Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2004 Jul;78(14):7852-60.
doi: 10.1128/JVI.78.14.7852-7860.2004.

Epstein-Barr virus latent membrane protein LMP-2A is sufficient for transactivation of the human endogenous retrovirus HERV-K18 superantigen

Natalie Sutkowski  1 , Gang Chen, German Calderon, Brigitte T Huber
Affiliations

Epstein-Barr virus latent membrane protein LMP-2A is sufficient for transactivation of the human endogenous retrovirus HERV-K18 superantigen

Natalie Sutkowski et al. J Virol. 2004 Jul.

Abstract

Superantigens are microbial proteins that strongly stimulate T cells. We described previously that the Epstein-Barr virus (EBV) transactivates a superantigen encoded by the human endogenous retrovirus, HERV-K18. We now report that the transactivation is dependent upon the EBV latent cycle proteins. Moreover, LMP-2A is sufficient for induction of HERV-K18 superantigen activity.

PubMed Disclaimer

Figures

FIG. 1.
FIG. 1.
EBNA-2-dependent transactivation of the HERV-K18 superantigen. (A) LCL transformed by deletion mutant EBV (Mg68 and 253.30) or B95-8 EBV were tested for the ability to stimulate TCRBV13 and TCRBV8 T-cell hybridomas. EBV− BL-41 lymphoma cells were also tested and compared with BL-41 infected with B95-8 (BL-41/B95-8) or EBNA-2-deficient P3HR1 virus (BL-41/P3HR1). EBV cell lines used as superantigen-presenting cells were treated overnight with phorbol myristate acetate (10 ng/ml; Calbiochem) at 37°C. Cells were washed extensively in phosphate-buffered saline, counted, and resuspended with T-cell hybrids in 96-well round-bottom plates with 105 antigen-presenting cells and 2 × 104 T-cell hybrids per well. After 24 to 48 h at 37°C, the plates were frozen at −80°C to lyse the cells, and thawed supernatants were tested for the presence of IL-2 by HT-2 bioassay as previously described (53). As the positive control, the T-cell hybrids were cross-linked with plate-bound anti-CD3 (145 2C11). The mean IL-2 production for each T-cell hybrid measured in quadruplicate wells was expressed in picograms per milliliter of culture supernatant by comparison with values from a standard curve derived from recombinant IL-2 (R & D Systems). Error bars represent the difference measured between quadruplicate wells within a single experiment. Experiments were performed at least five times. (B) Semiquantitative RT-PCR for HERV-K18 read-through transcripts and 18S rRNA was performed on uninfected BL-41, BL-41/B95-8, BL-41/P3HR1, and BL-41/P3HR1 stably transfected with EBNA-2 (MCB1-9 cells). In addition, LCL transformed by recombinant EBV with estrogen-responsive EBNA-2 (EREB/2-6 cells) were tested in the presence or absence of estrogen. cDNA was prepared by random priming of total RNA that had been DNase I treated to remove contamination by genomic DNA. All samples were prepared in the presence (+) or absence (−) of RT. The PCR sense primer was 5′ TCCGAAGAGACAGTGACATCGA 3′, directed against a HERV-K18 env-specific sequence; the antisense primer was 5′ TGGCAATGCTGGCTATGTAAGT 3′, directed against a chromosome 1q23.1-q24.1 (GenBank accession number AL121985) sequence, located 127 bp downstream of the 3′ viral long terminal repeat. PCR was performed in the presence of [32P]α-dCTP, incorporating primers specific for 18S rRNA as an endogenous standard. Since the HERV-K18 read-through transcripts were extremely rare compared with the 18S rRNA, 18S Classic competimers (Ambion) were added at a primer-to-competimer ratio of 1:20. PCR was performed by using a hot start of 4 min at 94°C and then 25 cycles of 30 s at 94°C, 90 s at 72°C, and 60 s at 55°C, followed by a 7-min extension at 72°C, which yielded products within a linear range. PCR products were separated on a 6% denaturing polyacrylamide gel. HERV-K18 read-through transcripts were quantified by phosphorimaging (Molecular Dynamics), and induction (fold) was calculated after normalization against the 18S rRNA product; values are reported below each lane.
