Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2000 Jan 22;9(2):187-94.
doi: 10.1093/hmg/9.2.187.

Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase

E Earle  1 , A Saxena, A MacDonald, D F Hudson, L G Shaffer, R Saffery, M R Cancilla, S M Cutts, E Howman, K H Choo
Affiliations

Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase

E Earle et al. Hum Mol Genet. .

Abstract

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.

PubMed Disclaimer

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

Publication types

Substances

LinkOut - more resources