Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2001 Apr;102(4):498-505.
doi: 10.1046/j.1365-2567.2001.01189.x.

The 3'-untranslated region of human interleukin-8 mRNA suppresses IL-8 gene expression

Y Yu  1 , K Chadee
Affiliations

The 3'-untranslated region of human interleukin-8 mRNA suppresses IL-8 gene expression

Y Yu et al. Immunology. 2001 Apr.

Abstract

Although adenosine/uridine (AU)-rich sequences in the 3'-untranslated region (UTR) of the interleukin-8 (IL-8) gene have been suggested to contribute to its post-transcriptional regulation, the molecular basis whereby this occurs still needs to be understood. To investigate the role of the 3'-UTR on human IL-8 gene regulation, chimeric reporter genes were generated by adding full length or differentially deleted 3'-UTR of the IL-8 gene to chloramphenicol acetyltransferase (CAT). Addition of the entire IL-8 3'-UTR markedly reduced CAT mRNA and protein expression in COS 7 cells. In a reporter gene study, IL-8 3'-UTR destabilized CAT mRNA, which was dependent on active transcription in COS 7 cells. A 357-base sequence (nucleotides (nt) 2387-2743 of genomic DNA) within 3'-UTR, designated e, suppressed CAT gene expression by accelerating CAT mRNA turnover. A 26-base AU-rich sequence (nt 2552-2577) within e, containing four AUUUA pentamers that form two UAUUUAUU and one UUAUUUAU octamers, did not suppress CAT gene expression. However, deletion of the AU-rich sequences attenuated the inhibitory effect of e on CAT gene expression. Elimination of the first 100 bases (nt 2386-2486) attenuated the potency of fragment e, but much weaker than elimination of the first 146 bases (nt 2387-2533). This study gives new insights in unravelling the molecular mechanisms involved in the post-transcriptional regulation of the IL-8 gene.

PubMed Disclaimer

Figures

Figure 2
Figure 2
Effect of the IL-8 3′-UTR on CAT reporter gene and protein expression. A schematic diagram of the pcDNA3 vector cloning site and the CAT reporter gene constructs with or without IL-8 3′-UTR is shown. Differentially deleted fragments of the IL-8 3′-UTR were cloned into pcDNACAT using PCR primers or by using the indicated restriction sites. Cells (3–4 × 105) in a 60-mm dish were transiently transfected and CAT activity measured 36 hr after transfection. At the same time the Gal gene was cotransfected to normalize the transfection efficiency. CAT activity was determined by measuring acetylated chloramphenicol and CAT protein by double sandwich ELISA (see Materials and methods). Results are shown as relative CAT activity or CAT protein with pcDNACAT defined as 100%. Each value is the mean±sd. of triplicate measurements of one representative experiment. Similar results were obtained from three separate experiments. CMV, human cytomegalovirus promoter; BGH pA, bovine growth hormone polyadenylation signal for polyadenylation of transcribed mRNA; SV40, SV40 promoter.
Figure 1
Figure 1
Determination of the polyadenylation site of IL-8 gene arising from plasmid construct. (a) Product derived from RT–PCR to map the 3′ end of transcript derived from pcDNACAT-a. RNA was isolated from transfected cells and cDNAs were obtained by reverse transcription in the presence of oligonucleotide GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTT using total RNA from COS 7 cells transfected with pcDNACAT-a. PCR products were obtained using a pair of primers gatatc-TAAAAAAATTCATTTCTCTGTGGTATCC (sense) specific to the IL-8 gene and an anchor primer GGCCACGCGTCGACTAGTAC (antisense). PCR product (lane 2) was cloned into pGEM-T and sequenced. DNA marker is shown in lane 1. (b) Diagram showing the location of the poly(A) addition site for the transcript derived from the pcDNACAT-a construct. The poly(A) addition site occurred approximately 1248 bases downstream after the stop code of IL-8 gene.
Figure 3
Figure 3
Mutational analysis of e (nt 2378–2743) on CAT reporter gene expression. (a) Ribonucleotide sequence of e. AUUUA pentamers are underlined and AU-rich sequences (nt 2552–2577) are italicized. (b) Cells (3–4 × 105) in a 60-mm dish were transiently transfected with CAT reporter gene constructs with e and its mutants and CAT activity measured 36 hr after transfection. Gal gene was cotransfected to normalize the transfection efficiency. Results are shown as relative CAT activity with pcDNACAT defined as 100%. Each value is the mean±sd. of the mean of triplicate measurements of one representative experiment. Similar results were obtained from three separate experiments.
Figure 4
Figure 4
Effect of the IL-8 3′-UTR on CAT mRNA expression. (a) COS 7 cells were transiently transfected with pcDNACAT, pcDNACAT-a, pcDNACAT-d, pcDNACAT-e or pcDNACAT-f. Total RNA was extracted after 36 hr and CAT mRNA levels were measured by RT–PCR as described in Materials and methods. Neomycin (NEO) gene was used as internal control. The ratio of CAT mRNA and NEO represents the CAT mRNA level. Results are shown as relative CAT mRNA level with pcDNACAT defined as 100%. Each value is the mean ±sd. of the mean of three separate experiments. (b, c). COS 7 cells were transfected with pcDNACAT, pcDNACAT-a, or pcDNACAT-e. One hour after transfection, transfected cells was treated with (b) or without (c) actinomycin D (10 µg/ml). Gal gene was cotransfected to normalize the transfection efficiency. CAT and Gal mRNA levels were determined by ribonuclease protection assay at various times. The ratio of CAT and Gal represents CAT mRNA expression. One hundred percent of CAT mRNA represents the CAT mRNA level 1 hr post-transfection at time zero in the presence or absence of actinomycin D. Similar results were obtained from three separate experiments.
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Matsushima K, Morishita K, Yoshimura T, et al. Molecular cloning of a human monocyte-derived neutrophil chemotactic factor (MDNCF) and the induction of MDNCF mRNA by interleukin-1 and tumor necrosis factor. J Exp Med. 1998;167:1883–93. - PMC - PubMed
    1. Baggiolini M, Walz A, Kunkel SL. Neutrophil-activating peptide-1/interleukin 8, a novel cytokine that activates neutrophils. J Clin Invest. 1989;84:1045–9. - PMC - PubMed
    1. Baggiolini M, Dewald B, Moser B. Interleukin-8 and related chemotactic cytokines-CXC and CC chemokines. Adv Immunol. 1994;55:97–197. - PubMed
    1. Baggiolini M, Dewald B, Moser B. Human chemokines: an update. Annu Rev Immunol. 1997;15:675–705. - PubMed
    1. Gillitzer R, Berger R, Meilke V, Miler C, Wolff K, Sting G. Upper keratinocytes of psoriatic skin lesions express high levels of NAP-1/IL-8 mRNA in situ. J Invest Dermatol. 1991;97:73–9. - PubMed

Publication types

MeSH terms

LinkOut - more resources