Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2014 May;88(9):5087-99.
doi: 10.1128/JVI.00184-14. Epub 2014 Feb 26.

In vivo ablation of type I interferon receptor from cardiomyocytes delays coxsackieviral clearance and accelerates myocardial disease

Nadine Althof  1 , Stephanie Harkins, Christopher C Kemball, Claudia T Flynn, Mehrdad Alirezaei, J Lindsay Whitton
Affiliations

In vivo ablation of type I interferon receptor from cardiomyocytes delays coxsackieviral clearance and accelerates myocardial disease

Nadine Althof et al. J Virol. 2014 May.

Abstract

Acute coxsackievirus B3 (CVB3) infection is one of the most prevalent causes of acute myocarditis, a disease that frequently is identified only after the sudden death of apparently healthy individuals. CVB3 infects cardiomyocytes, but the infection is highly focal, even in the absence of a strong adaptive immune response, suggesting that virus spread within the heart may be tightly constrained by the innate immune system. Type I interferons (T1IFNs) are an obvious candidate, and T1IFN receptor (T1IFNR) knockout mice are highly susceptible to CVB3 infection, succumbing within a few days of challenge. Here, we investigated the role of T1IFNs in the heart using a mouse model in which the T1IFNR gene can be ablated in vivo, specifically in cardiomyocytes. We found that T1IFN signaling into cardiomyocytes contributed substantially to the suppression of viral replication and infectious virus yield in the heart; in the absence of such signaling, virus titers were markedly elevated by day 3 postinfection (p.i.) and remained high at day 12 p.i., a time point at which virus was absent from genetically intact littermates, suggesting that the T1IFN-unresponsive cardiomyocytes may act as a safe haven for the virus. Nevertheless, in these mice the myocardial infection remained highly focal, despite the cardiomyocytes' inability to respond to T1IFN, indicating that other factors, as yet unidentified, are sufficient to prevent the more widespread dissemination of the infection throughout the heart. The absence of T1IFN signaling into cardiomyocytes also was accompanied by a profound acceleration and exacerbation of myocarditis and by a significant increase in mortality.

Importance: Acute coxsackievirus B3 (CVB3) infection is one of the most common causes of acute myocarditis, a serious and sometimes fatal disease. To optimize treatment, it is vital that we identify the immune factors that limit virus spread in the heart and other organs. Type I interferons play a key role in controlling many virus infections, but it has been suggested that they may not directly impact CVB3 infection within the heart. Here, using a novel line of transgenic mice, we show that these cytokines signal directly into cardiomyocytes, limiting viral replication, myocarditis, and death.

