Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
Comparative Study
. 2002 Apr;76(7):3168-78.
doi: 10.1128/jvi.76.7.3168-3178.2002.

Open reading frame 50 protein of Kaposi's sarcoma-associated herpesvirus directly activates the viral PAN and K12 genes by binding to related response elements

Pey-Jium Chang  1 , Duane Shedd, Lyn Gradoville, Myung-Sam Cho, Lee-Wen Chen, Jimmy Chang, George Miller
Affiliations
Comparative Study

Open reading frame 50 protein of Kaposi's sarcoma-associated herpesvirus directly activates the viral PAN and K12 genes by binding to related response elements

Pey-Jium Chang et al. J Virol. 2002 Apr.

Abstract

Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposi's sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cells and B cells in the absence of other KSHV proteins. The responsive region of DNA can be transferred to a heterologous minimal promoter. Extensive point mutagenesis showed that a span of at least 20 nt is essential for a response to ORF 50 protein. However, a minimum of six positions within this region were ambiguous. The related 26-nt responsive element in the K12 promoter (K12p), 5' GGAAATGGGTGGCTAACCCCTACATA, shares 20 nt (underlined) with the comparable region of PANp. The divergence is primarily at the 3' end. The DNA binding domain of ORF 50 protein, encompassing amino acids 1 to 490, fused to a heterologous activation domain from herpes simplex virus VP16 [ORF 50(1-490)+VP] can mediate activation of reporter constructs bearing these response elements. Most importantly, ORF 50(1-490)+VP can induce PAN RNA and K12 transcripts in transfected cells. ORF 50(1-490)+VP expressed in human cells binds specifically to duplex oligonucleotides containing the responsive regions from PANp and K12p. These DNA-protein complexes were supershifted by antibody to VP16. ORF 50(1-490) without a VP16 tag also bound to the response element. There was a strong correlation between DNA binding by ORF 50 and transcriptional activation. Mutations within PANp and K12p that impaired transactivation by ORF 50 or ORF 50(1-490)+VP also abolished DNA binding. Only one of eight related complexes formed on PANp and K12p oligonucleotides was due to ORF 50(1-490)+VP. The other complexes were due to cellular proteins. Two KSHV lytic-cycle promoters are activated by a similar mechanism that involves direct recognition of a homologous response element by the DNA binding domain of ORF 50 protein in the context of related cellular proteins.

