Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2010 Aug;38(15):5088-104.
doi: 10.1093/nar/gkq236. Epub 2010 Apr 18.

Two novel families of plasmids from hyperthermophilic archaea encoding new families of replication proteins

Nicolas Soler  1 , Evelyne Marguet, Diego Cortez, Nicole Desnoues, Jenny Keller, Herman van Tilbeurgh, Guennadi Sezonov, Patrick Forterre
Affiliations

Two novel families of plasmids from hyperthermophilic archaea encoding new families of replication proteins

Nicolas Soler et al. Nucleic Acids Res. 2010 Aug.

Abstract

Thermococcales (phylum Euryarchaeota) are model organisms for physiological and molecular studies of hyperthermophiles. Here we describe three new plasmids from Thermococcales that could provide new tools and model systems for genetic and molecular studies in Archaea. The plasmids pTN2 from Thermococcus nautilus sp. 30-1 and pP12-1 from Pyrococcus sp. 12-1 belong to the same family. They have similar size (approximately 12 kb) and share six genes, including homologues of genes encoded by the virus PAV1 from Pyrococcus abyssi. The plasmid pT26-2 from Thermococcus sp. 26-2 (21.5 kb), that corresponds to another plasmid family, encodes many proteins having homologues in virus-like elements integrated in several genomes of Thermococcales and Methanococcales. Our analyses confirm that viruses and plasmids are evolutionary related and co-evolve with their hosts. Whereas all plasmids previously isolated from Thermococcales replicate by the rolling circle mechanism, the three plasmids described here probably replicate by the theta mechanism. The plasmids pTN2 and pP12-1 encode a putative helicase of the SFI superfamily and a new family of DNA polymerase, whose activity was demonstrated in vitro, whereas pT26-2 encodes a putative new type of helicase. This strengthens the idea that plasmids and viruses are a reservoir of novel protein families involved in DNA replication.

