Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2000 Oct 10;97(21):11466-71.
doi: 10.1073/pnas.97.21.11466.

Selective CXCR4 antagonism by Tat: implications for in vivo expansion of coreceptor use by HIV-1

H Xiao  1 , C Neuveut, H L Tiffany, M Benkirane, E A Rich, P M Murphy, K T Jeang
Affiliations

Selective CXCR4 antagonism by Tat: implications for in vivo expansion of coreceptor use by HIV-1

H Xiao et al. Proc Natl Acad Sci U S A. .

Abstract

Chemokines and chemokine receptors play important roles in HIV-1 infection and tropism. CCR5 is the major macrophage-tropic coreceptor for HIV-1 whereas CXC chemokine receptor 4 (CXCR4) serves the counterpart function for T cell-tropic viruses. An outstanding biological mystery is why only R5-HIV-1 is initially detected in new seroconvertors who are exposed to R5 and X4 viruses. Indeed, X4 virus emerges in a minority of patients and only in the late stage of disease, suggesting that early negative selection against HIV-1-CXCR4 interaction may exist. Here, we report that the HIV-1 Tat protein, which is secreted from virus-infected cells, is a CXCR4-specific antagonist. Soluble Tat selectively inhibited the entry and replication of X4, but not R5, virus in peripheral blood mononuclear cells (PBMCs). We propose that one functional consequence of secreted Tat is to select against X4 viruses, thereby influencing the early in vivo course of HIV-1 disease.

