Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2002 May 29:3:13.
doi: 10.1186/1471-2091-3-13.

The role of the Zn(II) binding domain in the mechanism of E. coli DNA topoisomerase I

Adriana Ahumada  1 , Yuk-Ching Tse-Dinh
Affiliations

The role of the Zn(II) binding domain in the mechanism of E. coli DNA topoisomerase I

Adriana Ahumada et al. BMC Biochem. .

Abstract

Background: Escherichia coli DNA topoisomerase I binds three Zn(II) with three tetracysteine motifs which, together with the 14 kDa C-terminal region, form a 30 kDa DNA binding domain (ZD domain). The 67 kDa N-terminal domain (Top67) has the active site tyrosine for DNA cleavage but cannot relax negatively supercoiled DNA. We analyzed the role of the ZD domain in the enzyme mechanism.

Results: Addition of purified ZD domain to Top67 partially restored the relaxation activity, demonstrating that covalent linkage between the two domains is not necessary for removal of negative supercoils from DNA. The two domains had similar affinities to ssDNA. However, only Top67 could bind dsDNA with high affinity. DNA cleavage assays showed that the Top67 had the same sequence and structure selectivity for DNA cleavage as the intact enzyme. DNA rejoining also did not require the presence of the ZD domain.

Conclusions: We propose that during relaxation of negatively supercoiled DNA, Top67 by itself can position the active site tyrosine near the junction of double-stranded and single-stranded DNA for cleavage. However, the interaction of the ZD domain with the passing single-strand of DNA, coupled with enzyme conformational change, is needed for removal of negative supercoils.

PubMed Disclaimer

Figures

Figure 1
Figure 1
Domain organization of E. coli DNA topoisomerase I.
Figure 2
Figure 2
Partial restoration of relaxation activity by complementation of Top67 and ZD domains. (a). Agarose gel electrophoresis was carried out to analyze the relaxation reaction products after 1 h of incubation. Lane 1: supercoiled plasmid DNA with no protein added; lane 2: Top67 alone; lane 3: ZD alone. Lanes 4–7 (Top67 reconstituted with ZD) and lanes 8–11 (topoisomerase I) have 6, 1.2, 0.24 and 0.05 pmoles of proteins added. (b). Time course of relaxation reaction catalyzed by 6 pmoles of topoisomerase I, or Top67 reconstituted with ZD
Figure 3
Figure 3
Binding of Top67 and ZD to single-stranded and double-stranded DNA. The gel mobility shift assay was used to compare the binding affinities. The substrates used are (a): single-stranded 5'GAAAACTCACAGGAAGCGGCCGAAGCGATTCGTCC 3'; (b): the same labeled strand of hybridized to its complementary strand. Open circles: Top67; solid circles: ZD.
Figure 4
Figure 4
Cleavage selectivity of topoisomerase I and Top67. This was analyzed using single-stranded 32mer (a), 31mer (b), or substrate with both single- and double-stranded regions (c). For (a) and (b), lane 1: no protein added, lane 2: topoisomerase I, lane 3: Top67, lane 4: Top67 mixed with ZD. For (a), lane 5: ZD alone. For (c), lane 1: topoiosmerase I, lane 2: Top67, lane 3: no protein added, lane 4: DNase I digestion pattern.
Figure 5
Figure 5
Reversal of DNA cleavage by topoisomerase I and Top67. A 5'-end labeled 61mer was used as substrate. C: no enzyme added. Lane 1: enzyme cleavage reaction stopped with SDS; Lane 2: enzyme cleavage reaction incubated with 1 M NaCl before SDS treatment; Lane 3: enzyme cleavage reaction incubated with 1 M NaCl and 4 mM MgCl2 before SDS treatment.
Figure 6
Figure 6
Catenation of nicked double-stranded DNA circles by topoisomerase I and Top67. (a). Phage PM2 DNA circles with one or more single-strand scissions were incubated with 5 pmoles of proteins for 1 h. Lane 1: no enzyme added; Lane 2: topoisomerase I; Lane3: Top67; Lane 4: Top67 and ZD domain; Lane 5: ZD domain; Lane 6: mutant with Y319F substitution. (b). Aliquots of the reaction for topoisomerase I and Top67 were removed at different time points to analyse the time course of catenation.
Figure 7
Figure 7
Model for removal of a negative supercoil by E. coli DNA topoisomerase I. Subdomains I, II, III, IV found in the crystal structure of Top67 (4) are illustrated schematically along with the potential site for ZD domain (Z). G-strand: DNA strand cleaved to provide "DNA Gate". T-strand: DNA strand to be transported through the "DNA Gate".
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Champoux JJ. DNA topoisomerases. Annu Rev Biochem. 2001;70:369–413. doi: 10.1146/annurev.biochem.70.1.369. - DOI - PubMed
    1. Tse-Dinh YC. Bacterial and archeal type I topoisomerases. Biochim Biophys Acta. 1998;1400:19–27. doi: 10.1016/S0167-4781(98)00125-0. - DOI - PubMed
    1. Drlica K. Control of bacterial DNA supercoiling. Mol Microbiol. 1992;6:425–433. - PubMed
    1. Lima CD, Wang JC, Mondragon A. Three dimensional structure of the 67K N-terminal fragment of E. coli DNA topoisomerase I. Nature. 1994;367:138–146. doi: 10.1038/367138a0. - DOI - PubMed
    1. Tse-Dinh YC, Beran-Steed RK. Escherichia coli DNA topoisomerase I is a zinc metalloprotein with three repetitive zinc-binding domains. J Biol Chem. 1988;263:15857–15859. - PubMed

Publication types