Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2002 Mar 19;99(6):3830-5.
doi: 10.1073/pnas.062036999. Epub 2002 Mar 12.

Small-molecule antagonists of Myc/Max dimerization inhibit Myc-induced transformation of chicken embryo fibroblasts

Thorsten Berg  1 , Steven B Cohen, Joel Desharnais, Corinna Sonderegger, Daniel J Maslyar, Joel Goldberg, Dale L Boger, Peter K Vogt
Affiliations

Small-molecule antagonists of Myc/Max dimerization inhibit Myc-induced transformation of chicken embryo fibroblasts

Thorsten Berg et al. Proc Natl Acad Sci U S A. .

Abstract

Myc is a transcriptional regulator of the basic helix-loop-helix leucine zipper protein family. It has strong oncogenic potential, mutated or virally transduced forms of Myc induce lymphoid tumors in animals, and deregulated expression of Myc is associated with numerous types of human cancers. For its oncogenic activity, Myc must dimerize with the ubiquitously expressed basic helix-loop-helix leucine zipper protein Max. This requirement for dimerization may allow control of Myc activity with small molecules that interfere with Myc/Max dimerization. We have measured Myc/Max dimerization with fluorescence resonance energy transfer and have screened combinatorial chemical libraries for inhibitors of dimerization. Candidate inhibitors were isolated from a peptidomimetics library. Inhibition of Myc/Max interaction was validated by ELISA and electrophoretic mobility-shift assay. Two of the candidate inhibitors also interfere with Myc-induced oncogenic transformation in chicken embryo fibroblast cultures. Our work provides proof of principle for the identification of small molecule inhibitors of protein-protein interactions by using high-throughput screens of combinatorial chemical libraries.

PubMed Disclaimer

Figures

Figure 1
Figure 1
Small molecule inhibitors of Myc/Max dimers and control compound.
Figure 2
Figure 2
EMSA. (A) Neither MycGFP nor Max alone shift the 32P-labeled probe 5′AGTTGACCACGTGGTCTGGG3′ (lanes 2 and 3). The MycGFP/Max dimer binds to the probe (lane 4). Excess (100-fold) of the correct binding site (lane 5), but not of the mutated binding site 5′AGTTGACTACGTAGTCTGGG3′ (lane 6), inhibits binding of the MycGFP/Max dimer to the radiolabeled probe. MycGFP/Max does not bind to the mutated radiolabeled probe (lane 7). Addition of 60 ng/μl anti-GFP antibody supershifts the dimer/DNA complex (lane 8), but addition of 60 ng/μl IgG does not affect the dimer/DNA complex (lane 9). (B–D) Inhibition of MycGFP/Max-DNA complex by compounds IIA6B17 (B), IIA4B11 (C), and IA4B11 (D). (E and F) Compounds IA4B6 and IIA4B20 do not inhibit formation of the MycGFP/Max-DNA complex.
Figure 3
Figure 3
The effect of IIA4B20 and IIA6B17 on focus formation by Myc, Scr, or Jun in CEF. Both Myc- and Jun-induced transformation are inhibited by the higher compound concentrations. Src-induced foci consist of poorly adherent cells that are often washed off during the staining process, leaving a hole in the cell sheet.
Figure 4
Figure 4
Dose–response curves for compounds IIA4B20 and IIA6B17 in CEF assays for transformed focus formation by Myc, Src, or Jun. Shown are the relative numbers of foci from a representative experiment.
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Duesberg P H, Bister K, Vogt P K. Proc Natl Acad Sci USA. 1977;74:4320–4324. - PMC - PubMed
    1. Duesberg P H, Vogt P K. Proc Natl Acad Sci USA. 1979;76:1633–1637. - PMC - PubMed
    1. Kung H J, Boerkoel C, Carter T H. Curr Top Microbiol Immunol. 1991;171:1–25. - PubMed
    1. Nesbit C E, Tersak J M, Prochownik E V. Oncogene. 1999;18:3004–3016. - PubMed
    1. Dalla-Favera R, Bregni M, Erikson J, Patterson D, Gallo R C, Croce C M. Proc Natl Acad Sci USA. 1982;79:7824–7827. - PMC - PubMed

Publication types

MeSH terms