Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2006 Feb;80(4):2055-62.
doi: 10.1128/JVI.80.4.2055-2062.2006.

Identification of spliced gammaherpesvirus 68 LANA and v-cyclin transcripts and analysis of their expression in vivo during latent infection

Robert D Allen 3rd  1 , Shelley Dickerson, Samuel H Speck
Affiliations

Identification of spliced gammaherpesvirus 68 LANA and v-cyclin transcripts and analysis of their expression in vivo during latent infection

Robert D Allen 3rd et al. J Virol. 2006 Feb.

Abstract

Regulation of orf73 (LANA) gene expression is critical to the establishment and maintenance of latency following infection by members of the gamma-2 herpesvirus (rhadinovirus) family. Previous studies of murine gammaherpesvirus 68 (gammaHV68) have demonstrated that loss of LANA function results in a complete failure to establish virus latency in the spleens of laboratory mice. Here we report the characterization of alternatively spliced LANA and v-cyclin (orf72) transcripts encoded by gammaHV68. Similar to other rhadinoviruses, alternative splicing, coupled with alternative 3' processing, of a ca. 16-kb transcriptional unit can lead to expression of either LANA or v-cyclin during gammaHV68 infection. Spliced LANA and v-cyclin transcripts were initially identified from an analysis of the gammaHV68 latently infected B-cell lymphoma cell line S11E, but were also detected during lytic infection of NIH 3T12 fibroblasts. 5' Random amplification of cDNA ends (RACE) analyses identified two distinct promoters, p1 and p2, that drive expression of spliced LANA transcripts. Analysis of p1 and p2, using transiently transfected reporter constructs, mapped the minimal sequences required for promoter activity and demonstrated that both promoters are active in the absence of any viral antigens. Analysis of spliced LANA and v-cyclin transcripts in spleens recovered from latently infected mice at days 16 and 42 postinfection revealed that spliced v-cyclin transcripts can only be detected sporadically, suggesting that these may be associated with cells reactivating from latency. In contrast, spliced LANA transcripts were detected in ca. 1 in 4,000 splenocytes harvested at day 16 postinfection. Notably, based on the frequency of viral genome-positive splenocytes at day 16 postinfection (ca. 1 in 200), only 5 to 10% of viral genome-positive splenocytes express LANA. The failure of the majority of infected splenocytes at day 16 postinfection to express LANA may contribute to the contraction in the frequency of latently infected splenocytes as chronic infection is established, due to failure to maintain the viral episome in proliferating B cells.

