Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2009 Jan;5(1):e1000339.
doi: 10.1371/journal.pgen.1000339. Epub 2009 Jan 16.

Yeast genetic analysis reveals the involvement of chromatin reassembly factors in repressing HIV-1 basal transcription

Manuela Vanti  1 , Edurne Gallastegui, Iñaki Respaldiza, Alfonso Rodríguez-Gil, Fernando Gómez-Herreros, Silvia Jimeno-González, Albert Jordan, Sebastián Chávez
Affiliations

Yeast genetic analysis reveals the involvement of chromatin reassembly factors in repressing HIV-1 basal transcription

Manuela Vanti et al. PLoS Genet. 2009 Jan.

Erratum in

  • PLoS Genet. 2009 Jan;5(1). doi: 10.1371/annotation/45587774-5d7c-4023-97b0-96833be7ad9a

Abstract

Rebound of HIV viremia after interruption of anti-retroviral therapy is due to the small population of CD4+ T cells that remain latently infected. HIV-1 transcription is the main process controlling post-integration latency. Regulation of HIV-1 transcription takes place at both initiation and elongation levels. Pausing of RNA polymerase II at the 5' end of HIV-1 transcribed region (5'HIV-TR), which is immediately downstream of the transcription start site, plays an important role in the regulation of viral expression. The activation of HIV-1 transcription correlates with the rearrangement of a positioned nucleosome located at this region. These two facts suggest that the 5'HIV-TR contributes to inhibit basal transcription of those HIV-1 proviruses that remain latently inactive. However, little is known about the cell elements mediating the repressive role of the 5'HIV-TR. We performed a genetic analysis of this phenomenon in Saccharomyces cerevisiae after reconstructing a minimal HIV-1 transcriptional system in this yeast. Unexpectedly, we found that the critical role played by the 5'HIV-TR in maintaining low levels of basal transcription in yeast is mediated by FACT, Spt6, and Chd1, proteins so far associated with chromatin assembly and disassembly during ongoing transcription. We confirmed that this group of factors plays a role in HIV-1 postintegration latency in human cells by depleting the corresponding human orthologs with shRNAs, both in HIV latently infected cell populations and in particular single-integration clones, including a latent clone with a provirus integrated in a highly transcribed gene. Our results indicate that chromatin reassembly factors participate in the establishment of the equilibrium between activation and repression of HIV-1 when it integrates into the human genome, and they open the possibility of considering these factors as therapeutic targets of HIV-1 latency.

PubMed Disclaimer

Conflict of interest statement

The authors have declared that no competing interests exist.

