Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2011 Feb-Mar;90(2-3):143-56.
doi: 10.1016/j.ejcb.2010.07.006. Epub 2010 Aug 17.

Analysis of the signaling pathways regulating Src-dependent remodeling of the actin cytoskeleton

Sabina E Winograd-Katz  1 , Michal C Brunner, Natalia Mirlas, Benjamin Geiger
Affiliations

Analysis of the signaling pathways regulating Src-dependent remodeling of the actin cytoskeleton

Sabina E Winograd-Katz et al. Eur J Cell Biol. 2011 Feb-Mar.

Abstract

Cell adhesion to the extracellular matrix is mediated by adhesion receptors, mainly integrins, which upon interaction with the extracellular matrix, bind to the actin cytoskeleton via their cytoplasmic domains. This association is mediated by a variety of scaffold and signaling proteins, which control the mechanical and signaling activities of the adhesion site. Upon transformation of fibroblasts with active forms of Src (e.g., v-Src), focal adhesions are disrupted, and transformed into dot-like contacts known as podosomes, and consisting of a central actin core surrounded by an adhesion ring. To clarify the mechanism underlying Src-dependent modulation of the adhesive phenotype, and its influence on podosome organization, we screened for the effect of siRNA-mediated knockdown of tyrosine kinases, MAP kinases and phosphatases on the reorganization of the adhesion-cytoskeleton complex, induced by a constitutively active Src mutant (SrcY527F). In this screen, we discovered several genes that are involved in Src-induced remodeling of the actin cytoskeleton. We further showed that knockdown of Src in osteoclasts abolishes the formation of the podosome-based rings and impairs cell spreading, without inducing stress fiber development. Our work points to several genes that are involved in this process, and sheds new light on the molecular plasticity of integrin adhesions.