PubMed Disclaimer

Figures

FIG 1
FIG 1
Hepatic and cardiac CVB titers in interferon single- and double-receptor knockout mice. (A) PBMC were isolated from the four indicated strains of mice—wt, T1IFNRKO, IFN-γRKO, and double-receptor knockout (DRKO)—and their expression of IFN-α receptor 1 and IFN-γ receptor 1 was confirmed by flow cytometry. (B and C) The mice then were challenged with 103 PFU of wtCVB3 i.p. Two to 3 days later, the mice were sacrificed and perfused, and virus titers were determined in the liver (B) and heart (C). Means + standard errors are shown.
FIG 2
FIG 2
Generation and characterization of mice with inducible, cardiomyocyte-specific, interruption of the T1IFNR gene. (A) The locations of the loxP sites and the primers used for PCR, and the predicted amplicon sizes, are shown for both intact floxed DNA and for DNA that has been subjected to Cre recombinase action. Primer 1 sequence, 5′GAATGTAGTCTGTAATACGC3′; primer 2 sequence, 5′CTTTTTGGATCGATCCATAACTTCG3′. (B) T1IFNRf/f mice, with or without the CMMCM cassette as indicated, received a single inoculation of either Tam (+) or vehicle alone (corn oil; −). Four days later, the mice were sacrificed and the indicated tissues, as well as kidney, spleen, brain, and lung (not shown), were harvested. DNA was isolated, and PCR was carried out using the above primers. Sk., skeletal.
FIG 3
FIG 3
Reporter mice reveal the extent and cell specificity of Tam-induced Cre activity. CMMCM mice were crossed with mice that were homozygous for a Cre reporter cassette in which the open reading frame encoding mGFP is preceded by a strong transcriptional termination signal. As confirmed by PCR screening, all F1 offspring carried the reporter cassette, and ∼50% were double-transgenic, i.e., they also carried the CMMCM cassette. Groups of F1 mice (CMMCM and MCM− littermates, all reporter+) were inoculated with Tam and were sacrificed 4 days later. One group of double-transgenic animals received vehicle alone (corn oil). The expression of mGFP (reflecting MCM enzymatic activity) was determined in heart and liver using confocal microscopy of vibratome sections. Blue, nuclei (Hoechst 33342 dye); ochre, F-actin (phalloidin-Alexa Fluor 647 dye; phalloidin binds to F-actin, thereby revealing the cytoskeleton). In all panels, the upper row shows blue and green color channels, and the lower row shows the identical fields, this time with all three channels. (A to C) Heart sections (longitudinal and transverse sections in left and right columns, respectively). (D) Transverse heart section, showing absence of mGFP on vascular endothelial cells (lower right corner of images; indicated by red arrowheads in upper image). (E) Organ specificity, shown by absence of mGFP on hepatocytes.
FIG 4
FIG 4
Ablation of T1IFN receptor from cardiomyocytes results in early loss of viral control in the heart but not in the liver. Eight- to 20-week-old CMMCM T1IFNRf/f mice (red bars) and littermate MCM− controls (green bars) were treated with Tam as described, and at least 2 weeks were allowed to elapse. The mice then were infected with wtCVB3 (500 PFU i.p.). (A and B) Mice were sacrificed at the indicated time points p.i., and viral titers were determined in the heart (A) and liver (B). The number of mice evaluated at each time point is indicated by white numerals near the base of each bar and represents the cumulative data derived from several separate experiments, in all of which the groups were age and sex matched. The lower limit of virus detection was 100 PFU per gram of tissue. ND, not detected. (C) Blood samples were drawn either prior to infection (day 0) or at day 3, 6, or 10 p.i., and serum IFN-α levels were determined by ELISA.
FIG 5
FIG 5
Effects of cardiomyocyte-specific deletion of type I IFN signaling on viral RNA. (A) Viral genomic RNA content was determined by reverse transcription-qPCR as described in Materials and Methods. All mice were T1IFNRf/f and had been treated with Tam at least 2 weeks prior to infection. Means + standard errors are shown. (B) The correlations between infectious virus titer (data in Fig. 4A) and genome copy number (this figure, panel A) between days 2 and 8 p.i. are shown, together with a best-fit linear regression line. (C) In situ hybridization was carried out on hearts at day 8 p.i. Mice are identified by their designated number (#), and for each mouse, the copy number of genomic RNA per gram of heart (c/g), measured by qPCR (A), is shown. Top row, probe detecting genomic RNA; bottom row, probe detecting antigenomic RNA.
FIG 6
FIG 6
CVB-induced pathology is accelerated and exacerbated in the absence of T1IFN signaling into cardiomyocytes. T1IFNRf/f mice (MCM− or CMMCM) were treated with Tam and then infected with 500 PFU of wtCVB3. (A) Paraffin-embedded sections from hearts of representative mice are shown (day 6 or day 8 p.i., stained with Masson's trichrome). For the day 8 MCM− image, yellow arrows indicate two small inflammatory lesions, and the white arrow shows a larger lesion. (B) In a separate experiment, survival of both Tam-treated mouse strains was assessed over a 12-day period. Kaplan-Meier survival curves, and statistical comparisons thereof (log-rank, Mantel-Cox), were generated using GraphPad Prism v6.04.
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Magnani JW, Dec GW. 2006. Myocarditis: current trends in diagnosis and treatment. Circulation 113:876–890. 10.1161/CIRCULATIONAHA.105.584532 - DOI - PubMed
    1. Esfandiarei M, McManus BM. 2008. Molecular biology and pathogenesis of viral myocarditis. Annu. Rev. Pathol. 3:127–155. 10.1146/annurev.pathmechdis.3.121806.151534 - DOI - PubMed
    1. Marchant D, Si X, Luo H, McManus B, Yang D. 2008. The impact of CVB3 infection on host cell biology. Curr. Top. Microbiol. Immunol. 323:177–198. 10.1007/978-3-540-75546-3_8 - DOI - PubMed
    1. Andreoletti L, Leveque N, Boulagnon C, Brasselet C, Fornes P. 2009. Viral causes of human myocarditis. Arch. Cardiovasc. Dis. 102:559–568. 10.1016/j.acvd.2009.04.010 - DOI - PubMed
    1. Mahfoud F, Gartner B, Kindermann M, Ukena C, Gadomski K, Klingel K, Kandolf R, Bohm M, Kindermann I. 2011. Virus serology in patients with suspected myocarditis: utility or futility? Eur. Heart J. 32:897–903. 10.1093/eurheartj/ehq493 - DOI - PubMed

Publication types

Substances