Abundance of Phasi-Charoen-like virus in Aedes aegypti mosquito populations in different states of India

Kavita Lole; Ashwini Ramdasi; Sucheta Patil; Shivani Thakar; Amol Nath; Onkar Ghuge; Abhranil Gangopadhayya; Anakkathil B Sudeep; Sarah Cherian

doi:10.1371/journal.pone.0277276

. 2022 Dec 9;17(12):e0277276. doi: 10.1371/journal.pone.0277276

Abundance of Phasi-Charoen-like virus in Aedes aegypti mosquito populations in different states of India

Kavita Lole ¹, Ashwini Ramdasi ¹, Sucheta Patil ¹, Shivani Thakar ¹, Amol Nath ¹, Onkar Ghuge ¹, Abhranil Gangopadhayya ¹, Anakkathil B Sudeep ^1,^*, Sarah Cherian ^1,^*

Editor: Humberto Lanz-Mendoza²

PMCID: PMC9733876 PMID: 36490242

Abstract

Mosquitoes are known to harbor a large number of insect specific viruses (ISV) in addition to viruses of public health importance. These ISVs are highly species specific and are non-pathogenic to humans or domestic animals. However, there is a potential threat of these ISVs evolving into human pathogens by genome alterations. Some ISVs are known to modulate replication of pathogenic viruses by altering the susceptibility of vector mosquitoes to pathogenic viruses, thereby either inhibiting or enhancing transmission of the latter. In the present study, we report predominance of Phasi Charoen-like virus (PCLV, Family: Phenuviridae) contributing to >60% of the total reads in Aedes aegypti mosquitoes collected from Pune district of Maharashtra state using next generation sequencing based metagenomic analysis of viromes. Similar results were also obtained with mosquitoes from Assam, Tamil Nadu and Karnataka states of India. Comparison of Pune mosquito sequences with PCLV Rio (Brazil) isolate showed 98.90%, 99.027% and 98.88% homologies in the S, M and L segments respectively indicating less genetic heterogeneity of PCLV. The study also demonstrated occurrence of transovarial transmission as seen by detection of PCLV in eggs, larvae, pupae and male mosquitoes. Ae. aegypti mosquitoes collected from Pune also showed a large number of reads for viruses belonging to Baculoviridae, Rhabdoviridae, Genomoviridae and Bunyaviridae families. The role of PCLV in the replication of dengue and chikungunya virus is yet not clear. It warrants further studies to know the significance of PCLV and other ISVs on the replication and transmission of Ae. aegypti borne pathogenic viruses, especially in the absence of prophylactics or therapeutics.

Introduction

Emerging and re-emerging arthropod borne viruses continue to be a major threat to humanity as they not only inflict high morbidity and mortality but also devastate the economy of many countries especially in the tropical and subtropical countries [1–4]. During the last few decades, mosquito-borne viruses have emerged as a major public health concern, replacing malaria that had the dubious distinction as a major mosquito borne killer disease across the globe. Recent efforts on diagnosis and therapy have brought down malaria cases in most of the endemic countries, while therapeutics/vaccines for arboviral infections still remain scanty. The increased frequency and speed of human travel and commercial trade combined with global warming has resulted in geographic expansion of mosquito vectors and their pathogens from indigenous habitats to newer/naïve areas. The emerging /re-emerging viruses have the potential of inducing large fatal outbreaks involving the whole country or a continent in a short time span. The chikungunya virus (CHIKV) which re-emerged in Kenya in 2004, spread like a wild fire causing large-scale outbreaks with high morbidity in several countries of Asia, Europe, Oceania, the Caribbeans and the South and North Americas [1,2]. Similar is the case with West Nile virus (WNV), that caused massive outbreaks in North America, South America and Europe with high morbidity and mortality, since it was first detected in New York in 1999 [3,4].

Aedes mosquitoes, especially Aedes aegypti has garnered special attention due to its rapid geographical spread and public health importance. It has already established itself in the tropical and subtropical climate zones. The day biting urban mosquito is highly anthropophilic and is the principal vector of some of the important viruses, viz., dengue, chikungunya, yellow fever and Zika [5]. Dengue is endemic to almost all the tropical and subtropical countries with estimated 390 million cases annually [6]. In the absence of effective vaccines or therapeutics as well as mosquito control, dengue continues to be a major health concern today. The control of arboviral infections still largely relies on the vector management. Recent studies documenting reduced replication and transmission of dengue virus in Aedes mosquitoes infested with bacteria of Wolbachia species seems to be a promising novel biological control means [7,8]. Promising results have also been observed with certain insect specific viruses (ISVs) that alter the susceptibility of vector mosquitoes or cell lines derived from mosquitoes to human pathogenic viruses [9,10]. These studies have shown inhibition/ reduced replication of Japanese encephalitis, Murray Valley encephalitis and West Nile viruses in respective vector mosquitoes/ mosquito cells that were experimentally infected with ISVs. These studies suggest possibility of using ISVs as biocontrol agents since they cause homologous interference in the hosts by blocking the receptors [11]. However, ISVs are also regarded as the precursor to several human pathogenic viruses and therefore need special attention as they have the potential to emerge and cause human infections [12].