PubMed Disclaimer

Figures

FIG. 1.
FIG. 1.
Structure of orf73 and orf72 spliced transcripts. (A) Schematic illustration of the steps involved in the RNA ligase-mediated 5′ RACE protocol. Using the GeneRacer reagents (Invitrogen), polyadenylated RNA from S11E lymphoma cells was treated as described to generate adapted RNA templates for reverse transcription into cDNA. Following nested RT-PCRs using primers specific to the RNA adaptor region and orf73 (73RTo, ATCGTCTGTCTCTCCTACATCTAAA, and 73RTi, TCAACATCAACATCTGGTGATGGTG) products were subcloned and sequenced. (B) The region of the genome encoding γHV68 orf72 and orf73 is shown. Two major spliced orf73 transcripts were identified. The larger orf73 spliced transcript contained at least one copy of a 91-bp exon (E1) located within the viral terminal repeat, a 106-bp exon (E2) and the orf73 coding exon (E3). The second, smaller orf73 transcript identified contained only E2 and E3. RT-PCR performed with a primer specific to orf72 (72RTi, TCAACATCAACATCTGGTGATGGTG) and a primer specific to exon 2 of the orf73 transcript (73E2i, TCCCGACTCGTGAGTAGCGCCGACTAG) amplified a spliced product that contains the sequences encoding orf72 as well as an additional exon from within the orf73 coding region. Products were subsequently subcloned and sequenced. The positions of the 73p1 and 73p2 promoters are also indicated.
FIG. 2.
FIG. 2.
Orf73 promoter upstream of E1 functions independently of virus infection. (A) Characterization of the orf73 p1 promoter. Using wild-type γHV68 BAC DNA as template, PCR fragments encompassing the indicated genomic coordinates were generated with 5′ NheI restriction sites and 3′XhoI sites and subcloned into the pGL3-basic luciferase reporter vector (Promega). (B) 5 μg of each reporter construct was introduced into 106 S11E tumor cells, WEHI B-cell lymphoma cells, or RAW macrophage cells by nucleofection using optimized conditions according to the manufacturer's protocol (Amaxa), or transfected into NIH 3T12 fibroblasts using Superfect transfection reagent (QIAGEN); 24 h later, cell lysates were prepared using passive lysis buffer (Promega) and luciferase activity in each lysate was measured using a TD 20/20 luminometer (Turner Biosystems). (C) The genomic DNA fragments tested in panel B were analyzed for presence of consensus transcription factor binding sites (overlined) using Transcription Element Search Software (TESS; http://www.cbil.upenn.edu/tess/). The splice donor and splice acceptor sites for 73E1 are boxed in white and the sequence of 73E1 is boxed in gray. The 5′ terminus of E1/E2/E3 spliced LANA transcripts identified in S11E lymphoma cells is indicated with an empty arrowhead, and those termini identified in splenocytes harvested at day 16 postinfection are indicated with filled arrowheads.
FIG. 3.
FIG. 3.
Viral terminal repeat acts to enhance transcription from a promoter upstream of orf73E2. (A) Characterization of the orf73 p2 promoter. Reporter constructs carrying DNA fragments from within the indicated genomic coordinates were generated as described for p1 reporter constructs. For constructs containing the γHV68 terminal repeat, an XcmI fragment containing a single terminal repeat sequence was subcloned into the BamHI site of pGL3. (B) Transfections and luciferase assays were carried out in the same manner as described for p1 promoter constructs in Fig. 2B. Luciferase activity in cells transfected with p2-300-TR or pGL3-TR was plotted in comparison to activity in lysates from cells transfected with the p2-300 construct. (C) The genomic DNA fragments tested in panel B were analyzed for presence of consensus transcription factor binding sites (overlined) as described in the legend to Fig. 2. The splice donor and splice acceptor sites for 73E2 are boxed in white and the sequence of 73E2 is boxed in gray. The 5′ termini identified in S11E lymphoma cells and day 16-infected mouse splenocytes for 73 transcripts containing only 73E2 and 73E3 exons are indicated with solid arrowheads.
FIG. 4.
FIG. 4.
Spliced orf73 and orf72 transcripts are present in S11E tumor cells, day 16-infected splenocytes, and infected NIH 3T12 fibroblasts. (A) Total RNA was extracted from 107 cultured cells or mouse splenocytes and 5 μg of total RNA was used as template for oligo(dT)-primed cDNA synthesis. RT-PCR with primers specific to 73E2 (73E2o, TCTTCCACCCTTCCCTCTGGCCCTG) and orf73 (73RTo) or orf72 (72RTo, GGGGAAAGACGTTGTTATCCTGACG) was performed and products of the reaction were electrophoresed in a 1% agarose gel. Using cDNA from S11E tumor cells, infected day 16 splenocytes, or infected NIH 3T12 fibroblasts, RT-PCR with primers 73E2o and 73E3o generated a 466-bp product, and reactions using primers 73E2o and 72RTo generated a 433-bp product. Negative control reactions using cDNA generated from either naïve splenocytes (naïve SPL) or mock-infected NIH 3T12 fibroblasts did not generate any detectable RT-PCR products. (B) Mice were infected with 1,000 PFU of γHV68 intranasally and spleens were harvested from infected animals 16 days postinfection. Single cell splenocyte suspensions were prepared using a Dounce homogenizer, and subsequently treated with red blood cell lysis buffer. Splenocytes were then counted and resuspended at a concentration of 105 cells/ml and 10-fold serial dilutions of infected splenocytes (10 replicates at each dilution) were prepared in a background of 106 uninfected splenocytes. Cells were centrifuged and pellets were resuspended in 1 