PubMed Disclaimer

Figures

Figure 1.
Figure 1.
Schematic representation of the three new plasmids. (A) pTN2 and pP12-1 plasmid maps were drawn at the same scale together with PAV1 genome. ORFs are numbered and represented as arrows. ORFs encoding homologous proteins have the same colour. White ORFs do not have detectable homologues among these three genomes. (B) pT26-2 plasmid map with ORFs numbered and represented as arrows. Coloured ORFs encode proteins with expected activity or function. (A and B) Hachured ORFs harbour putative hydrophobic segments. Circles indicate large intergenic regions including putative replication origins.
Figure 2.
Figure 2.
tn2-12p is a DNA polymerase. (A) Lanes 1–4: 5′-32P oligonucleotides of 40, 42, 43 and 45 mers. Lane 5: 5′-32P labelled 20 nt oligonucleotide CGAACCCGTTCTCGGAGCAC, no protein added. The recombinant protein tn2-12p (2.5 and 5 μM, lanes 6 and 7, respectively) or Taq polymerase (Promega, 0.04 U/μl, lane 8) were incubated with this short primer-template substrate hybridized to 42-nt template TTCTGCACAAAGCGGTTCTGCAGTGCTCCGAGAACGGGTTCG. Primers are extended in the presence of 0.2 mM dNTPs during 20 min at 70°C. The buffer used for the polymerization reaction is described in ‘Materials and Methods’ section. Extension products were analysed on the 16% denaturating polyacrylamide gel. Magnification: two very close bands of 42 and 43 bp are clearly visible. (B) The recombinant protein tn2-12p (15 μM, lanes 1 and 2) or Taq polymerase (Promega, 0.02 U/μl, lane 3) were incubated with a short primer-template substrate (5′-32P labelled 20 nt oligonucleotide CGAACCCGTTCTCGGAGCAC hybridized to 42 nt template TTCTGCACAAAGCGGTTCTGCAGTGCTCCGAGAACGGGTTCG). Primers are extended in the presence of 0.2 mM dNTPs (lanes 1 and 3) or 0.2 mM NTPs (lane 2) during 20 min at 70°C. In the control reaction with NTPs (lane 2) no primer elongation was observed. The buffer used for the polymerization reaction is described in ‘Materials and Methods’ section. Extension products were analysed on the 16% denaturating polyacrylamide gel. (C) The primer extension activity of tn2-12p was assayed at 70°C (lanes 1–3) and 80°C (lanes 4 and 5). A 5′-32P-labelled 18-nt primer (GTAAAACGACGGCCAGTG) was hybridized with ssDNA of M13. This primer-template substrate (10 nM) were incubated for 20 min either without any proteins (lane 1), either with 10 μM of tn2-12p (lanes 2 and 4) or with 0.05 U/μl of Taq polymerase (lanes 3 and 5) in the presence of 0.2 mM dNTPs. The buffer used for the polymerization reaction is described in ‘Materials and Methods’ section. Extension products were analysed on the 16% denaturating polyacrylamide gel.
Figure 3.
Figure 3.
Schematic alignment of pT26-2 genome with integrated elements in Thermococcales and Methanococcales genomes. Thermococcus kodakaraensis virus-related regions (TKV1, TKV2 and TKV3), P. horikoschii (PHV1), T. gammatolerans (TGV1), M. maripaludis strain S2 (MMPV1), M. maripaludis strain C7 (MMC7V1 and MMC7V2) and strain C6 (MMC6V1), and M. voltae (MVV1). ORFs are indicated as arrows. Yellow ORFs represent genes of fragments of genes encoding an integrase related to the SSV1 integrase, and blue bars indicate tRNA genes. Brown ORFs share sequence similarities with RepA proteins encoded by the Sulfolobus plasmids pTIK4 et pORA1 (t262-22 and TK0587). Pink ORFs are homologous with genes encoding integrases of XerCD family, whereas mauve ORFs are homologous to genes encoding resolvases. Among the integrated elements represented here, ORFs encoding homologous proteins with pT26-2 are linked together with green bands.
Figure 4.
Figure 4.
CAGs families. In this figure, each circle correspond to either a plasmid (pT26-2) or to an integrated element identified as a cluster of atypical genes (41). Each link between two elements means that they share at least five homologous genes (see ‘Materials and Methods’ section for further details). The plasmid pT26-2 is in black, and the other Thermococcales integrated elements are in dark grey (TKV1, TKV2, TKV3, PHV1). The integrated elements sharing core genes with pT26-2 (described in the text), are linked by bold lines. Integrated elements from Methanococcales are represented in light grey whereas integrated elements from other phyla (Methanosarcinales and Nanoarchaea) are represented in grey.
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Lipps G, editor. Plasmids Current Research and Future Trends. Norfolk, UK: Caaister Academic Press; 2008. p. 259.
    1. Harriott OT, Huber R, Stetter KO, Betts PW, Noll KM. A cryptic miniplasmid from the hyperthermophilic bacterium Thermotoga sp. strain RQ7. J. Bacteriol. 1994;176:2759–2762. - PMC - PubMed
    1. Soppa J. From genomes to function: haloarchaea as model organisms. Microbiology. 2006;152:585–590. - PubMed
    1. Baliga NS, Bonneau R, Facciotti MT, Pan M, Glusman G, Deutsch EW, Shannon P, Chiu Y, Weng RS, Gan RR, et al. Genome sequence of Haloarcula marismortui: a halophilic archaeon from the Dead Sea. Genome Res. 2004;14:2221–2234. - PMC - PubMed
    1. del Solar G, Giraldo R, Ruiz-Echevarria MJ, Espinosa M, Diaz-Orejas R. Replication and control of circular bacterial plasmids. Microbiol. Mol. Biol. Rev. 1998;62:434–464. - PMC - PubMed

Publication types

Substances

Associated data