Studies conducted in China, Grenada and other countries have reported the prevalence of Phasi Charoen-like virus (PCLV) in Aedes aegypti populations, however, its potential to influence replication of viruses like dengue and chikungunya is not yet clear [13,14]. In the present study, we report predominance of PCLV in Aedes aegypti mosquitoes collected from Pune, Maharashtra, and three other states of India, i.e., Karnataka, Tamil Nadu and Assam.

Materials and methods

(i) Mosquito collection and processing

Adult Aedes aegypti mosquitoes were collected using hand held mouth aspirators, identified using entomological keys [15], pooled according to gender and locality and stored at -86°C until processing. Aedes larvae collected from breeding habitats were brought to ICMR-National Institute of Virology (NIV), Pune laboratory and reared until adults. The larvae reared adults were identified individually, pooled and used for the study. The mosquitoes were maintained at 28°C with 80–85% humidity and a 12:12 h photoperiod. Mosquitoes from Pune district of Maharashtra comprised collections from five different locations, viz., Dange Chowk, Savitribai Phule Pune University campus, Tadiwala Road, Alandi and Chincholi while that of Karnataka and Assam represented by mosquitoes from Bengaluru and Dibrugarh respectively. The Tamil Nadu mosquitoes represented the laboratory colony established at NIV from mosquito eggs received from ICMR-Vector Control Research Centre, Madurai, Tamil Nadu (Fig 1). Only female mosquitoes obtained from five locations of Pune were processed for the total virome analysis. For other locations, adult mosquitoes, eggs, larvae and pupae were processed for RT-PCR based detection of PCLV using S region specific primers (Table 1).

Fig 1 — 1a) The enlarged map of Pune Municipal Corporation (PMC), Pune City, prepared using software available at https://www.mapz.com (with due permission) shows two locations (Savitribai Phule Pune University area and Tadiwala road) while three locations on the outskirt of Pune city (Alandi, Chincholi and Dange chowk), 1b) Map of India prepared using software at https://www.gramener.com (free software) showing four locations from India, *viz*., Bengaluru, Dibrugarh, Madurai and Pune.

Table 1. Primers used in the study.

Primer type	Primer	Primer sequence (5’ to 3’)	Reference
Random anchored primer	RT5	`CATCACATAGGCGTCCGCTGNNNNNN`	Xiao et al. [16]
Random anchored primer	RT10	`CGACCCTCTTATCGTGACGGNNNNNN`	Xiao et al. [16]
Random anchored primer	RT12	`GGTGGGCGTGTGAAATCGACNNNNNN`	Xiao et al. [16]
Random anchored primer	IDT- K-8N	`GACCATCTAGCGACCTCCACNNNNNNNN`	Chrzastek et al. [17]
Anchor primer	P5	`CATCACATAGGCGTCCGCTG`	Xiao et al. [16]
Anchor primer	P10	`CGACCCTCTTATCGTGACGG`	Xiao et al. [16]
Anchor primer	P12	`GGTGGGCGTGTGAAATCGAC`	Xiao et al. [16]
Anchor primer	IDT-K	`GACCATCTAGCGACCTCCAC`	Chrzastek et al. [17]
L segment- Forward		`AGACAGCACAAGCAAATAAAGCAAG`	Ramos-Nino et al. [13]
L segment-Reverse		`AAACATGCATTGTAAGGTTTTGTCG`	Ramos-Nino et al. [13]
M segment-Forward		`AAAAGTAGGAATTGATGCTGTTGC`	Ramos-Nino et al. [13]
M segment-Reverse		`CTTTGAGCACTTTTGTCTAATGGC`	Ramos-Nino et al. [13]
S segment Forward		`CAGTTAAAGCATTTAATCGTATGATAA`	Ramos-Nino et al. [13]
S segment Reverse		`TGGAAAATAAAAACAATAAAGCAATAC`	Ramos-Nino et al. [13]

Open in a new tab

(ii) Next generation sequencing based Aedes aegypti virome analysis using Oxford Nanopore technology

Mosquito homogenization and sample processing

Viral RNA was extracted from pools of 20–50 Aedes aegypti female mosquitoes. Briefly, the mosquitoes were surface sterilized using absolute ethanol for first wash followed by two consecutive washes with 70% ethanol and a final wash with sterile milliQ water/nuclease-free water. Surface sterilized mosquitoes were transferred to a sterile pre-chilled mortar and the frozen mosquito tissue was crushed in liquid nitrogen using a pestle until the mosquito tissue was completely homogenized as a fine powder. The homogenized tissue was suspended in 1X PBS (phosphate buffered saline) containing 5 mM MgCl₂ and 1.4 mM Dithiothreitol (DTT, Invitrogen) and centrifuged at 17,000 g for 10 min at 4°C to pellet down cellular debris.