Figures

Figure 1
Figure 1. Influence of the 5′ end of HIV-1 transcribed region on basal transcription in yeast.
(A) The 5′HIV-TR inhibits Ty1-HIV-1 expression and this inhibition partially depends on yDSIF. mRNA samples from the BY4741 wild-type yeast strains and from an isogenic spt4Δ strain, transformed with plasmids pTy1-HIV and pTy1-HIVTARless, were resolved in agarose gels and analyzed by Northern blotting. Quantification of the signals is shown, after normalizing with the levels of 25S rRNA. A typical result and the quantification of three independent experiments are shown. (B) ChIP analysis of RNApol II in the two indicated transcription units. ARG3 cells, isogenic to BY4741, except for the RPB1::cMyc allele, transformed with pTy1-HIV and pTy1-HIVTARless, were grown to mid-log phase. Cross-linked chromatin was immunoprecipitated with monoclonal anti-Myc antibody. PCR was conducted on two dilutions of whole cell extract (WCE) and two different amounts of immunoprecipitated DNA (IP; only the most diluted are shown). PCR primers flank segments located in the 5′, central and 3′ regions of each gene. Diagrams at the top indicate the position of the PCR amplicons relative to the HIV-1 transcription start site. A non-transcribed region adjacent to FUS1 was used as a control. A typical experiment for each gene is shown on the left and the averages of three independent experiments are quantified on the right. The HIV signals are marked with an asterisk. (C) The TAR RNA structure is not required for the repressive effect of the 5′HIV-TR on basal transcription. Northern analyses of Ty1-HIV, Ty1-HIVTARless and Ty1HIVTARmut in BY4741 were performed as in A. (D) Chromatin configuration of the 5′HIV-TR in yeast. Spheroplasts of formaldehyde-treated BY4741 cells containing pTy1-HIV and pTy1-HIVTARless were lysed and digested with MNase. After purification, DNA was quantified with real-time PCR as described in Materials and Methods, using the primers listed in Table S3. Signals were normalized against naked DNA by repeating the same procedure with control DNA, purified from formaldehyde-treated cells before digesting it with MNase. For comparison, the two profiles were represented as fractions of the signal obtained with amplicon 14 (+490/+537). Diagrams represent the estimated locations of positioned nucleosomes. Dashed ovals indicate possible alternative locations of nucleosomes in TyHIVTARless.
Figure 2
Figure 2. No effect of the 5′HIV-TR on mRNA levels upon promoter activation.
(A) Activation of the Ty1 promoter by the NTP-depleting agent 6-azauracil eliminates the inhibitory effect of the 5′HIV-TR, both in a wild type and in a strain lacking TFIIS (dst1Δ). Experiment details as for Figure 1A. (B) The 5′HIV-TR inhibits GAL1-driven transcription when the promoter is weakly active. Cells transformed with plasmids pGAL1-HIV or pGAL1-HIVTARless were grown to mid-log phase in minimal medium with raffinose (0%) or with raffinose plus 0.02% galactose (0.02%) as carbon sources. (C) No effect of the 5′HIV-TR on mRNA levels is detected when an activated GAL1 promoter drives transcription, unless Tat and P-TEFb are present in the yeast cell. Cells transformed with plasmids pGAL1-HIV or pGAL1-HIVTARless, alone or together with p415GPD-CycT1, p414GPD-Cdk9 and p413GPD-Tat, were grown to mid-log phase as in B and incubated for 90 min in the presence of 2% galactose. (D) Tat and P-TEFb enhance Ty1-HIV expression in spt4Δ but they do not alter basal transcription in the wild type. Cells transformed with plasmids pTy1-HIV or pTy1-HIVTARless, alone or together with p415GPD-CycT1, p414GPD-Cdk9 and p413GPD-Tat, were grown to mid-log phase. In all cases, mRNA samples were taken and analyzed by Northern blot as in Figure 1A and the averages of three independent experiments are shown.
Figure 3
Figure 3. Genetic analysis of the 5′HIV-TR inhibitory effect.
