Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2000 May 23;97(11):5978-83.
doi: 10.1073/pnas.100127597.

An efficient recombination system for chromosome engineering in Escherichia coli

D Yu  1 , H M Ellis, E C Lee, N A Jenkins, N G Copeland, D L Court
Affiliations

An efficient recombination system for chromosome engineering in Escherichia coli

D Yu et al. Proc Natl Acad Sci U S A. .

Abstract

A recombination system has been developed for efficient chromosome engineering in Escherichia coli by using electroporated linear DNA. A defective lambda prophage supplies functions that protect and recombine an electroporated linear DNA substrate in the bacterial cell. The use of recombination eliminates the requirement for standard cloning as all novel joints are engineered by chemical synthesis in vitro and the linear DNA is efficiently recombined into place in vivo. The technology and manipulations required are simple and straightforward. A temperature-dependent repressor tightly controls prophage expression, and, thus, recombination functions can be transiently supplied by shifting cultures to 42 degrees C for 15 min. The efficient prophage recombination system does not require host RecA function and depends primarily on Exo, Beta, and Gam functions expressed from the defective lambda prophage. The defective prophage can be moved to other strains and can be easily removed from any strain. Gene disruptions and modifications of both the bacterial chromosome and bacterial plasmids are possible. This system will be especially useful for the engineering of large bacterial plasmids such as those from bacterial artificial chromosome libraries.

PubMed Disclaimer

Figures

Figure 1
Figure 1
Description of the defective λ prophage on the E. coli chromosome. The defective prophage contains λ genes from cI to int. A deletion (dotted line) removes the right side of the prophage from cro through attR and including bioA (21). On the chromosome, the nadA and gal operons are to the left of the prophage, and the bio genes without bioA are to the right. Genes of the λ prophage are shown on the solid line, and genes of the host are shown on the broken line. pL and pR indicate the early left and right promoters of λ. attL and attR indicate the left and right attachment sites of λ. The λ genes and functions have been described (17).
Figure 2
Figure 2
Strategy for generating recombinant DNA molecules and gene replacement. Three steps are outlined. (A) Recombinant oligonucleotides were chemically synthesized with the 5′ 30–50 nt (shaded rectangles) identical to sequences at the target and the 3′ 20 nt (arrowheads) homologous to the ends of the cassette to be introduced. A cassette is generated by PCR that is flanked by the 30- to 50-bp homologies present at the target. (B) Cells carrying the target DNA either on the chromosome or on a plasmid are induced for Exo, Beta, and Gam function. These cells are made competent for electroporation and mixed with the amplified cassette. (C) After electroporation, recombination occurs between the homologous sequences on the linear cassette and the target replacing the target segment with the cassette. The 50-nt galK homology segments (rectangles) used for the experiment described in Table 2 are 5′GTTTGCGCGCAGTCAGCGATATCCATTTTCGCGAATCCGGAGTGTAAGAA and 5′'TTCATATTGTTCAGCGACAGCTTGCTGTACGGCAGGCACCAGCTCTTCCG.
Figure 3
Figure 3
Effect of induction time on recombination. The strain DY330 was grown at 32°C to OD600 = 0.4–0.6, was induced at 42°C for the times indicated, and then was made electrocompetent. A linear cat cassette (10 ng) was used to target the cIII kil gam genes of the prophage. Total CmR recombinants were plotted vs. the time of induction.
Figure 4
Figure 4
Effect of concentration of the linear DNA cassette on recombination. The strain DY330 was grown at 32°C to OD600 = 0.4–0.6, was induced at 42°C for 15 min, and then was made electrocompetent. Different amounts (1, 10, 100, 300, and 1,000 ng) of a linear cat cassette (1 kbp in length) were used to target the cIII kil gam genes of the prophage. Total CmR recombinants were plotted vs. the DNA amount at 42°C.
Figure 5
Figure 5
Effect of homologous arm length on recombination. The strains DY330 (filled circles) and DY331 (open circles) were grown at 32°C, were induced at 42°C for 15 min, and then were made relectrocompetent. A linear cat cassette (100 ng) was used to target the cIII kil gam genes of the prophage. The homologous arm length of the cassette was varied from 0 to 1,000 bp. The primers containing the 0- to 50-bp homologies were chemically synthesized as described (Fig. 2). The cassette containing 1,000-bp homologous arms was made by PCR using primers 1,000 bp away on each side of an existing (cIII kil gam)<>cat disruption in the cell. Total CmR recombinants were plotted vs. the homologous arm length.
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Szostak J W, Orr-Weaver T L, Rothstein R J, Stahl F W. Cell. 1983;33:25–35. - PubMed
    1. Yamamoto T, Moerschell R P, Wakem L P, Ferguson D, Sherman F. Yeast. 1992;8:935–948. - PubMed
    1. Baudin A, Ozier-Kalogeropoulos O, Denouel A, Lacroute F, Cullin C. Nucleic Acids Res. 1993;21:3329–3330. - PMC - PubMed
    1. Lafontaine D, Tollervey D. Nucleic Acids Res. 1996;24:3469–3471. - PMC - PubMed
    1. Benzinger R, Enquist L W, Skalka A. J Virol. 1975;15:861–871. - PMC - PubMed

MeSH terms

LinkOut - more resources