Viral RNA enrichment

Clear supernatants were collected and filtered twice through sterile 0.22 μM syringe filters to exclude bacterial and other larger microscopic entities. Filtrates were treated with 2 U/μl TURBO DNase (Invitrogen), 10 U/μl RNase A (Invitrogen) and incubated at 37°C for one hour to digest mosquito nucleic acids, bacterial and other genomes, essentially to enrich the enveloped/capsid-protected viruses.

Optimization of the workflow for NGS based virome analysis

To optimize the workflow for library preparation, lysates were prepared using pools of 50 Ae. aegypti female mosquitoes (from laboratory colony) and spiked with cell culture grown West Nile virus (WNV), Japanese encephalitis virus (JEV), dengue virus (DENV) (serotype two), Zika virus (ZIKV) and chikungunya virus (CHIKV) particles, equivalent to 10⁴ plaque forming units each (to mimic realistic viral loads in mosquitoes) and processed further for library preparation. The primers for cDNA synthesis and amplification were selected based on broad metagenomic sensitivity for pathogen detection from previous reports [16–20]. A two-step strategy was optimized for cDNA synthesis using random anchored primers wherein first strand synthesis was done using reverse transcriptase while the second strand synthesis was done by using Klenow fragment. Four, out of fourteen, random anchored primers were selected for carrying out cDNA synthesis based on the properties, i.e., low self-annealing tendency, similar annealing temperatures and low tendency of primer dimer formation. Primer concentrations, reaction conditions and thermal cycling conditions were optimized to obtain ds-cDNA concentration equivalent to the input viral RNA template concentration. Sequence Independent Single Primer Amplification (SISPA) strategy was used for amplification of the cDNA fragments generated from viral RNA genomes.Library preparation was carried out using standard protocols provided by the Oxford Nanopore Technologies (ONT) for the Nanopore platform as described below using different primer sets (Table 1). The reaction conditions that yielded maximum sequence coverage (>90%) and depth for the spiked virus genomes were further used for processing the field collected mosquitoes from Pune.

Viral RNA extraction and library preparation

Viral RNA was extracted using QIAamp Viral RNA Mini Kit (Qiagen) as per the manufacturer’s instructions. Additional two washes with 80% and 70% ethanol were given on the column before sample elution to remove PCR inhibitors and to improve the quality of RNA. The eluted RNA was quantified using Qubit flourometer (Invitrogen).

Reverse transcription and double strand cDNA synthesis

RNA was subjected to first strand cDNA synthesis using four random anchored primers at a concentration of 20 picomoles (Table 1). For that, random anchored primers; one primer to each reaction, were added and incubated at 75°C for 5 min to allow denaturation of RNA secondary structures; and subjected to snap-cooling by placing on ice for 5 min to allow annealing of the primers to the template RNA. The first strand reaction final volume of 20 μl consisted of input RNA and primer, 1.0 μl SuperScript III Reverse Transcriptase (RT) (Invitrogen), 1.0 μl 0.1M DTT (Invitrogen), 1.0 μl (40U) RNase OUT (Invitrogen), 1.0 μl 25mM dNTPs and 4.0 μl 5 X first-strand buffer (Invitrogen). The reaction was carried out as follows: 25°C 10 min, 50°C 60 min, and 75°C 10 min. The first-strand cDNA synthesis reaction was followed by treatment with 250 U RNase H (NEB; New England Biologicals) to digest template RNA strand. Second strand cDNA synthesis was carried out using Klenow fragment (NEB). For that, the corresponding random anchored primer (Table 1) was added to the first-strand reaction and incubated at 75°C for 5 min, followed by snap-cooling on ice for 5 min. The final volume of 30 μl consisted of the first strand reaction, 10 picomoles of random anchored primer, 2.0 μl 10X Klenow buffer (NEB) and 200 U of Klenow fragment (NEB). The reaction was carried out at 37°C for 60 min followed by heat inactivation at 70°C for 10 min.

Sequence-Independent Single-Primer Amplification (SISPA)

The double stranded cDNA was subjected to SISPA, using anchor primers corresponding to the respective random anchored primers (Table 1). The 50 μl SISPA reaction consisted of 5.0 μl ds-cDNA, 2.5 μl anchor primer, 1.0 μl 25mM dNTPs, 0.5μl AmpliTaq Polymerase (Invitrogen), 10X PCR buffer (Invitrogen) and 1.25 μl 25mM MgCl₂ (Invitrogen). The reaction was carried out at 95°C for 3 min, followed by 35 cycles at 95°C for 20 sec; 54°C for 45 sec; 72°C for 1 min and a final extension at 72°C for 7 min.

