The gene encoding hyaluronan-binding protein 1 (HABP1) is expressed ubiquitously in different rat tissues, and is present in eukaryotic species from yeast to humans. Fluorescence in situ hybridization indicates that this is localized in human chromosome 17p13.3. Here, we report the presence of homologous sequences of HABP1 cDNA, termed processed HABP1 pseudogene in humans. This is concluded from an additional PCR product of ~0.5 kb, along with the expected band at approximately 5 kb as observed by PCR amplification of human genomic DNA with HABP1-specific primers. Partial sequencing of the 5-kb PCR product and comparison of the HABP1 cDNA with the sequence obtained from Genbank accession number AC004148 indicated that the HABP1 gene is comprised of six exons and five introns. The 0.5-kb additional PCR product was confirmed to be homologous to HABP1 cDNA by southern hybridization, sequencing, and by a sequence homology search. Search analysis with HABP1 cDNA sequence further revealed the presence of similar sequence in chromosomes 21 and 11, which could generate ~0.5 kb with the primers used. In this report, we describe the presence of several copies of the pseudogene of HABP1 spread over different chromosomes that vary in length and similarity to the HABP1 cDNA sequence. These are 1013 bp in chromosome 21 with 85.4% similarity, 1071 bp in chromosome 11 with 87.2% similarity, 818 bp in chromosome 15 with 82.3% similarity, and 323 bp in chromosome 4 with 84% similarity to HABP1 cDNA. We have also identified similar HABP1 pseudogenes in the rat and mouse genome. The human pseudogene sequence of HABP1 possesses a 10 base pair direct repeat of "AGAAAAATAA" in chromosome 21, a 12-bp direct repeat of "AG/CAAATTA/CAA/TTA" in chromosome 4, a 8-bp direct repeat of "ACAAAG/TCT" in chromosome 15. In the case of chromosome 11, there is an inverted repeat of "AGCCTGGGCGACAGAGCGAGA" ~50 bp upstream of the HABP1 pseudogene sequence. All of the HABP1 pseudogene sequences lack 5' promoter sequence and possess multiple mutations leading to the insertion of premature stop codons in all three reading frames. Rat and mouse homologs of the HABP1 pseudogene also contain multiple mutations, leading to the insertion of premature stop codons confirming the identity of a processed pseudogene.