PubMed Disclaimer

Figures

FIG. 1.
FIG. 1.
Definition of an ORF 50 protein response element in the promoter of the PAN gene. (A) Summary of mutagenesis of the PAN promoter. Deletion mutations include 5′-end deletions of the PAN promoter in pCAT-Basic (i) and fragments of PAN promoter transferred to pE4CAT (ii). Double point mutations are in the context of PAN promoter (−90 to −1) in pCAT-Basic; single point mutations are in the PANp fragment (−91 to −58) in pE4CAT. Responsiveness of each construct to ORF 50 is indicated as follows: +, wild-type activity; +/−, about 50% activity; −, markedly impaired activity. (B) Effect of deletion mutations of the PAN promoter on the response to the ORF 50 protein. The deletions were studied in two reporters, pCAT-Basic (i and ii) and pE4CAT (iii and iv). In panels i and ii, the data are expressed relative to the response of the construct (−90 to −1) pCAT. This represented 40-fold stimulation in BJAB and 62-fold stimulation in 293T cells. In panels iii and iv, the data are expressed relative to the construct −91 to −58 inserted into pE4CAT. This represented 40-fold stimulation in BJAB and 36-fold stimulation in 293T cells. (C) Effect of point mutations of the PAN promoter on response to the ORF 50 protein. The response of double point mutants was measured in pCAT (−90 to −1) (i and ii; 31-fold stimulation in BJAB and 61-fold stimulation in 293T cells) and that of single point mutants was measured in E4CAT (−91 to −58) (iii and iv; 40-fold stimulation and BJAB and 36-fold stimulation in 293T cells). (D) Activity of double or quadruple point mutants relative to the response of PANp (−91 to −58) E4CAT.
FIG. 2.
FIG. 2.
A region of the PAN promoter is specifically responsive to ORF 50 protein. (A) Sequence of the PAN promoter from −107 to −1; •, recently mapped start of PAN RNA (28). (B) Sequence of the adenovirus E4 minimal promoter. Potential binding sites for transcription factors identified by computer search are boxed, as is the KSHV/ORF 50 response element identified by mutagenesis experiments (Fig. 1). [ ], position where fragments of PANp or K12P were inserted. (C and D) Response of CAT reporters containing the KSHV PAN promoter and the promoters of the EBV BaRF1 (ap) and BRLF1 (Rp) genes to KSHV ORF 50 protein (KSHV/ORF50) or EBV BRLF1 protein (EBV/Rta) in BJAB (C) and 293T (D) cells.
FIG. 3.
FIG. 3.
Sequence in the promoter of the K12 gene that is responsive to ORF 50 protein. (A) Comparison of sequences in the ORF 50 protein response element in the PAN promoter with a region of the K12 promoter. Identical sequences are shown by vertical lines. The sequence in the K12 mutant are boxed. Arrowheads demarcate the minimal region of the two promoters that is responsive to ORF 50 protein. (B) Response of PAN (−91 to −58), K12 (−105 to −72), and K12 mutant (K12-MT) in E4CAT to stimulation by ORF 50 protein. (C) Effect of deletions of the K12 promoter cloned in E4CAT on its response to ORF 50 protein and ORF 50(1-490)+VP. The deletions are designated by the number of nucleotides removed from the 3′ end (e.g., 3′-D4 removed 4 nt) or 5′ end. K12-S, short K12p; S.D., standard deviation. For panels B and C, the assays were performed in BJAB cells. The capacity of the duplex oligonucleotide to bind ORF 50(1-490)+VP was determined in competition EMSAs. (−, no competition; ++++, strongest competition).
FIG. 4.
FIG. 4.
Transcriptional activation by the N-terminal 490 aa of ORF 50 protein fused to VP16. (A) Diagram of the ORF 50 protein. NLS, nuclear localization signal; LZ, leucine zipper; AD, activation domain (15). Numbers below the diagram represent amino acid residues. Results of transcriptional activation by deletion mutants of ORF 50 protein fused to VP16 are means and standard deviations (S.D.) of two experiments measuring activation of K12 promoter (−105 to −72) fused to E4CAT in BJAB cells. (B) Expression of deletion mutants of ORF 50 protein fused to VP16. A Western blot of extracts of HKB5/B5 cells was probed with antibody to VP16.
FIG. 5.
FIG. 5.
Activation of viral transcripts by ORF 50(1-490)+VP. HH-B2 cells were transfected with plasmids expressing empty vector (pRTS), full-length ORF 50 protein (ORF 50), ORF 50(1-490)+VP, or ORF 50(1-490). Uninduced and n-butyrate-treated cells were negative and positive controls for lytic gene expression. Northern blots were probed with the PAN RNA gene (A) or an oligonucleotide from the K12 gene (B).
FIG. 6.
FIG. 6.
The N-terminal 490 aa of ORF 50 protein fused to VP16 binds to the promoters of the KSHV PAN and K12 genes. Extracts of HKB5/B5 cells transfected with deletion mutants of ORF 50 protein fused to VP16 were used in EMSAs. Antibody to VP16 (αVP) was used to supershift the complexes formed. The probes were the PAN promoter (−91 to −58) (A) and the K12 promoter (−105 to −72) (B). The ORF 50-specific complexes and the supershifted (SS) complex are indicated. (C) Comparison of DNA binding by ORF 50(1-490) and ORF 50(1-490)+VP to PANp. The binding reactions were supershifted with antibody to ORF 50(230-250) or with antibody to VP16.
FIG. 6.
FIG. 6.
The N-terminal 490 aa of ORF 50 protein fused to VP16 binds to the promoters of the KSHV PAN and K12 genes. Extracts of HKB5/B5 cells transfected with deletion mutants of ORF 50 protein fused to VP16 were used in EMSAs. Antibody to VP16 (αVP) was used to supershift the complexes formed. The probes were the PAN promoter (−91 to −58) (A) and the K12 promoter (−105 to −72) (B). The ORF 50-specific complexes and the supershifted (SS) complex are indicated. (C) Comparison of DNA binding by ORF 50(1-490) and ORF 50(1-490)+VP to PANp. The binding reactions were supershifted with antibody to ORF 50(230-250) or with antibody to VP16.
FIG. 7.
FIG. 7.
Specificity of DNA binding by the N-terminal 490 aa of ORF 50 fused to VP16. Extracts for EMSA were prepared from HKB5/B5 cells transfected with empty vector (pRTS) or a vector expressing ORF 50(1-490)+VP16. DNA binding reactions were competed with wild-type (WT) or mutant (MT) duplex oligonucleotides. (A) Binding to a duplex oligonucleotide from the PAN promoter; (B) binding to a duplex oligonucleotide from the K12 promoter.
FIG. 8.
FIG. 8.
Cross competition of ORF 50 protein binding to the K12 and PAN promoters. The probe was a duplex oligonucleotide derived from the K12 promoter. The competitors were wild-type (WT) K12, K12 5′-D12 (Fig. 3C), wild-type PAN, and a mutant oligonucleotide from the PAN promoter with the same changes as K12-MT (Fig. 7B). The sequences of the competitors are above the EMSA gel. The sequence shared between PAN promoter and K12 promoter is boxed.
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Adamson, A. L., D. Darr, E. Holley-Guthrie, R. A. Johnson, A. Mauser, J. Swenson, and S. Kenney. 2000. Epstein-Barr virus immediate-early proteins BZLF1 and BRLF1 activate the ATF2 transcription factor by increasing the levels of phosphorylated p38 and c-Jun N-terminal kinases. J. Virol. 74:1224-1233. - PMC - PubMed
    1. Albrecht, J. C., J. Nicholas, D. Biller, K. R. Cameron, B. Biesinger, C. Newman, S. Wittmann, M. A. Craxton, H. Coleman, B. Fleckenstein, et al. 1992. Primary structure of the herpesvirus saimiri genome. J. Virol. 66:5047-5058. - PMC - PubMed
    1. Chan, S. R., C. Bloomer, and B. Chandran. 1998. Identification and characterization of human herpesvirus-8 lytic cycle-associated ORF 59 protein and the encoding cDNA by monoclonal antibody. Virology 240:118-126. - PubMed
    1. Chen, J., K. Ueda, S. Sakakibara, T. Okuno, and K. Yamanishi. 2000. Transcriptional regulation of the Kaposi's sarcoma-associated herpesvirus viral interferon regulatory factor gene. J. Virol. 74:8623-8634. - PMC - PubMed
    1. Darr, C. D., A. Mauser, and S. Kenney. 2001. Epstein-Barr virus immediate-early protein BRLF1 induces the lytic form of viral replication through a mechanism involving phosphatidylinositol-3 kinase activation. J. Virol. 75:6135-6142. - PMC - PubMed

Publication types