SISPA reaction was followed by a magnetic bead purification step using AMPure XP magnetic beads (Beckman-Coulter) to purify amplicons as per the manufacturer’s instructions. The amplicons were eluted in nuclease-free water and quantified using Qubit fluorometer. Only samples with quantities higher than 100 μg were taken forward for library preparation to ensure inclusion and representation of viral species from mosquito samples.

Library preparation and sequencing on Oxford Nanopore MinION Mk1B sequencer

DNA repair, blunt-end preparation and adapter ligation of amplicons were done as per the standard protocol for library preparation recommended by ONT using NEBNext FFPE DNA Repair Mix (M6630) and NEBNext Ultra II End repair / dA-tailing Module (E7546). The DNA sample was then subjected to clean-up with AMPure XP beads, eluted and quantified on Qubit fluorometer. Approx. 200–300 ng of amplified DNA of each sample (100 to 200 femtomoles) was ligated to sequencing adapters using SQK-LSK 109 kit (ONT) and barcoding was done using native barcoding EXP-NBD104 kit (ONT). Equal quantities of barcoded samples were pooled to 300ng for final sequencing and the remaining libraries were stored at -80˚C. Adapter ligated libraries were loaded onto the SpotON flow-cell (R.9.0.4) (MinION Mk1B system) and sequencing runs were performed for about 24 h using MinKNOW software (ONT).

Basecalling and data QC

The generated fast5 files were processed for basecalling using Guppy_basecaller v4.0.15 with high accuracy config file (dna_r9.4.1_450bps_hac.cfg). The reads in fastq format were demultiplexed (only if both the ends had the barcodes) using Guppy_barcoder v4.0.15. Only the reads with a minimum q-score of 7 were considered for further analysis. Porechop v0.2.4 was used for trimming all the adapter and barcode sequences. The resulting clean reads were used for further analysis.

Metagenomic classification

The reads were classified using Centrifuge v1.0.4 against a database of viral genomes. The genome specific reads were sorted and mapped against respective genomes using minimap2 and the coverage was calculated. The bcftools was used for assembling the mapped reads and generating the consensus genome sequence.

Confirmation of presence of PCLV with conventional RT-PCR and sequencing

Fresh viral RNA was extracted from Pune mosquito pools as described above. Forward and reverse pairs of primers as given in Table 1 were used for amplification of ~900–1000 nucleotide sequences from L, M and S segments of PCLV genome by RT-PCR using SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (Invitrogen). The amplicons were purified and both strands were sequenced using BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) and analyzed on ABI 3130xl Genetic analyzer (Applied Biosystems, Foster City, USA). Mosquito samples collected from different states were processed similarly for viral RNA isolation and used for S gene amplification and sequencing.

Vertical transmission of PCLV

Eggs, larvae, pupae and adult mosquitoes reared from Ae. aegypti eggs from Madurai (Tamil Nadu) were processed to determine whether vertical transmission of the virus is occurring in the Aedes aegypti mosquitoes of the region. Generated amplicons were processed for sequencing and phylogenetic analysis.

Phylogenetic analysis

The obtained sequences were trimmed to remove primer sequences and aligned with various reference sequences downloaded from NCBI GenBank, using the ClustalW algorithm available through the Molecular Evolutionary Genetics Analysis (MEGA) 5 software [21]. Following this, the best fitting model for phylogenetic analysis was computed, and found to be the Tamura 3-Parameter model [22]. Maximum Likelihood phylogenetic trees were constructed using this model, taking uniform rates and 1000 bootstrap replicates.

Results

Optimization of library preparation for metagenome analysis

Lysates prepared from the laboratory colony of mosquitoes were spiked with cell culture grown WNV, JEV, dengue (serotype two), ZIKV and CHIKV particles and processed for viral RNA isolation, cDNA synthesis and library preparation using four different sets of primers. This was done in order to have the best conditions to carry out the metagenomic virome analysis of field mosquitoes. Library prepared with each of the P5 and P10, P12 and IDT-K primer set generated ~3 million reads. The trimmed reads were aligned onto the reference genomes of dengue, CHIKV, WNV, ZIKV, JEV and Aedes aegypti genome using minimap2, independently. All four primers, P5 and P10, P12 and IDT-K amplified the spiked viruses generating reads with the N50 of around 698 bases. Among the spiked viruses, dengue genome was recovered with maximum coverage 99.5%, while WNV, JEV and ZIKV genomes showed ~90% coverage with P5 and P10 primers. There were no reads representing chikungunya virus with both P5 and P10 primers. Though both P12 and IDT-K primers were able to successfully amplify CHIKV sequences, IDT-K primer (random octamer) showed >90% genome recovery. Pooling of libraries generated with primers P10 and IDK-K yielded sequence reads showing >90% coverage of genomes of all spiked viruses and hence it was decided to use both P10 and IDT-K primers for amplification in further experiments of virome analysis.