PubMed Disclaimer

Figures

Figure 1
Figure 1. The SrcY527F constitutively active mutant causes extensive morphological changes in MEF cells that can be reversed by an Src inhibitor or by siRNA specific to Src
(A) Control MEF and (B) MEF-SrcY527F cells were permeabilized, fixed and stained for actin (red) and paxillin (green). (C) MEF-SrcY527F cells were transiently transfected with Src siRNA and maintained in culture for 72 h before permeabilization, fixation and staining. (D) MEF-SrcY527F cells were treated with the Src family kinase inhibitor SU6656 (5μM) for 2 h and were then permeabilized, fixed, and stained for actin and paxillin.
Figure 2
Figure 2. The three major phenotypes of MEF-SrcY527F cells
(A) MEF-SrcY527F cells were permeabilized, fixed and stained for actin and paxillin. Three groups of adhesion structures were defined: Phenotype A, displaying super rings at the periphery of the cell; Phenotype B with rosettes, and Phenotype C, with clusters of peripheral adhesions. Spatial ratio images are shown. Red indicates highly localized actin, whereas blue indicates high paxillin levels. Intermediate color levels, as shown in the color scale, indicate co-localization. (B) Phenotype distribution in the total population of MEF-SrcY527F cells.
Figure 3
Figure 3. Distribution of actin and tyrosine-phosphorylated proteins in the three major phenotypes of MEF-SrcY527F cells
Representative MEF-SrcY527F cells from each phenotype were permeabilized, fixed, and stained for actin and general phospho-tyrosine. Spatial ratio images are shown. Red indicates highly localized actin, whereas blue indicates high phospho-tyrosine levels. Intermediate color levels, as shown in the color scale, indicate co-localization.
Figure 4
Figure 4. Dynamics of the adhesion structures in the three major phenotypes of MEF-SrcY527F cells
MEF-SrcY527F cells were transiently transfected with GFP-α-actinin (A, B, D), mCherry actin (C) or co-transfected with GFP-cortactin and mCherry actin (E). Time-lapse movies were recorded 24 h later. Frames from the movies, and corresponding times, are shown. An image of the superimposed times is also shown, (A–D) in order to appreciate the dynamics. (E) Stress fibers seem to be anchored to podosomes, but can slide from one podosome to the other, as shown by the pairs of arrowheads.
Figure 5
Figure 5. The structures of individual podosomes, podosomes in clusters, and podosome rings, as observed by scanning electron microscopy
Cell bodies of MEF-SrcY527F cells were removed, leaving the cytoplasmic faces of the attached ventral membrane exposed. The samples were then fixed, and observed in a scanning electron microscope (SEM). (A) Podosome clusters. (B) An individual podosome. (C) Rosette structure (3–4μm wide). (D) Higher magnification reveals that the rosette is built from podosomes. (E) A structure of larger rings, built in part from two actin belts. Each of the actin belts is about 1–2μm wide, with an ~1–2μm gap between them. (F) Higher magnification reveals the double podosome belt.
Figure 6
Figure 6. Workflow of the screen
Schematic description of the screen, including the screening procedure, the number of screened siRNAs, the features extracted, and the number of hits.
Figure 7
Figure 7. Images of the screen hits
Single high–resolution, representative images of all the screen hits, stained for actin. The first four images were taken from controls (untransfected, Risc-Free, and non-targeting controls, and Src siRNA), and are shown for comparison.
Figure 8
Figure 8. Distribution of the major effects in the three libraries
The graph shows the percentage of the three major effects (more stress fibers, more rings, and a peripheral belt), of the siRNAs, in each of the three-siRNA libraries.
Figure 9
Figure 9. Effects of Src knockdown in RAW 264.7 osteoclasts
(A) RAW 264.7 cells were infected with lentiviral vectors expressing shRNAs targeting Src, or treated with control media. The cells were allowed to differentiate for 72 h, and stained for actin. The image is a montage of 36 single images from the same well. (B) The graph shows the knockdown level of Src mRNA (the fraction of expression, compared to the non-targeted control), analyzed by RT-PCR in RAW 264.7 stable cell lines. The RNA amount was normalized to HPRT. Quantitative PCR was performed with the following primers: Src forward, 5’-GGTGCCTACTGCCTCTCTGTA-3’; Src reverse: 5’-GCGGGAGGTGATGTAGAAACC-3’; HPRT forward: 5′ CTGGTTAAGCAGTACAGCCCCAAA 3′;HPRT reverse 5′ TGGCCTGTATCCAACACTTCGAGA 3′. (C) Phase contrast, time-lapse movies of an Src shRNA-1 stable cell line, and of control cells, were produced 24 h after differentiation began. The figure shows 4 images of the 16-image montage taken at each time point. Four time points are shown, as indicated. At the end of the movie, the cells were stained with phalloidin-FITC (green) and DAPI (blue); the same field is shown for the stained image. (D) Fluorescent time-lapse movies of a differentiated Src shRNA-1 stable cell line, and of control cells, were produced at high magnification (100× /1.3). Four time points are shown; only a fraction of the cells is visible. Several unstable rings are seen in Src shRNA-1 cells; whereas two adjacent sealing zone-like rings are partially seen in control cells.
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Albiges-Rizo C, Destaing O, Fourcade B, Planus E, Block MR. Actin machinery and mechanosensitivity in invadopodia, podosomes and focal adhesions. J Cell Sci. 2009;122:3037–3049. - PMC - PubMed
    1. Badowski C, Pawlak G, Grichine A, Chabadel A, Oddou C, Jurdic P, Pfaff M, Albiges-Rizo C, Block MR. Paxillin phosphorylation controls invadopodia/podosomes spatiotemporal organization. Mol Biol Cell. 2008;19:633–645. - PMC - PubMed
    1. Bennett AM, Tang TL, Sugimoto S, Walsh CT, Neel BG. Protein-tyrosine-phosphatase SHPTP2 couples platelet-derived growth factor receptor beta to Ras. Proc Natl Acad Sci U S A. 1994;91:7335–7339. - PMC - PubMed
    1. Berdeaux RL, Diaz B, Kim L, Martin GS. Active Rho is localized to podosomes induced by oncogenic Src and is required for their assembly and function. J Cell Biol. 2004;166:317–323. - PMC - PubMed
    1. Berrier AL, Yamada KM. Cell-matrix adhesion. J Cell Physiol. 2007;213:565–573. - PubMed

Publication types

LinkOut - more resources