The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus
- PMID: 6780979
- PMCID: PMC324311
- DOI: 10.1093/nar/8.22.5423
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus
Abstract
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.
Similar articles
-
Comparative studies on bacterial 5S ribosomal RNA.Arch Biochem Biophys. 1973 May;156(1):104-11. doi: 10.1016/0003-9861(73)90346-9. Arch Biochem Biophys. 1973. PMID: 4354230 No abstract available.
-
A physical study of acidic ribosomal proteins from Artemia salina, Bacillus subtilis and Micrococcus lysodeikticus.FEBS Lett. 1981 Dec 28;136(2):235-8. doi: 10.1016/0014-5793(81)80625-4. FEBS Lett. 1981. PMID: 6799326 No abstract available.
-
Is wheat mitochondrial 5S ribosomal RNA prokaryotic in nature?Nucleic Acids Res. 1981 Jul 24;9(14):3523-9. doi: 10.1093/nar/9.14.3523. Nucleic Acids Res. 1981. PMID: 7024917 Free PMC article.
-
[5S RNA: structure and function].Usp Sovrem Biol. 1978 Jul-Aug;86(1):3-18. Usp Sovrem Biol. 1978. PMID: 152015 Review. Russian. No abstract available.
-
Ribosome structure.Annu Rev Biochem. 1978;47:217-49. doi: 10.1146/annurev.bi.47.070178.001245. Annu Rev Biochem. 1978. PMID: 354495 Review. No abstract available.
Cited by
-
Collection of published 5S and 5.8S ribosomal RNA sequences.Nucleic Acids Res. 1984;12 Suppl(Suppl):r133-66. doi: 10.1093/nar/12.suppl.r133. Nucleic Acids Res. 1984. PMID: 6728686 Free PMC article. No abstract available.
-
The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8.Nucleic Acids Res. 1981 Oct 10;9(19):5159-62. doi: 10.1093/nar/9.19.5159. Nucleic Acids Res. 1981. PMID: 6171775 Free PMC article.
-
Collection of published 5S and 5.8S ribosomal RNA sequences.Nucleic Acids Res. 1983 Jan 11;11(1):r105-33. Nucleic Acids Res. 1983. PMID: 6866760 Free PMC article. No abstract available.
-
Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.J Bacteriol. 1984 Jul;159(1):233-7. doi: 10.1128/jb.159.1.233-237.1984. J Bacteriol. 1984. PMID: 6735981 Free PMC article.
-
Consensus structure and evolution of 5S rRNA.Nucleic Acids Res. 1983 Feb 11;11(3):893-900. doi: 10.1093/nar/11.3.893. Nucleic Acids Res. 1983. PMID: 6835839 Free PMC article.
References
Publication types
MeSH terms
Substances
Associated data
- Actions
LinkOut - more resources
Full Text Sources