(A) The inhibitory role of the 5′HIV-TR is compromised in mutants affecting co-transcriptional chromatin reassembly. mRNA samples of the indicated mutants, transformed with pTy1-HIV and pTy1-HIVTARless, were analyzed by Northern blot, as in Figure 1A. Averages of three independent experiments (see Figure S5) were plotted. Dashed line represents all possible variations of mRNA levels that maintain the Ty1HIV/Ty1HIVTARless proportion of the wild type. The grey square covers all points with a level of Ty1HIV mRNA significantly higher than the wild type (more than two standard deviations), but with a similar level of Ty1HIVTARless mRNA that the wild type (within two standard deviations). (B) Representative Northern blots, comparing the mRNA levels of Ty1-HIV and Ty1-HIVTARless, in spt6-140 (FY137), spt16-197 (FY348), chd1Δ and their respective isogenic wild-type strains (FY120 and BY4741). (C) ChIP analysis of Spt6, Spt16 and Chd1. SJY25, DBY871 and DBY969 strains, transformed with pTy1-HIV, were grown to mid-log phase. Cross-linked chromatin was immunoprecipitated and quantified by real-time PCR as described in Materials and Methods. Averaged fold enrichments of three independent experiments, relative to an untranscribed telomeric region, are shown. (D) Chromatin configuration of the 5′HIV-TR in spt4Δ, spt6-140 and chd1Δ. Averages of three independent experiments are shown. Experimental details as in Figure 1D.
Figure 4
Figure 4. shRNA-mediated depletion of chromatin reassembly factors hSpt6 and hChd1 in Jurkat cells derepress latently-integrated HIV.
(A) shRNA-mediated depletion of SPT6 and CHD1. A population of HIV (LTR-Tat-IRES-GFP-LTR) latently-infected human cells was infected with Control, Spt6 (#1, target sequence CGCCTTGTACTGTGAATTTAT) or Chd1 (#3, GCAGTTGTGATGAAACAGAAT) shRNA expression lentiviruses (pLKO.1-Puro) and, 10 days after puromycin (2 mg/ml) selection, depletion of these factors was tested in Western blot with specific antibodies and tubulin as a loading control. (B) HIV reactivation in a heterogeneous population of HIV latently infected Jurkat cells, expressed as percentage of cells that become GFP-positive 10–15 days after infection with the indicated shRNA-expressing lentiviruses and continuous selection with puromycin. Values represent the mean±SD of three independent infection experiments. (C) Example of FACS analysis of GFP expression as a result of HIV promoter reactivation in a latently infected Jurkat clone after infection with a Spt6 specific shRNA-expressing vector or treatment with PMA (10 nM for 16 h) or TSA (400 nM for 16 h). The percentage of GFP-positive cells is indicated inside the corresponding gate. (D) HIV reactivation in individual cell clones. Four different clones containing single HIV latent integrations previously mapped were infected with the indicated shRNA-expressing lentiviruses, selected by puromycin treatment, and GFP expression was monitored by FACS over time. Values represent the mean±SD of percentage of GFP-positive cells of two independent experiments 10–15 days after infection.
Figure 5
Figure 5. A model for the contribution of chromatin reassembly factors to the repression of HIV basal transcription.
(A) Chromatin reassembly factors, recruited by the elongating form of RNApol II, stabilize nucleosomes on the transcribed region, keeping basal transcription at low rates. In the absence of chromatin reassembly factors, nucleosomal configuration of the transcribe region becomes instable, increasing basal transcription and eventually favoring promoter activation. (B) Chromatin reassembly factors may also contribute to the silencing of HIV by transcriptional interference. HIV proviruses integrated in highly expressed genes would remain untranscribed due to the repressive chromatin configuration established by chromatin reassembly factors during transcription elongation. In the absence of chromatin reassembly factors, nucleosomes repressing the 5′-LTR become instable, allowing transcription factors to activate the HIV promoter.
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Palangat M, Meier TI, Keene RG, Landick R. Transcriptional pausing at +62 of the HIV-1 nascent RNA modulates formation of the TAR RNA structure. Mol Cell. 1998;1:1033–1042. - PubMed
    1. Kao SY, Calman AF, Luciw PA, Peterlin BM. Anti-termination of transcription within the long terminal repeat of HIV-1 by tat gene product. Nature. 1987;330:489–493. - PubMed
    1. Perkins KJ, Lusic M, Mitar I, Giacca M, Proudfoot NJ. Transcription-dependent gene looping of the HIV-1 provirus is dictated by recognition of pre-mRNA processing signals. Mol Cell. 2008;29:56–68. - PMC - PubMed
    1. Wei P, Garber ME, Fang SM, Fischer WH, Jones KA. A novel CDK9-associated C-type cyclin interacts directly with HIV-1 Tat and mediates its high-affinity, loop-specific binding to TAR RNA. Cell. 1998;92:451–462. - PubMed
    1. Benkirane M, Chun RF, Xiao H, Ogryzko VV, Howard BH, et al. Activation of integrated provirus requires histone acetyltransferase. p300 and P/CAF are coactivators for HIV-1 Tat. J Biol Chem. 1998;273:24898–24905. - PubMed

Publication types