FIG. 2.
FIG. 2.
Infection of BL-41 with LMP-2A vaccinia virus selectively induces HERV-K18 env. BL-41 cells were infected with a panel of recombinant vaccinia viruses containing different EBV latent genes, EBNA-1, EBNA-2, EBNA-3A, EBNA-3B, EBNA-3C, EBNA-LP, and LMP-2A, or control virus VVTK−. Eight, 18, or 24 h postinfection, cells were lysed, RNA was extracted, and semiquantitative RT-PCR for K18 and 18S transcripts was performed as described in the legend to Fig. 1B. (A) RT-PCR analysis at 18 h (top panel) and 24 h (bottom panel) postinfection. The ratio of HERV-K18 to 18S rRNA was measured by phosphorimager analysis, and the induction (fold) is reported below each lane. (B) Summary of RT-PCR analyses at 8, 18, and 24 h postinfection (p.i.) in one of two representative experiments. Induction (fold) of HERV-K18 was calculated by normalization with values obtained from VVTK− infected cells. N.D., not determined.
FIG. 3.
FIG. 3.
Infection of BL-41 with AdLMP2 transactivates the HERV-K18 superantigen. Adenovirus vectors containing LMP-2A (AdLMP2), LMP-1 (UpLMP1), or EGFP (AdEGFP, UpGFP, and UpLMP1) were used to infect BL-41 cells at an MOI of 100. (A) AdLMP2- and UpLMP1-infected cells were stained 48 h postinfection with MAbs specific for LMP-2A (8C3) and LMP-1 (S12) or isotype-matched control antibody. (B) EGFP expression in BL-41 48 h postinfection with each adenovirus. (C) Adenovirus-infected cells were lysed 96 h postinfection and subjected to RT-PCR analysis for K18 and 18S rRNA transcripts as described in the legend to Fig. 1B. Alternatively, cells infected at an MOI of 100 or 300 were tested for their ability to stimulate the TCRBV13 and TCRBV8 T-cell hybridomas, as described in the legend to Fig. 1A. (D) The mean IL-2 production for each T-cell hybrid was measured in quadruplicate wells by enzyme-linked immunosorbent assay and expressed in picograms per milliliter of culture supernatant by comparison with values from a standard curve derived from recombinant IL-2 (R & D Systems). Error bars represent the difference measured between quadruplicate wells in one representative experiment. Experiments were performed at least three times. The response of the hybrids to BL-41/B95-8 and anti-CD3 cross-linkage was included as a positive control.
FIG. 4.
FIG. 4.
Lack of synergy between latent membrane proteins after coinfection of BL-41 with UpLMP1 and AdLMP2. (A) BL-41 cells were mock infected or coinfected with UpLMP1 and AdLMP2 at an MOI of 100 for each. Cells were stained 48 h postinfection with MAb specific for LMP-2A (8C3) and LMP-1 (S12) or isotype-matched control antibody shown on the y axis, and EGFP is shown on the x axis by flow cytometry. (B) Cells infected at an MOI of 100 were tested for superantigen activity by the TCRBV13 T-cell hybridoma, as described in the legend to Fig. 1A.
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Allday, M. J., D. H. Crawford, and B. E. Griffin. 1989. Epstein-Barr virus latent gene expression during the initiation of B cell immortalization. J. Gen. Virol. 70:1755-1764. - PubMed
    1. Baichwal, V. R., and B. Sugden. 1988. Transformation of Balb 3T3 cells by the BNLF-1 gene of Epstein-Barr virus. Oncogene 2:461-467. - PubMed
    1. Bornkamm, G. W., J. Hudewentz, U. K. Freese, and U. Zimber. 1982. Deletion of the nontransforming Epstein-Barr virus strain P3HR-1 causes fusion of the large internal repeat to the DSL region. J. Virol. 43:952-968. - PMC - PubMed
    1. Brierley, M. M., and E. N. Fish. 2002. Review: IFN-alpha/beta receptor interactions to biologic outcomes: understanding the circuitry. J. Interferon Cytokine Res. 22:835-845. - PubMed
    1. Caldwell, R. G., R. C. Brown, and R. Longnecker. 2000. Epstein-Barr virus LMP2A-induced B-cell survival in two unique classes of EmuLMP2A transgenic mice. J. Virol. 74:1101-1113. - PMC - PubMed

Publication types

MeSH terms

Substances

LinkOut - more resources