Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2013 Aug 23:8:21.
doi: 10.1186/1745-6150-8-21.

Circularity and self-cleavage as a strategy for the emergence of a chromosome in the RNA-based protocell

Wentao Ma  1 , Chunwu Yu, Wentao Zhang
Affiliations

Circularity and self-cleavage as a strategy for the emergence of a chromosome in the RNA-based protocell

Wentao Ma et al. Biol Direct. .

Abstract

Background: It is now popularly accepted that an "RNA world" existed in early evolution. During division of RNA-based protocells, random distribution of individual genes (simultaneously as ribozymes) between offspring might have resulted in gene loss, especially when the number of gene types increased. Therefore, the emergence of a chromosome carrying linked genes was critical for the prosperity of the RNA world. However, there were quite a few immediate difficulties for this event to occur. For example, a chromosome would be much longer than individual genes, and thus more likely to degrade and less likely to replicate completely; the copying of the chromosome might start at middle sites and be only partial; and, without a complex transcription mechanism, the synthesis of distinct ribozymes would become problematic.

Results: Inspired by features of viroids, which have been suggested as "living fossils" of the RNA world, we supposed that these difficulties could have been overcome if the chromosome adopted a circular form and small, self-cleaving ribozymes (e.g. the hammer head ribozymes) resided at the sites between genes. Computer simulation using a Monte-Carlo method was conducted to investigate this hypothesis. The simulation shows that an RNA chromosome can spread (increase in quantity and be sustained) in the system if it is a circular one and its linear "transcripts" are readily broken at the sites between genes; the chromosome works as genetic material and ribozymes "coded" by it serve as functional molecules; and both circularity and self-cleavage are important for the spread of the chromosome.

Conclusions: In the RNA world, circularity and self-cleavage may have been adopted as a strategy to overcome the immediate difficulties for the emergence of a chromosome (with linked genes). The strategy suggested here is very simple and likely to have been used in this early stage of evolution. By demonstrating the possibility of the emergence of an RNA chromosome, this study opens on the prospect of a prosperous RNA world, populated by RNA-based protocells with a number of genes, showing complicated functions.