PubMed Disclaimer

Figures

Figure 1
Figure 1
Tat binds directly to CXCR4 and competes for 125I-SDF-1α binding to CXCR4. (a) Separate bindings of 125I-labeled SDF-1α (Left), RANTES (Center), or MIP-1β (Right) to cells were competed either with escalating concentrations (12.5 nM, 25 nM, and 100 nM) of a 40-aa Tat peptide corresponding to residues 11 to 50 or with an excess (100 nM) of unlabeled cognate chemokine (last bar in each panel). SDF-1α binding to CXCR4 was measured by using human PBMCs; RANTES or MIP-1β binding to CCR5 used CCR5/293 cells stably transfected with hCCR5. (b) GST-protein affinity chromatography shows direct binding of Tat to CXCR4. 35S-labeled chemokine receptors were translated in vitro from T7-generated transcripts in rabbit reticulocyte lysate and then incubated with 50 μl of glutathione-Sepharose beads saturated with either GST (lane 2) or GST-Tat (lane 3). Beads were washed twice (each time with 20 column volumes of buffer containing 100 mM NaCl). Proteins retained by either GST or GST-Tat were visualized by boiling washed beads in reducing SDS-sample buffer followed by PAGE and autoradiography.
Figure 2
Figure 2
Tat antagonizes signaling by CXCR4, but not CCR5, agonists. (Panel 1) Tat wild-type (wt) (residues 11–50), but not Tat-mCXC (cysteines at residues 25 and 27 changed to alanines), peptide-desensitized SDF-1-induced calcium mobilization. Tat peptides were added 50–100 s before SDF-1; measurements of calcium flux followed. Tat wt peptide did not affect RANTES signaling in PBMCs (panel 2) and monocytes (panel 3); nor MIP1α (panel 4) or MIP1β (panel 5) signaling in PBMCs. In each panel, the top tracing is the addition of chemokine alone (100 nM) whereas the bottom tracing(s) is pretreatment with Tat peptide(s) (200 nM), followed by addition of indicated chemokine (100 nM).
Figure 3
Figure 3
Tat inhibits CXCR4-dependent infection of cells by HIV-1 NL4-3. Phytohemagglutinin-stimulated PBMCs were infected with 100 TCID50 of NL4-3 in the presence of indicated proteins at either 2 mg/ml (a) or 20 ng/ml (b). Fresh proteins were replenished into cultures at days 4, 8, and 12, and media supernatants were sampled for RT activity. Representative day 4 RT values (similar profiles were also seen on days 8 and 12; not shown) are presented; results were replicated three times. (c) Tat and SDF-1 synergistically inhibit NL4-3-infection of PBMCs. PBMCs with MBP alone, MBP + SDF-1, or MBP + SDF-1 + MBPTat72 were infected with NL4-3. SDF-1 concentration was 800 ng/ml; MBP or MBPTat72 was at 2 μg/ml. RT average values from three independent experiments are from day 8 after infection.
Figure 4
Figure 4
Tat inhibits X4-dependent infection at the step of viral entry into cells. HOS-CD4 cells stably expressing individual coreceptors (AIDS Reagent Repository, National Institute of Allergy and Infectious Diseases) were infected either with DNase I-treated NL4-3 (X4-tropic) or NLAD8 (ref. ; NL4-3 modified to contain an R5-tropic envelope). At time of infection, affinity-purified MBP or MBPTat72 fusion protein was added separately to final concentrations of 100 ng/ml. Cells were harvested at indicated times (hours postinfection), washed, and resuspended into PCR lysis buffer [10 mM Tris⋅HCl (pH 8.0)/0.5 mM EDTA/0.001% Triton X-100/0.0001% SDS). PCR products from nef-R primer pair (5′-AGCTGTAGATCTTAGCCACTT-3′ and 5′-AGGCTCAGATCTGGTCTAA-3′) were visualized after hybridization with a 32P-labeled HIV-1 LTR probe. Control PCRs on the same samples used β-actin-specific primers (ethidium bromide-stained bands). (A) Schematics of the HIV-1 LTR and primers used. Virus-specific signal is 522 bp. (B) PCR analysis of NL4-3/NLAD8 infection of HOS-CXCR4/HOS-CCR5 (Left and Right, respectively). Tat inhibited NL4-3 entry into HOS-CXCR4 (lanes 4 and 6) but not NLAD8 entry into HOS-CCR5 (lanes 10 and 12). HIV-1 (arrow) points to the virus-specific 522-bp band. (C) MAGI analysis of R5- or X4-dependent viral entry into cells. RT-normalized virus stocks (3,000 cpm) of NL4-3 or NLAD8 were used to infect either U373-MAGI-CXCR4 or U373-MAGI-CCR5 cells in the presence of MBP (−Tat) or MBPTat72 (+Tat). Cells were processed for beta-galactosidase staining (31) 48 h after infection. Values are averages from three assays.
Figure 5
Figure 5
Extracellular Tat selects against X4-tropism. (A) A two-step PCR protocol for detecting changes at residue 25 of the V3 loop. The region surrounding position 25 was first amplified by using primers (5′, GTAATTAATTGTACAAGACCCAAC and 3′, CTACTAACGTTACAATGAGCTTGTC). Changes at position 25 were queried by a further one-cycle PCR separately by using one of three codon-specific 32P-labeled inner primers (“labeling” primer). (B and C) Evolution at position 25 in V3 when X4-NL4-3-infected PBMCs were maintained with either MBPTat72 (B) or MBP (C). Cells were harvested at the indicated days postinfection and analyzed by PCR. K to Q change seen in the MBPTat72 samples is absent in the MBP samples. (D) Phenotypic analysis of MBPTat72-selected NL4-3 virus. RT-normalized (3,000 cpm) viral samples were collected at the indicated days after infection and assayed on U373-MAGI-CXCR4 or U373-MAGI-CCR5 cells. Assays were in triplicate, and average values are presented. Range of values varied by less than 20%. Proportion of NL4-3 virus that showed R5 phenotype at day 35 was calculated by using the formula [(U373-MAGI-CCR5 day 35 value) − (U373-MAGI-CCR5 day 0 value)]/[(U373-MAGI-CCR5 day 35 value) + (U373-MAGI-CXCR4 day 35 value)]. The proportion of R5-tropic NL4-3 at day 35 was (11 − 7)/[11 + 165] = 2%; and (29 − 7)/[129 + 29] = 14% for −Tat and +Tat samples, respectively.
Figure 6
Figure 6
Examples of soluble Tat detected in HIV-1+ sera. Recombinant MBP-Tat protein (0.1 ng, 1 ng, or 10 ng) were spotted onto PVDF-squares (top row). Eighty anonymous patient sera in 0.5-ml aliquots were dot-spotted onto individual filters and were screened in two parallel sets by using rabbit anti-Tat polyclonal sera with (anti-Tat + Tat) or without (anti-Tat) competition with soluble MBP-Tat protein. Six examples, which include five anti-Tat reactive and one nonreactive (bottom rightmost square, anti-Tat) samples, are shown. The same six samples were reacted with goat anti-human IgG to verify for equivalence in spotting (last two rows; goat anti-huIgG).
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Berger E A, Murphy P M, Farber J M. Annu Rev Immunol. 1999;17:657–700. - PubMed
    1. Alkhatib G, Combadiere C, Broder C C, Feng Y, Kennedy P E, Murphy P M, Berger E A. Science. 1996;272:1955–1958. - PubMed
    1. Deng H K, Unutmaz D, KewalRamani V N, Littman D R. Nature (London) 1996;381:661–666. - PubMed
    1. Dragic T, Litwin V, Allaway G P, Martin S R, Huang Y, Nagashima K A, Cayanan C, Maddon P J, Koup R A, Moore J P, Paxton W A. Nature (London) 1996;381:667–673. - PubMed
    1. Berger E A, Doms R W, Fenyo E M, Korber B T, Littman D R, Moore J P, Sattentau Q J, Schuitemaker H, Sodroski J, Weiss R A. Nature (London) 1998;391:240. (lett.). - PubMed

Publication types

LinkOut - more resources