Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 1986 Nov;83(21):8112-6.
doi: 10.1073/pnas.83.21.8112.

Requirement of multiple copies of a 21-nucleotide sequence in the U3 regions of human T-cell leukemia virus type I and type II long terminal repeats for trans-acting activation of transcription

K Shimotohno, M Takano, T Teruuchi, M Miwa

Requirement of multiple copies of a 21-nucleotide sequence in the U3 regions of human T-cell leukemia virus type I and type II long terminal repeats for trans-acting activation of transcription

K Shimotohno et al. Proc Natl Acad Sci U S A. 1986 Nov.

Abstract

The cis-acting regulatory sequence of transcription from long terminal repeats (LTRs) of human T-cell leukemia virus type I and type II (HTLV-I and HTLV-II), which is essential for action of the virally encoded trans-acting transcriptional factor(s) designated pX(s), in HTLV-I and -II was identified. Deletion of most of the U3 region of the HTLV-I LTR resulted in loss of trans-acting transcriptional activation. However, when a tandem repeat of a 21-nucleotide sequence (GAAGGCTCTGACGTCTCCCCC) that is present in the U3 region of HTLV-I and -II LTRs was inserted into the deleted U3 region of the HTLV-I LTRs, chloramphenicol acetyltransferase activity was restored. The extent of restoration of activity was proportional to the number of copies of the sequence inserted. To test the possibility that the 21-nucleotide sequence alone is necessary for trans-activation, a sequence (AGGAACTGAAA) homologous to a type-specific viral enhancer sequence and present in the U3 region of HTLV-II LTR, but not in the same region of the HTLV-I LTR, was inserted together with the 21-nucleotide sequence into the deleted U3 region of the HTLV-I LTR. However, no significant differences of the levels of activities of those LTRs compared to the LTRs with only the 21-nucleotide sequence repeats were observed.

PubMed Disclaimer

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Nature. 1985 Dec 12-18;318(6046):571-4 - PubMed
    1. Proc Natl Acad Sci U S A. 1985 Oct;82(19):6502-6 - PubMed
    1. Proc Natl Acad Sci U S A. 1985 Dec;82(24):8359-63 - PubMed
    1. Jpn J Cancer Res. 1985 Dec;76(12):1127-31 - PubMed
    1. J Virol. 1986 Mar;57(3):738-44 - PubMed

Publication types

Substances

LinkOut - more resources