Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 1989 Oct;63(10):4354-61.
doi: 10.1128/JVI.63.10.4354-4361.1989.

Nucleotide sequence required for resolution of the concatemer junction of vaccinia virus DNA

M Merchlinsky  1 , B Moss
Affiliations

Nucleotide sequence required for resolution of the concatemer junction of vaccinia virus DNA

M Merchlinsky et al. J Virol. 1989 Oct.

Abstract

The mature form of the vaccinia virus genome consists of a linear, 185,000-base-pair (bp) DNA molecule with a 10,000-bp inverted terminal repetition and incompletely base-paired 104-nucleotide hairpin loops connecting the two strands at each end. In concatemeric forms of intracellular vaccinia virus DNA, the inverted terminal repetitions of adjacent genomes form an imperfect palindrome. The apex of this palindrome corresponds in sequence to the double-stranded form of the hairpin loop. Circular plasmids containing palindromic concatemer junction fragments of 250 bp or longer are converted into linear minichromosomes with hairpin ends when they are transfected into vaccinia virus-infected cells, providing a model system with which to study the resolution process. To distinguish between sequence-specific and structural requirements for resolution, plasmids with symmetrical insertions, deletions, and oligonucleotide-directed mutations within the concatemer junction were constructed. A sequence (ATTTAGTGTCTAGAAAAAAA) located on both sides of the apex segment was found to be critical for resolution. Resolution was more efficient when additional nucleotides, TGTG, followed the run of A residues. Both the location and sequence of the proposed resolution signal are highly conserved among poxviruses.

PubMed Disclaimer

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. J Biol Chem. 1987 Oct 25;262(30):14826-36 - PubMed
    1. J Virol. 1987 Jun;61(6):1957-63 - PubMed
    1. J Mol Biol. 1987 Aug 5;196(3):541-58 - PubMed
    1. J Mol Biol. 1988 Feb 5;199(3):399-413 - PubMed
    1. J Biol Chem. 1989 Jan 5;264(1):443-9 - PubMed

Associated data

LinkOut - more resources