Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2018 Oct 3;18(1):216.
doi: 10.1186/s12870-018-1424-0.

The rare orange-red colored Euphorbia pulcherrima cultivar 'Harvest Orange' shows a nonsense mutation in a flavonoid 3'-hydroxylase allele expressed in the bracts

Daria Nitarska  1 , Carmen Stefanini  2 , Christian Haselmair-Gosch  1 , Silvija Miosic  1 , Benjamin Walliser  1 , Maja Mikulic-Petkovsek  3 , Ionela Regos  2 , Ana Slatnar  3 , Thomas Debener  4 , Diro Terefe-Ayana  4 , Vinicius Vilperte  4 , Johannes Hadersdorfer  2 , Karl Stich  1 , Heidi Halbwirth  5
Affiliations

The rare orange-red colored Euphorbia pulcherrima cultivar 'Harvest Orange' shows a nonsense mutation in a flavonoid 3'-hydroxylase allele expressed in the bracts

Daria Nitarska et al. BMC Plant Biol. .

Abstract

Background: Commercially available poinsettia (Euphorbia pulcherrima) varieties prevalently accumulate cyanidin derivatives and show intense red coloration. Orange-red bract color is less common. We investigated four cultivars displaying four different red hues with respect to selected enzymes and genes of the anthocyanin pathway, putatively determining the color hue.

Results: Red hues correlated with anthocyanin composition and concentration and showed common dark red coloration in cultivars 'Christmas Beauty' and 'Christmas Feeling' where cyanidin derivatives were prevalent. In contrast, orange-red bract color is based on the prevalent presence of pelargonidin derivatives that comprised 85% of the total anthocyanin content in cv. 'Premium Red' and 96% in cv. 'Harvest Orange' (synonym: 'Orange Spice'). cDNA clones of flavonoid 3'-hydroxylase (F3'H) and dihydroflavonol 4-reductase (DFR) were isolated from the four varieties, and functional activity and substrate specificity of the corresponding recombinant enzymes were studied. Kinetic studies demonstrated that poinsettia DFRs prefer dihydromyricetin and dihydroquercetin over dihydrokaempferol, and thus, favor the formation of cyanidin over pelargonidin. Whereas the F3'H cDNA clones of cultivars 'Christmas Beauty', 'Christmas Feeling', and 'Premium Red' encoded functionally active enzymes, the F3'H cDNA clone of cv. 'Harvest Orange' contained an insertion of 28 bases, which is partly a duplication of 20 bases found close to the insertion site. This causes a frameshift mutation with a premature stop codon after nucleotide 132 and, therefore, a non-functional enzyme. Heterozygosity of the F3'H was demonstrated in this cultivar, but only the mutated allele was expressed in the bracts. No correlation between F3'H-expression and the color hue could be observed in the four species.

Conclusions: Rare orange-red poinsettia hues caused by pelargonidin based anthocyanins can be achieved by different mechanisms. F3'H is a critical step in the establishment of orange red poinsettia color. Although poinsettia DFR shows a low substrate specificity for dihydrokaempferol, sufficient precursor for pelargonidin formation is available in planta, in the absence of F3'H activity.

Keywords: Anthocyanin; Bract coloration; Cyanidin; Dihydroflavonol 4-reductase (DFR); Flavonoid 3′-hydroxylase (F3′H); Pelargonidin; Poinsettia (Euphorbia pulcherrima); Substrate specificity.

PubMed Disclaimer

Conflict of interest statement

Ethics approval and consent to participate

All plant material used in this study is commercially available from the sources listed under methods subsection Plant Material.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Figures

