Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2000 Dec;182(23):6679-86.
doi: 10.1128/JB.182.23.6679-6686.2000.

Catalase-peroxidases of Legionella pneumophila: cloning of the katA gene and studies of KatA function

P Bandyopadhyay  1 , H M Steinman
Affiliations

Catalase-peroxidases of Legionella pneumophila: cloning of the katA gene and studies of KatA function

P Bandyopadhyay et al. J Bacteriol. 2000 Dec.

Abstract

Legionella pneumophila, the causative organism of Legionnaires' pneumonia, contains two enzymes with catalatic and peroxidatic activity, KatA and KatB. To address the issue of redundant, overlapping, or discrete in vivo functions of highly homologous catalase-peroxidases, the gene for katA was cloned and its function was studied in L. pneumophila and Escherichia coli and compared with prior studies of katB in this laboratory. katA is induced during exponential growth and is the predominant peroxidase in stationary phase. When katA is inactivated, L. pneumophila is more sensitive to exogenous hydrogen peroxide and less virulent in the THP-1 macrophage cell line, similar to katB. Catalatic-peroxidatic activity with different peroxidatic cosubstrates is comparable for KatA and KatB, but KatA is five times more active towards dianisidine. In contrast with these examples of redundant or overlapping function, stationary-phase survival is decreased by 100- to 10,000-fold when katA is inactivated, while no change from wild type is seen for the katB null. The principal clue for understanding this discrete in vivo function was the demonstration that KatA is periplasmic and KatB is cytosolic. This stationary-phase phenotype suggests that targets sensitive to hydrogen peroxide are present outside the cytosol in stationary phase or that the peroxidatic activity of KatA is critical for stationary-phase redox reactions in the periplasm, perhaps disulfide bond formation. Since starvation-induced stationary phase is a prerequisite to acquisition of virulence by L. pneumophila, further studies on the function and regulation of katA in stationary phase may give insights on the mechanisms of infectivity of this pathogen.

PubMed Disclaimer

Figures

FIG. 1
FIG. 1
Restriction map of the L. pneumophila katA locus. The open horizontal bar at the bottom depicts the region sequenced (5,249 nt). Every nucleotide reported was identified in at least two sequencing runs with different primers. Restriction sites: B, BamHI; E, EcoRI. The distance between BamHI sites is 6.7 kb. The katA ORF and direction of transcription are indicated. The cross-hatched bar above the ORF indicates the internal EcoRI-EcoRI fragment used to make the chromosomal katA disruption. Fragments amplified by PCR are indicated by dashed (lacZ fusion plasmid) and dotted (katA+ complementation plasmid) lines. The 5′ and 3′ PCR primers for the lacZ fusion fragment were TGACAAAGGATCCAGTTTGGCACAAAGCACAACC and GAGTGACTGCAGCAAACAGAGGTATTGTTCGTTTG, respectively. The 5′ and 3′ PCR primers for the complementation plasmid were AAAGGATCAGGTAGGATCCCGTGGCATTAATGAACCGGAGG and AAGCGGTTATCTGGATCCGGTGAACATGAAAGTCGCATGC, respectively. The underlined segments are restriction sites for BamHI, PstI, BamHI, and BamHI, respectively, which replace 6 nt in the L. pneumophila genomic sequence.
FIG. 2
FIG. 2
Zymogram stains of catalatic and peroxidatic activities. Cell extracts were electrophoresed under nondenaturing conditions and stained for catalatic (left) or diaminobenzidine peroxidatic (right) activity. Lanes 1, strain PB126 (katA null); lanes 2, strain PB140 (katA katB null), 275 μg of cell protein from an overnight culture per lane; lanes 3, 4, and 5, wild-type strain JR32 from, respectively, exponential-phase cultures (optical density at 600 nm, 0.69 and 1.45, respectively) and a 48-h culture (250 μg of cell protein per lane).
FIG. 3
FIG. 3
Stationary-phase survival. Titers were determined on CYE plates at the indicated times following inoculation into CAYE broth of wild-type strain JR32 (●), katA null strain PB126 (○), and katA null strain with complementing vector pMMB207αB-Km14::katA+ (▾). Standard deviations are shown by the error bars or are contained within the symbols.
FIG. 4
FIG. 4
Expression of katA during growth. Wild-type strain JR32 containing the lacZ translational fusion plasmid pJBZ281::PkatA was cultured in AYE medium, and at the indicated times aliquots were removed for determination of optical density at 600 nm (OD600) (●) and LacZ measurements (bars).
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Aebi H. Catalase in vitro. Methods Enzymol. 1984;108:121–126. - PubMed
    1. Alley M R K, Gomes S L, Alexander W, Shapiro L. Genetic analysis of a temporally transcribed chemotaxis gene cluster in Caulobacter crescentus. Genetics. 1991;129:333–342. - PMC - PubMed
    1. Amemura-Maekawa J, Mishima-Abe S, Kura F, Takahashi T, Watanabe H. Identification of a novel periplasmic catalase-peroxidase KatA of Legionella pneumophila. FEMS Microbiol Lett. 1999;176:339–344. - PubMed
    1. Aslund F, Beckwith J. The thioredoxin superfamily: redundancy, specificity, and gray-area genomics. J Bacteriol. 1999;181:1375–1379. - PMC - PubMed
    1. Bader M, Muse W, Ballou D P, Gassner C, Bardwell J C. Oxidative protein folding is driven by the electron transport system. Cell. 1999;98:217–227. - PubMed

Publication types

MeSH terms

Associated data

LinkOut - more resources