Skip to main page content
U.S. flag

An official website of the United States government

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2011 Apr;173(1):1-6.
doi: 10.1016/j.jviromet.2010.12.014. Epub 2010 Dec 24.

Strand-specific real-time RT-PCR for distinguishing influenza vRNA, cRNA, and mRNA

Eiryo Kawakami  1 , Tokiko Watanabe, Ken Fujii, Hideo Goto, Shinji Watanabe, Takeshi Noda, Yoshihiro Kawaoka
Affiliations

Strand-specific real-time RT-PCR for distinguishing influenza vRNA, cRNA, and mRNA

Eiryo Kawakami et al. J Virol Methods. 2011 Apr.

Abstract

Real-time RT-PCR is used to quantify individual influenza viral RNAs. However, conventional real-time RT-PCR, using strand-specific primers, has been shown to produce not only the anticipated strand-specific products, but also substantial amounts of non-strand-specific products, indicating lack of specificity. Therefore, in this study, a novel strand-specific real-time RT-PCR method was established to quantify the three types of influenza viral RNA (vRNA, cRNA, and mRNA) separately. This method is based on reverse transcription using tagged primers to add a 'tag' sequence at the 5' end and the hot-start method. Real-time PCR using the 'tag' portion as the forward primer and a segment-specific reverse primer ensured the specificity for quantifying the three types of RNA. Using this method, specific target RNA was detected at 100-100,000-folds higher level than other types of RNA. This method was also used to evaluate the vRNA, cRNA, and mRNA levels of segments 5 and 6 in MDCK cells infected with influenza A virus at different time point post-infections. The cRNA level was 1/10 to 1/100 lower than that of the vRNA and mRNA. Moreover, different dynamics of vRNA, cRNA, and mRNA synthesis were observed; the copy number of the vRNA gradually increased throughout the infection, the cRNA increased and then plateaued, while the mRNA increased and then decreased. This novel method thus provides data critical for understanding the influenza virus life cycle, including transcription, replication, and genome incorporation into virions.