Metagenomic virome analysis of field caught Aedes aegypti mosquitoes

Field caught mosquitoes were processed for library preparation and sequencing using protocols optimized with virus spiking experiment. Each total virome sequencing run generated ~6.0 Gb data after 24 hours of the sequencing. After basecalling, demultiplexing, and trimming of adapters and primer sequences, average length of the reads was found to be ~300 bases (S1 Table). After removing the host Ae. aegypti sequences and reads <100 of length, the remaining clean reads were classified using BLASTn tool. The percentage of classified reads ranged between 3 to 53% for different runs after classification against a database containing human and viral genomes from RefSeq database (Table 2).

Table 2. Classified reads after classification against a database containing human and viral genomes.

Sample	Classified reads	% classified reads	Chordate reads	Viral reads	PCLV reads	PCLV % in virome
RUN2_barcode01	18573	6.93	8343	10209	9685	94.87
RUN2_barcode03	6408	2.88	3529	2877	2804	97.46
RUN2_barcode04	522282	51.29	521008	1259	604	47.97
RUN2_barcode05	141041	30.34	131983	8901	3013	33.85
RUN2_barcode06	255523	30.02	242491	12906	8927	69.17
RUN2_barcode07	322213	48.38	287419	34736	29867	85.98
RUN2_barcode08	87601	14.72	47884	39541	33189	83.94
RUN3_barcode01	340	38.12	336	4	3	75.00
RUN3_barcode02	1021	39.93	1005	16	12	75.00
RUN3_barcode03	1825	51.77	1755	70	22	31.43
RUN3_barcode04	528	13.14	341	182	105	57.69
RUN3_barcode05	258	12.60	179	79	44	55.70
RUN4_barcode01	201193	11.72	121277	79145	44009	55.61
RUN4_barcode02	154833	15.34	125205	29520	21630	73.27
RUN4_barcode03	260004	34.92	257119	2825	1934	68.46
RUN4_barcode04	132896	14.65	122883	9914	7331	73.95
RUN4_barcode05	362075	29.01	354058	7826	2923	37.35
RUN5_barcode01	325579	52.86	323486	2031	734	36.14
RUN5_barcode02	91354	34.45	89156	2147	1059	49.32
RUN5_barcode03	90009	28.16	83713	5674	2432	42.86
RUN5_barcode04	20988	15.63	20272	696	9	1.29
RUN5_barcode05	846	25.29	826	20	8	40.00
RUN5_barcode06	1390	13.78	1205	184	8	4.35

Open in a new tab

The virus metagenomic analysis revealed abundance of Phasi Charoen-like virus (PCLV) belonging to Phenuviridae family of the order Bunyavirales in all the mosquito samples from Pune. PCLV constituted an average of 62.25% of the total mapped viral reads. On further mapping of these against the PCLV L, M and S genome segments to estimate the genome coverage, eleven out of seventeen processed mosquito pool samples showed more than 70% coverage of PCLV genome, while two samples showed more than 90% virus genome coverage (S2 Table). The metagenome sequences generated from Ae. aegypti mosquitoes from Pune are deposited in GenBank (S3 Table; Accession Nos. five locations and SRA IDs respectively). In addition to PCLV, reads of other viruses, viz., Choristoneura fumiferana granulovirus (ChfuGV) (Baculoviridae), Piry vesiculovirus (PIRYV) (Rhabdoviridae), Human Gemykibivirus 2 (HuGkV-2) (Genomoviridae), Shamonda virus (Bunyaviridae) were also detected in the samples (Table 3). Since the reads for these viruses were comparatively few and genome coverage and depth were comparatively low, these sequences were not analyzed further.

Table 3. Species identified with minimum 50 reads.

Species	Taxon ID	Maximum reads classified	RUN2_NB01	RUN2_NB03	RUN2_NB04	RUN2_NB05	RUN2_NB06	RUN2_NB07	RUN2_NB08	RUN4_NB01	RUN4_NB02	RUN4_NB03
Homo sapiens	9606	521008	8343	3529	521008	131983	242491	287419	47884	121277	125205	257119
Phasi Charoen-like phasivirus	1980610	44009	9685	8804	6604	3013	8927	29867	33189	44009	21630	1934
Choristoneura fumiferana granulovirus	56947	21118	166	12	14	188	203	2239	2620	21118	5774	296
Piry vesiculovirus	1972575	12405	209	7	569	5519	3622	2440	2057	12405	1475	512
Human associated gemykibivirus 2	2004957	1011	1	0	2	77	1	82	1011
Shamonda orthobunyavirus	159150	727	4	0		5	3	11	38	174	47	48
Cotesia congregata bracovirus	39640	112	0	9		15			91	112
Lactobacillus virus LP65	298338	73	13	0	1	2	1	7		13	18	2
Prochlorococcus phage P-SSM2	268746	73	0	0						10
Mycobacterium virus Goose	1211282	57	0	0					57
Gokushovirinae Bog1183_53	1655646	54	0	0