Fig. 1
Fig. 1
a Simplified overview of the anthocyanin pathway. Abbrev: ANS: anthocyanidin synthase, CHI: chalcone isomerase, CHS: chalcone synthase, DFR: dihydroflavonol 4-reductase, FHT: flavanone 3-hydroxylase, F3′H: flavonoid 3′-hydroxylase, F3′5′H: flavonoid 3′,5′-hydroxylase. b Euphorbia pulcherrima cv. ‘Christmas Feeling’ (CF), cv. ‘Christmas Beauty’ (CB), cv. ‘Premium Red’ (PR), cv. ‘Harvest Orange’ (HO)
Fig. 2
Fig. 2
Multiple alignment of deduced amino acid sequences of F3′H cDNA clones of Euphorbia pulcherrima cvs. ‘Harvest Orange’ (EpHO_F3′H, KY273441), ‘Premium Red’ (EpPR_F3′H, KY489667), ‘Christmas Beauty’ (EpCB_F3′H, KY273439), and ‘Christmas Feeling’ (EpCF_F3′H, KY273440). Grey frames highlight characteristic sequences of the P450 protein family. 1. Proline-rich region [40]; 2. Oxygen binding pocket [41]; 3. Heme binding motif (Prosite pattern PS00086, [42]; 4. Substrate recognition site (SRS) 6 according to Seitz et al. [43]
Fig. 3
Fig. 3
Multiple alignment of a selected part of the nucleotide sequences at the 5′-terminus of F3′H cDNA clones of Euphorbia pulcherrima cvs. ‘Harvest Orange’ (EpHO_F3′H, KY273441), ‘Premium Red’ (EpPR_F3′H, KY489667), ‘Christmas Beauty’ (EpCB_F3′H, KY273439), and ‘Christmas Feeling’ (EpCF_F3′H, KY273440). The grey-shaded frame highlights the repetition of ACCATTTTTTCTGCCATTTT from position 22 to 41 in position 50 to 69 (numbering from EpHO_F3′H)
Fig. 4
Fig. 4
Quantitative expression of F3′H normalized to glycerine aldehyde 3-phosphate dehydrogenase (GAPDH) in Euphorbia pulcherrima cvs. ‘Harvest Orange’ (HO), ‘Premium Red’ (PR), ‘Christmas Beauty’ (CB), and ‘Christmas Feeling’ (CF). Left: Three year old plants kept in the greenhouse. Right: Plants in their first year cultivated in house under standard conditions. Data were calculated from three biological replicates with at least two technical replicates and with error bars representing standard deviation
Fig. 5
Fig. 5
Amplification of F3′H with the primer pair EpF3′H_fraF and EpF3′H_fraR (Additional file 5: Table S4) flanking the variable region at the N-terminal end using genomic DNA (a) and cDNA (b) from the four poinsettia cultivars ‘Harvest Orange’ (HO), ‘Premium Red’ (PR), Christmas (CB) and ‘Christmas Feeling’ (CF). For cv. ‘Harvest Orange’, amplification from gDNA delivered two fragments of the expected size (calculated values: 109 and 138 bp), whereas only the larger fragment was obtained with cDNA. With gDNA and cDNA from the other cultivars only a single fragment of the smaller size was obtained. Size marker (M) was the 2-Log DNA Ladder (New England Biolabs, UK) with digested DNA fragments ranging from 100 bp to 10 kbp (100 bp steps between 100 and 1000); 100 and 200 bp fragments are highlighted on the gel with red arrows
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Ecke P. Ill.: Ball Pub. 2004. The Ecke poinsettia manual. Batavia.
    1. Mol J, Grotewold E, Koes R. How genes paint flowers and seeds. Trends Plant Sci. 1998;3(6):212–217. doi: 10.1016/S1360-1385(98)01242-4. - DOI
    1. Halbwirth H. The creation and physiological relevance of divergent hydroxylation patterns in the flavonoid pathway. Int J Mol Sci. 2010;11(2):595–621. doi: 10.3390/ijms11020595. - DOI - PMC - PubMed
    1. Horn JW, van Ee BW, Morawetz JJ, Riina R, Steinmann VW, Berry PE, Wurdack KJ. Phylogenetics and the evolution of major structural characters in the giant genus Euphorbia L.(Euphorbiaceae) Mol Phylogenet Evol. 2012;63(2):305–326. doi: 10.1016/j.ympev.2011.12.022. - DOI - PubMed
    1. Stewart R, Asen S, Massie D, Norris K. The identification of poinsettia cultivars by HPLC analysis of their anthocyanin content. Biochem Syst Ecol. 1979;7(4):281–287. doi: 10.1016/0305-1978(79)90005-X. - DOI

MeSH terms

LinkOut - more resources