Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 1987 Feb;61(2):465-71.
doi: 10.1128/JVI.61.2.465-471.1987.

Epstein-Barr virus nuclear antigen forms a complex that binds with high concentration dependence to a single DNA-binding site

G Milman, E S Hwang

Epstein-Barr virus nuclear antigen forms a complex that binds with high concentration dependence to a single DNA-binding site

G Milman et al. J Virol. 1987 Feb.

Abstract

A bacterially synthesized 28-kilodalton carboxyl-terminal fragment (28K-EBNA of Epstein-Barr virus nuclear antigen shows highly concentration dependent binding to monomer, dimer, and trimer copies of synthetic DNA-binding site 5' GATCTAGGATAGCATATGCTACCCCGGGG 3' 3' ATCCTATCGTATACGATGGGGCCCCCTAG 5' in bacterial plasmids. The rate of the binding reaction is independent of the number of sites, but dependent upon the length of the DNA containing the sites. These data are consistent with 28K-EBNA locating its binding sites by a process of facilitated transfer or sliding along the DNA. The highly concentration dependent binding suggests that multiple 28K-EBNA monomer polypeptides form a complex before or during binding. Binding occurs equally well at 24 and 37 degrees C, but not at 0 degrees C. A 28K-EBNA complex bound to a single site has unoccupied binding sites capable of interacting with additional DNA molecules. Such interaction is confirmed by agarose gel electrophoresis of protein-DNA complexes which indicate that a 28K-EBNA complex forms bridges between two DNA molecules. A bridge between the two binding regions in the Epstein-Barr virus origin of plasmid replication (oriP) would form a loop structure which could be an important feature for the regulatory function of authentic Epstein-Barr virus nuclear antigen.

PubMed Disclaimer

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. J Mol Biol. 1969 Aug 14;43(3):479-85 - PubMed
    1. Mol Cell Biol. 1985 Aug;5(8):1822-32 - PubMed
    1. Rev Infect Dis. 1982 Sep-Oct;4(5):1048-61 - PubMed
    1. Gene. 1982 Oct;19(3):259-68 - PubMed
    1. Cell. 1983 Jan;32(1):161-8 - PubMed

Publication types

LinkOut - more resources