Open in a new tab

Confirmation of the presence of PCLV in Aedes aegypti mosquitoes by conventional RT-PCR and sequence analysis

Viral RNA isolated from Ae. aegypti female mosquitoes collected from one location in Pune was processed for amplification of partial L, M, and complete S segment of PCLV genome to validate the NGS results. All the three segments could be successfully amplified (Figs 2A and S1). Sequencing of amplicons obtained from these segments using Sanger’s method confirmed these as PCLV sequences and validated the results obtained with NGS based metagenomic analysis. Sequence comparisons with the reference PCLV Rio isolate showed 98.90%, 99.027% and 98.88% homologies in the S, M and L segments respectively. These findings confirmed findings of NGS based metagenome analysis of viruses suggesting that PCLV is present abundantly in wild, field caught Ae. aegypti mosquitoes from Pune district, Maharashtra.

Fig 2 — **a: Detection of PCLV S, M and L segments from Pune adult female mosquito pools using RT-PCR.** Products were analysed on 2% agarose gel, lanes- L1: Complete S segment, L2: Partial M segment, L3: Partial L segment, L4: 100 bp DNA ladder, L5: Negative control. **b: Detection of PCLV S segment from mosquito samples from different locations from India using RT-PCR.** Products were analyzed on 2% agarose gel, lanes- L1: 100 bp DNA ladder (Invitrogen), L2: Assam (AS) adult mosquito pool, L3: Pune, Maharashtra (MH) adult mosquito pool, L4: Karnataka (KA) adult mosquito pool, L5: Tamil Nadu (TN) mosquito eggs, L6: Tamil Nadu (TN) mosquito larvae, L7: Tamil Nadu (TN) mosquito pupae, L8: Tamil Nadu (TN) mosquito adults, L9: 100 bp DNA ladder.

Detection of PCLV in Aedes aegypti mosquitoes collected from other states of India

PCLV ‘S’ segment was amplified from Ae. aegypti mosquito samples collected from Karnataka, Assam and Tamil Nadu states of India (Figs 2B and S2). Presence of PCLV in Ae. aegypti mosquitoes in Karnataka has already been reported recently [23]. PCLV S segment sequences from different locations of India were compared to reference PCLV S segment sequences across the world. The lowest percent nucleotide identity observed was 99.90% between S segment sequences generated from Ae. aegypti mosquitoes from Assam, India, and adult mosquitoes from Rio (Brazil). The highest homology observed was 99.98% between sequences from pupae of Tamil Nadu mosquitoes and adults from Kenya (Table 4). Ae. aegypti mosquitoes from the four states showed >99.95% homology of PCLV ‘S’ gene sequences. Overall results indicate that PCLV is a highly conserved virus and viral strains circulating in Ae. aegypti mosquitoes across the world have very high genetic similarity suggesting a common ancestor for these strains (Fig 2B).

Table 4. Percent Nucleotide identities of PCLV S segment sequences from various life cycle stages of Ae. aegypti mosquitoes collected from different parts of India compared to PCLV sequences across the world.

Origin	NC_038263.1 Rio_Brazil	LC498493.1 Ghana	MH237597.1 Australia	MN053771.1 Guadeloupe	MT361067.1 Kenya	KM001087.1 Thailand	MN109951.1 Grenada	KU936055.1 UK	MH310081.1 USA	MF614134.1 China
IND (TN) (eggs)	98.939	99.961	99.957	99.975	99.983	99.981	99.970	99.959	99.959	99.959
IND (TN) (larvae)	98.942	99.952	99.952	99.966	99.974	99.972	99.961	99.954	99.954	99.954
IND (TN) (pupae)	98.958	99.961	99.957	99.979	99.986	99.981	99.981	99.959	99.959	99.963
IND (TN) (female)	98.934	99.961	99.956	99.979	99.983	99.977	99.977	99.957	99.957	99.959
IND (MH)	98.901	99.950	99.941	99.956	99.967	99.959	99.952	99.943	99.943	99.946
IND (AS)	98.900	99.957	99.944	99.965	99.979	99.970	99.963	99.946	99.946	99.948
IND (KN)	98.901	99.948	99.939	99.957	99.968	99.961	99.954	99.941	99.941	99.941

Open in a new tab

Transovrial transmission of PCLV in Aedes aegypti

To determine whether transovarial transmission of PCLV occurs in Ae. aegypti mosquitoes, a colony was established from Ae. aegypti eggs obtained from Madurai (Tamil Nadu state) and larvae, pupae, adults and eggs from the colony were processed for S gene amplification. PCLV was detected in all the stages of Ae. aegypti indicating occurrence of transovarial transmission (vertical transmission) of the virus in Ae. aegypti. Nucleotide identities as compared to reference sequence were: eggs 99.984%, larvae 99.981, pupae 99.983% and adults 99.983% (Fig 3).