PubMed Disclaimer

Figures

Fig. 1
Fig. 1
Schematic diagram of conventional real-time RT-PCR and real-time RT-PCR with tagged primers. (A) Conventional real-time RT-PCR. Viral RNAs are reverse transcribed with specific primers. In real-time PCR, the cDNAs are then amplified with primer sets common to the three types of RNA. (B) Real-time RT-PCR with tagged primers. cDNA synthesis is performed using “tagged” primers complementary to each type of RNA. A tag of 18–20 nucleotides unrelated to the influenza virus, is shown as red, yellow, and green bars for the vRNAtag, cRNAtag, and mRNAtag, respectively. The tagged cDNA is amplified by PCR using the tag portion of the cDNA primer as the forward primer and a segment-specific oligonucleotide as the reverse primer.
Fig. 1
Fig. 1
Schematic diagram of conventional real-time RT-PCR and real-time RT-PCR with tagged primers. (A) Conventional real-time RT-PCR. Viral RNAs are reverse transcribed with specific primers. In real-time PCR, the cDNAs are then amplified with primer sets common to the three types of RNA. (B) Real-time RT-PCR with tagged primers. cDNA synthesis is performed using “tagged” primers complementary to each type of RNA. A tag of 18–20 nucleotides unrelated to the influenza virus, is shown as red, yellow, and green bars for the vRNAtag, cRNAtag, and mRNAtag, respectively. The tagged cDNA is amplified by PCR using the tag portion of the cDNA primer as the forward primer and a segment-specific oligonucleotide as the reverse primer.
Fig. 2
Fig. 2
Low specificity of conventional real-time RT-PCR. 109 copies of synthetic viral vRNA, cRNA, and mRNA of segment 5 are used as standards in conventional real-time RT-PCR. Reverse transcription was performed with primers specific for vRNA, cRNA, and mRNA respectively or in the absence of primers [primer (−)], or the absence of reverse transcriptase [RTase (−)]. The average molecular number and standard deviation of triplicate experiments are presented as a percentage of the average value of the target type of RNA. Error bars represent the standard deviation of triplicate experiments.
Fig. 3
Fig. 3
Analysis of synthetic viral RNAs for segment 5(A) and segment 6 (B) by using strand-specific real-time RT-PCR with tagged primers and the hot-start method. cDNAs were synthesized with tagged primers to add an 18–20 nucleotide tag that was unrelated to the influenza virus (Table 1: vRNAtag; GGCCGTCATGGTGGCGAAT, cRNAtag; GCTAGCTTCAGCTAGGCATC, and mRNAtag; CCAGATCGTTCGAGTCGT), at the 5 end. The tagged cDNA was amplified by real-time PCR by using the tag portion of the cDNA primer as the forward primer and a segment-specific oligonucleotide as the reverse primer. The average molecular number and standard deviation of triplicate experiments are presented as a percentage of the average value of the target type of RNA. Error bars represent the standard deviation of triplicate experiments.
Fig. 3
Fig. 3
Analysis of synthetic viral RNAs for segment 5(A) and segment 6 (B) by using strand-specific real-time RT-PCR with tagged primers and the hot-start method. cDNAs were synthesized with tagged primers to add an 18–20 nucleotide tag that was unrelated to the influenza virus (Table 1: vRNAtag; GGCCGTCATGGTGGCGAAT, cRNAtag; GCTAGCTTCAGCTAGGCATC, and mRNAtag; CCAGATCGTTCGAGTCGT), at the 5 end. The tagged cDNA was amplified by real-time PCR by using the tag portion of the cDNA primer as the forward primer and a segment-specific oligonucleotide as the reverse primer. The average molecular number and standard deviation of triplicate experiments are presented as a percentage of the average value of the target type of RNA. Error bars represent the standard deviation of triplicate experiments.
Fig. 4
Fig. 4
Standard curve for segment 5 (A) and segment 6 (B), generated by plotting the Cq values against the input synthetic RNA molecular numbers. Ten-fold serial dilutions (103 – 109 copies/μl for segment 5, 104 – 109 copies/μl for segment 6) of synthetic viral RNA standard were used to generate a standard curve.
Fig. 4
Fig. 4
Standard curve for segment 5 (A) and segment 6 (B), generated by plotting the Cq values against the input synthetic RNA molecular numbers. Ten-fold serial dilutions (103 – 109 copies/μl for segment 5, 104 – 109 copies/μl for segment 6) of synthetic viral RNA standard were used to generate a standard curve.
Fig. 5
Fig. 5
Kinetics of synthesis of (A) vRNA, (B) cRNA and (C) mRNA of segments 5 and 6 in MDCK cells infected with influenza virus (A/WSN/33 (H1N1) strain, MOI=10). The average molecules per cell were determined by strand-specific real-time RT-PCR using a tagged primer and the hot-start method with synthetic viral RNA as a reference standard. The values are expressed as numbers of RNA copies in an infected cell, assuming that a cell contains 10 pg of RNA. Error bars represent the standard deviation of triplicate experiments.
Fig. 5
Fig. 5
Kinetics of synthesis of (A) vRNA, (B) cRNA and (C) mRNA of segments 5 and 6 in MDCK cells infected with influenza virus (A/WSN/33 (H1N1) strain, MOI=10). The average molecules per cell were determined by strand-specific real-time RT-PCR using a tagged primer and the hot-start method with synthetic viral RNA as a reference standard. The values are expressed as numbers of RNA copies in an infected cell, assuming that a cell contains 10 pg of RNA. Error bars represent the standard deviation of triplicate experiments.
Fig. 5
Fig. 5
Kinetics of synthesis of (A) vRNA, (B) cRNA and (C) mRNA of segments 5 and 6 in MDCK cells infected with influenza virus (A/WSN/33 (H1N1) strain, MOI=10). The average molecules per cell were determined by strand-specific real-time RT-PCR using a tagged primer and the hot-start method with synthetic viral RNA as a reference standard. The values are expressed as numbers of RNA copies in an infected cell, assuming that a cell contains 10 pg of RNA. Error bars represent the standard deviation of triplicate experiments.
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Bouvier N, Palese P. The biology of influenza viruses. Vaccine. 2008;26:D49–D53. - PMC - PubMed
    1. Craggs J, Ball J, Thomson B, Irving W, Grabowska A. Development of a strand-specific RT-PCR based assay to detect the replicative form of hepatitis C virus RNA. J Virol Methods. 2001;94:111–120. - PubMed
    1. Ge Q, McManus MT, Nguyen T, Shen CH, Sharp PA, Eisen HN, Chen JZ. RNA interference of influenza virus production by directly targeting rnRNA for degradation and indirectly inhibiting all viral RNA transcription. Proc Nat Acad Sci USA. 2003;100:2718–2723. - PMC - PubMed
    1. Hatada E, Hasegawa M, Mukaigawa J, Shimizu K, Fukuda R. Control of influenza virus gene expression: quantitative analysis of each viral RNA species in infected cells. J Biochem. 1989;105:537–546. - PubMed
    1. Karlas A, Machuy N, Shin Y, Pleissner K, Artarini A, Heuer D, Becker D, Khalil H, Ogilvie L, Hess S, Mäurer A, Müller E, Wolff T, Rudel T, Meyer T. Genome-wide RNAi screen identifies human host factors crucial for influenza virus replication. Nature. 2010;463:818–22. - PubMed

Publication types

MeSH terms

LinkOut - more resources