ml of guanidine isothiocyanate/phenol solution (2 M guanidine isothiocyanate, 0.05 M β-mercaptoethanol, 0.25% Sarcosyl, 0.1 M sodium acetate). Following extraction with phenol-chloroform-isoamyl alcohol (25:24:1, EM Science), RNA was precipitated and resuspended in 12 μl of RNase-free water. Each sample was then used as template in a 20-μl random hexamer-primed cDNA reaction using Superscipt II reverse transcriptase (Invitrogen); 4 μl of each cDNA reaction was used as the template in nested PCRs specific for detection of orf73 spliced transcripts or orf72 spliced transcripts. The orf73E2-specific primer set used in both reactions was 73E2o and 73E2i. The orf73 spliced transcript-specific primer set was 73RTo and 73RTi. The orf72 spliced transcript-specific primer set was 72RTo and 72RTi. S11E cells were diluted in a background of 106 uninfected splenocytes and used as a control template to determine the sensitivity of the primer sets.
FIG. 5.
FIG. 5.
Determination of the frequency of infected splenocytes transcribing orf73 or M2 in vivo. (A) Determination of detection sensitivity for M2 and 73 primer sets. S11E lymphoma B cells were serially diluted 10-fold in a background of 105 uninfected splenocytes and multiple, 1-ml replicates of each dilution were processed for RNA extraction and reverse transcription as described for Fig. 3B. For PCR detection of the spliced M2 mRNA, the primers used in the primary reaction were M2E1o (ACTTTCAGCTTTCGGGAAGGGTTTAGGCAC) and M2E2o (GGACTGTCAGTCGAGCCAGAGTCCAACATC), and the primers used in the nested reaction were M2E1i (CAGGACTTCCTGCAGGGTTAACTTCTTCAG) and M2E2i (TTCCCCTCTCAAGCTGCTTCCTTAGCCAGT). For the orf73 nested PCR, the primers used in the primary reaction were 73E2o and 73RTo, and the primers used in the nested reaction were 73E2i and 73RTi. Data were analyzed using nonlinear regression analysis and sensitivities were calculated as the point at which 63% of the PCRs were positive for each primer set. (B) At 16 days following intranasal infection of C57BL/6 mice with 1,000 PFU of wild-type γHV68, whole splenocytes were harvested from five mice, pooled, and treated as described for Fig. 3B. Single-cell suspensions of infected splenocytes were then diluted (threefold serial dilutions beginning with 105 splenocytes/ml and ending with 4.6 × 101 splenocytes/ml) in a background of uninfected splenocytes. Ten 1.0-ml replicates at each dilution point were processed for RNA extraction and reverse transcription as described for Fig. 3B. The PCR conditions used were those described for panel A. Results were compiled from five independent experiments. To obtain the frequency for each set of limiting-dilution experiments, data were subjected to nonlinear regression (using a sigmoidal dose curve with nonvariable slope to fit the data). Frequencies of transcript-positive cells were obtained by calculating the cell density at which 63% of the PCRs were positive for orf73 or M2 transcript based on a Poisson distribution. (C) Experiments were performed as described for panel B on splenocytes isolated from C57BL/6 mice 42 days postinfection.
FIG. 6.
FIG. 6.
Detection of orf73p1 and orf73p2 initiation events in infected splenocytes. Sixteen days following intranasal infection of C57BL/6 mice with 1,000 PFU of wild-type γHV68 bulk splenocytes were harvested from five mice, pooled, and treated as described for Fig. 3B. A total of 78 replicates were prepared with 3.7 × 103 cells per sample in a background of 105 uninfected splenocytes. RNA was extracted and reverse transcribed as detailed for Fig. 3B. Initially, all 78 replicates were screened for the presence of E1-containing (E1+) orf73 transcripts using the first-round primer set 73E1o (GACCCCCGCCCCTCCGGGACCCGCC) and 73RTo, and the nested primer set 73E1i (GCACCCGGACCCTGCTGAGGGCCAA) and 73RTi. cDNA reactions that were negative following orf73-E1 RT-PCR were then screened for the presence of E2-containing (E2+) orf73 transcripts using the first-round primer set 73E2o and 73RTo, and the nested primers 73E2i and 73RTi. Any cDNA reactions that scored E1 negative (E1−) but were E2+ were then rescreened two further times for the presence of E1 exon-containing transcripts using the orf73-E1 nested primer pair.
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Albrecht, J. C., J. Nicholas, D. Biller, K. R. Cameron, B. Biesinger, C. Newman, S. Wittmann, M. A. Craxton, H. Coleman, B. Fleckenstein, et al. 1992. Primary structure of the herpesvirus saimiri genome. J. Virol. 66:5047-5058. - PMC - PubMed
    1. Babcock, G. J., L. L. Decker, R. B. Freeman, and D. A. Thorley-Lawson. 1999. Epstein-barr virus-infected resting memory B cells, not proliferating lymphoblasts, accumulate in the peripheral blood of immunosuppressed patients. J. Exp. Med. 190:567-576. - PMC - PubMed
    1. Baer, R., A. T. Bankier, M. D. Biggin, P. L. Deininger, P. J. Farrell, T. J. Gibson, G. Hatfull, G. S. Hudson, S. C. Satchwell, C. Seguin, et al. 1984. DNA sequence and expression of the B95-8 Epstein-Barr virus genome. Nature 310:207-211. - PubMed
    1. Ballestas, M. E., P. A. Chatis, and K. M. Kaye. 1999. Efficient persistence of extrachromosomal KSHV DNA mediated by latency-associated nuclear antigen. Science 284:641-644. - PubMed
    1. Bieleski, L., and S. J. Talbot. 2001. Kaposi's sarcoma-associated herpesvirus vCyclin open reading frame contains an internal ribosome entry site. J. Virol. 75:1864-1869. - PMC - PubMed

Publication types

MeSH terms

LinkOut - more resources