Fig 3 — Phylogenetic tree constructed via Maximum Likelihood (ML) method, using Tamura 3-Parameter and 1000 Bootstrap replicates for PCLV S segment sequences obtained from *Aedes aegypti* mosquitoes from different states of India, along with reference sequences from across the world.

Discussion

Metagenomic analysis using Next generation sequencing platforms has become a powerful tool for analysis of genomes of organisms. A study by Shi et al [24] has reported presence of >1500 novel RNA viruses in invertebrates. Subsequently, several investigators across the globe have used the tool and identified novel viral reads in important disease vectors viz., Aedes aegypti, Culex quinquefasciatus, etc. The surge in dengue across the world in the recent decades has stimulated renewed research interest in Ae. aegypti mosquitoes as control of dengue still depends on vector management. It is speculated that vectorial capacity of mosquitoes can be influenced by the presence of endosymbiotic microbes by altering the susceptibility of the mosquitoes to pathogenic viruses [25]. Studies have also shown that endosymbiont organisms in mosquitoes inhibit or reduce the replication of pathogenic viruses and could be used as biological control agents [10,13,24]. Studies using Wolbachia, an enosymbiont bacterium in mosquitoes, have also shown that it can inhibit the replication of many eukaryotic viruses [7,26]. Aedes aegypti mosquitoes, which lack the natural colonization of Wolbachia have shown resistance to dengue and chikungunya viruses when experimentally infected with Wolbachia [27]. Culex quinquifasciatus mosquitoes harboring Wolbachia have also shown resistance to West Nile virus upon infection [28]. Since no licensed vaccine is available for dengue today, these studies may evolve in the development of suitable control agents to limit the growth of the virus in Aedes aegypti mosquito.

In the present study, we analysed virome of Ae. aegypti mosquitoes collected from different parts of India, i.e., Pune district of Maharashtra, Bengaluru (Karnataka), Dibrugarh (Assam) and Madurai (Tamil Nadu). We observed abundance of PCLV sequences in the mosquito samples tested from all the states. In complete virome analysis of field caught Ae. aegypti mosquitoes from Pune region of Maharashtra, PCLV constituted >60% reads of the total mapped viral reads. The rest constituted by an array of viruses, viz., members of virus families Baculoviridae, Rhabdoviridae, Genomoviridae, Bunyaviridae etc. Among these, Piry virus (PIRYV) (Family: Rhabdoviridae, genus: Vesiculovirus) and Human Gemykibivirus 2 (HuGkV-2) (family: Genomoviridae) (Table 3) are suspected to be human pathogens hence need further attention [29]. Piry virus (PIRYV) (genus Vesiculovirus) is similar to Chandipura virus [30] that shows very high mortality in infected children. Serosurveys from different regions of Brazil have shown 4–17.7% seropositivity against PIRYV suggestive of human exposure to the virus. It was noted that accidental human exposure to PIRYV induces symptoms such as fever, headache, weakness, myalgia and arthralgia indicating that the virus has potential to cause human disease [31]. Importantly, experimental PIRYV infections in adult Swiss albino mice induces neuropathological damage and behavioral changes [32] suggesting severe manifestations upon infection. Hence PIRYV warrants further studies to assess potential threat to humans. Though clinical impact of HuGkV-2 is currently not known, detection of HuGkV-2 DNA in human blood samples from Brazilian Amazon also draws attention towards this virus [33]. Reads detected for another virus requiring attention was, Shamonda virus belonging to the Simbu group of the genus Orthobunyavirus of the family Peribunyaviridae. Orthobunyaviruses are transmitted between mammalian hosts by arthropod vectors. Their tripartite genomes facilitate reassortment of genomic segments. Detection of Shamonda virus in Ae aegypti adult mosquitoes collected from different locations from Pune indicates that these mosquitoes are persistently infected with the virus. PCLV also belongs to the same family. With rapid global movement and favorable climatic changes for emergence of new viruses, it would be essential to monitor Peribunyavirus activity in mosquitoes. It would be worthwhile to isolate these mosquito viruses and do further studies to understand whether these viruses have ability to interfere in the growth of each other and of the viruses of medical importance. The metagenomic virome analysis did not show presence of any viruses of medical importance such as DENV, CHIKV and ZIKV in the field caught mosquitoes, possibly since there were no current outbreaks. We used RNA metagenomic approach using the Oxford Nanopore sequencing platform to generate nearly complete genome sequence of Phasi Charoen-like virus infecting field-caught Ae. aegypti female mosquitoes in Pune, Maharashtra, India. Analysis of Ae. aegypti mosquitoes from three other states of India also revealed that this virus is abundantly present in these mosquitoes. Furthermore, presence of the virus at all developmental stages of the mosquito indicated vertical transmission of PCLV. Since PCLV is insect specific virus and there is no intermediate vertebrate host that can amplify the virus, it appears that transovarial transmission is the only way to maintain the virus.