PubMed Disclaimer

Figures

Figure 1
Figure 1
Circularity and self-cleavage as a strategy for the primary chromosome in the RNA world. Thick lines represent the sense chain, and thin lines represent the antisense chain. The linear RNAs, which arise from the spontaneous break of the sense chain or partial copying of the antisense chain, may be readily broken at sites (labeled by virtual bands) between the linked genes. This feature may be implemented by the participation of short self-cleaving ribozymes residing at these sites. The products of the cleavage are the RNAs that may fold into various ribozymes (crescent-shapes). Note: the self-cleaving effect would not occur in the circular chromosome because steric constraints would inhibit the folding and function of the embedded self-cleaving ribozymes, consistent with the situations in viroids [11,12].
Figure 2
Figure 2
Representative case showing the spread of the chromosome. (A) At the molecular level. The characteristic domains for the ribozymes (stars) Rep (red), Nsr (green), Npsr (magenta) and Asr (blue) are assumed to be “GAGUCUCU”, “GCUCGUAU”, “GGUUCGAU” and “GCGACUUU”, respectively. The sense chain of the chromosome (yellow triangles) has a sequence of these four domains in a tandem and circular way. The antisense chain of the chromosome (x-shapes) is complementary to the sense chain. Linear RNA chains are assumed to break more readily (involving the factor FIB) at sites after U and before G than other sites, which represents the self-cleavage effect between genes (“U-G” sites are avoided within the assumed gene domains mentioned above). The control (white triangles) has a circular chain with length identical to the chromosome, but without any gene domains (“GCCUUAGUGGACUCUUGAUAGCGUGGAAGUCU”). The number of nucleotide precursors’ precursors (cyan dots) is represented in a 1/64 scale (i.e., quotients in measurement of the mass of a sense chain and an antisense chain of the chromosome, which have 32 nucleotide residues each). (B) At the cellular level. Black circles represent total protocells. Yellow circles represent protocells containing at least one molecule of the chromosome (sense chain). Amphiphile precursors (black dots) are represented in a 1/600 scale (i.e., quotients in measurement of the lower limit of amphiphiles to form a protocell membrane, LAM). The parameter values for this case are listed in Table 1. The random seed is 9.
Figure 3
Figure 3
The spatial distribution and the chain length distribution during the spread of the chromosome (for the case shown in Figure2). (Top row) The spatial distribution. The horizontal plane is the N × N grid. A bar in a grid room represents the number of ribozymes, Rep (red), Nsr (green), Npsr (magenta) and Asr (blue), and the chromosome (yellow) / the control (white), in a stacked form. A black cap on a bar represents that the grid room is occupied by a protocell and thus the RNA molecules are in the protocell (a sole cap means an “empty” protocell). At step 1 × 104 (the left panel), 10 grid rooms at the diagonal of the grid were each inoculated with an protocell containing 5 molecules of the ribozymes and the sense chain of the chromosome; 10 other rooms, also at the diagonal of the grid, were each inoculated with a protocell containing 5 molecules of the ribozymes and the control. The empty protocells at this step result from the spread of the 10 empty protocells inoculated at step 1 × 103 (not shown here). The middle panel shows the spatial distribution at step 8 × 104, and the right panel at step 2 × 106. (Bottom row) The chain-length distribution of RNA molecules. The steps for the left, middle and right panels correspond to those shown in the top row. In the middle panel, the numbers of monomers (25,775) and dimers (3,389) are not fully represented; in the right panel, the number of monomers (9,287) is not fully represented.
Figure 4
Figure 4
Analysis of the roles of circularity and self-cleavage on the spread of the chromosome. (A) The vertical axis represents the molecule number of the chromosome (the sense chain). Random seeds 1–10 were used to initiate the 10 different cases. In the cases shown in the top-left panel, all parameter values are set according to the common parameter list (identical to those used for the case shown in Figure 2, and listed in Table 1; wherein, PCRTT = 0.9, PLRTT = 0.01 and FIB = 100). Lines represent the cases for the circular chromosome, and dots for the linear chromosome. The top-right, bottom-left and bottom right panels, shows the cases for the circular chromosome assuming that PCRTT decreased to 0.2, PLRTT increased to 0.05, and FIB decreased to 20, respectively. (B) A tick on a horizontal axis denotes a value of the corresponding parameter (except for the top-left panel). Random seeds 1−100 were used to initiate 100 different cases adopting such a parameter value, whereas values of the other parameters are set according to the common parameter list (Table 1). For the cases in the top-left panel, all parameters are set according to this list, but the cases for the circular chromosome and the linear chromosome are compared. The bars in a bar group represent the molecule numbers (averaged over the 100 cases) of the chromosome (the sense chain; yellow), Rep (red), Nsr (green), Nspr (magenta), Asr (blue) and the control (grey) recorded at step 2 × 105. This step was adopted from experience to show the influence of the parameters clearly and also with consideration for the computational (time) cost.
Figure 5
Figure 5
Events occurring in the model and their associated probabilities. Solid arrows represent chemical events and dashed arrows represent other events. (A) Events occurring in a grid room. Legends: Npp, nucleotide precursor’s precursor; Np, nucleotide precursor; Nt, nucleotide (A, U, C, or G); Ap, amphiphile precursor; Am, amphiphile; the notations of ribozymes are the same as in the text. Note that for the template-directed synthesis, the probability of a circular RNA turning into a template would be PCRTT instead of PLRTT and the synthesis may start at a random site, whereas other associated events are the same as those for the linear RNA (shown in the figure). Some factors associated with the events are explained in the text. One of these factors, FIB , is important for the topic of the present study. For a particular intermediate site between two genes in a linear RNA (see the legend to Figure 2 for details of the assumption concerning the site), the probability of phosphodiester bond breaking (PBB) is increased by multiplying the factor, FIB, which represents the consideration of the self-cleaving effect. (B) Events concerning the behaviors of the protocells. 9 grid rooms are shown in each panel.
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Gilbert W. The RNA world. Nature. 1986;319:618.
    1. Joyce GF. The antiquity of RNA-based evolution. Nature. 2002;418:214–221. doi: 10.1038/418214a. - DOI - PubMed
    1. Szathmary E, Demeter L. Group selection of early replicators and origin of life. J Theor Biol. 1987;128:463–486. doi: 10.1016/S0022-5193(87)80191-1. - DOI - PubMed
    1. Zintzaras E, Santos M, Szathmary E. “Living” under the challenge of information decay: the stochastic corrector model vs. hypercycles. J Theor Biol. 2002;217:167–181. doi: 10.1006/jtbi.2002.3026. - DOI - PubMed
    1. Fontanari JF, Santos M, Szathmary E. Coexistence and error propagation in pre-biotic vesicle models: a group selection approach. J Theor Biol. 2006;239:247–256. doi: 10.1016/j.jtbi.2005.08.039. - DOI - PubMed

LinkOut - more resources