Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
Comparative Study
. 1980 Nov 25;8(22):5423-6.
doi: 10.1093/nar/8.22.5423.

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus

Free PMC article
Comparative Study

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus

H Hori et al. Nucleic Acids Res. .
Free PMC article

Abstract

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.

PubMed Disclaimer

Similar articles

Cited by

References

    1. Nature. 1967 Aug 12;215(5102):735-6 - PubMed
    1. Prog Nucleic Acid Res Mol Biol. 1972;12:49-85 - PubMed
    1. Nature. 1975 Aug 7;256(5517):505-7 - PubMed
    1. Methods Cell Biol. 1975;12:45-64 - PubMed
    1. J Biol Chem. 1976 May 25;251(10):3122-7 - PubMed

Publication types

Associated data