cell Biol. 2005 Mar;25(5):1713-29. doi: 10.1128/MCB.25.5.1713-1729.2005. Mol Cell Biol. 2005. PMID: 15713629 Free PMC article.
-
Transcription factor 4 and its association with psychiatric disorders.Transl Psychiatry. 2021 Jan 5;11(1):19. doi: 10.1038/s41398-020-01138-0. Transl Psychiatry. 2021. PMID: 33414364 Free PMC article. Review.
-
CDP/Cux stimulates transcription from the DNA polymerase alpha gene promoter.Mol Cell Biol. 2003 Apr;23(8):3013-28. doi: 10.1128/MCB.23.8.3013-3028.2003. Mol Cell Biol. 2003. PMID: 12665598 Free PMC article.
Publication types
MeSH terms
Substances
Associated data
- Actions
- Actions
Grants and funding
LinkOut - more resources
Full Text Sources
Other Literature Sources
Molecular Biology Databases
Miscellaneous