Importantly, comparative sequence analysis showed >99% homology between Indian isolates as well as in isolates of other countries, suggesting high genetic stability of the virus. Presence of PCLV in natural populations of Ae. aegypti without significant changes in viral genomes suggests its possible endosymbiotic or commensal relationship with the mosquito without harming the fitness of its host.

Detection of PCLV in Ae. aegypti mosquitoes has already been reported from Brazil, Grenada, China, Thailand, USA etc [13,14,24,25,34]. However, the implication of PCLV in Ae. aegypti mosquitoes in the inhibition of pathogenic viruses such as dengue or chikungunya is not clearly known. Entomological investigations during dengue/chikungunya outbreaks in different parts of India have shown transmission by Ae. aegypti mosquitoes despite harboring high density of PCLV suggestive of its negative role in blocking the virus transmission (NIV unpublished data). This is in agreement with in vitro studies by Fredericks et al [5] where they have shown persistently infected cells harboring PCLV, did not show any impact on culturing and growth of other arboviruses. Being a member of the family Peribunyaviridae, which comprises several viruses of public health importance; the role of PCLV in interfering with replication of bunyaviruses is important and warrants investigation. Presence of ISVs belonging to family Flaviviridae, viz., Bagaza virus, Palm Creek virus etc., have shown inhibition of JEV, WNV and Murray Valley encephalitis virus in their respective vectors [9,10]. Experimental studies have shown the phenomenon of superinfection exclusion where cultures/mosquitoes infected with one flavivirus, reduced replication of another flavivirus upon subsequent infection [35].

Not much is still known about the role played by PCLV and other viruses in Aedes aegypti mosquitoes in the replication and transmission of human pathogenic viruses, viz., dengue, chikungunya, Zika or Yellow fever. Further research into these aspects may come up with the potential of using the mosquito specific viruses in managing/impacting Ae. aegypti borne pathogenic viruses especially in the absence of prophylactics or therapeutics.

Supporting information

S1 Fig. Detection of PCLV S, M and L segments from Pune adult female mosquito pools using RT-PCR.

Products were analysed on 2% agarose gel, lanes- L1: Complete S segment, L2: Partial M segment, L3: Partial L segment, L4: 100 bp DNA ladder, L5: Negative control.

(TIFF)

Click here for additional data file.^{(3MB, tiff)}

S2 Fig. Detection of PCLV S segment from mosquito samples from different locations from India using RT-PCR.

Products were analyzed on 2% agarose gel, lanes- L1: 100 bp DNA ladder (Invitrogen), L2: Assam (AS) adult mosquito pool, L3: Pune, Maharashtra (MH) adult mosquito pool, L4: Karnataka (KA) adult mosquito pool, L5: Tamil Nadu (TN) mosquito eggs, L6: Tamil Nadu (TN) mosquito larvae, L7: Tamil Nadu (TN) mosquito pupae, L8: Tamil Nadu (TN) mosquito adults, L9: 100 bp DNA ladder.

(TIF)

Click here for additional data file.^{(3MB, tif)}

S1 Table. Reads of representative sequencing runs after basecalling, adaptor and primer trimming.

(DOCX)

Click here for additional data file.^{(12.3KB, docx)}

S2 Table. PCLV genome coverage in samples from different locations in Pune.

(DOCX)

Click here for additional data file.^{(20.5KB, docx)}

S3 Table. GenBank accession numbers for ‘S’ segment sequences and sample details.

(DOCX)

Click here for additional data file.^{(11.5KB, docx)}

S1 File

(PDF)

Click here for additional data file.^{(91.5KB, pdf)}

Acknowledgments

The authors wish to thank Professor Priya Abraham, the Director, ICMR- NIV, for her keen interest in the project and for the constant support. The authors also thank Dr Ashwani Kumar and Dr R Paramsivan from ICMR-Vector Control Research Centre, Puducherry and Dr Siraj Khan, Regional Medical Research Centre Dibrugarh, Assam for providing mosquito eggs for the study.

Data Availability

All relevant data are within the article and its supporting information files.

Funding Statement

Indian Council of Medical Research, New Delhi, India funded the project as an extramural project granted to ABS, KSL and SC. Grant No. 6/9-7 (2019-ECD-II). The funders had no role in study design, data collection and analyis, decision to publish or preparation of the manuscript.

References

1.Petersen LR, Powers AM. Chikungunya: epidemiology. F1000Res. 2016. Jan 19;5:F1000 Faculty Rev-82. doi: 10.12688/f1000research.7171.1 . [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Lim SM, Dutta SK and Martina BEE. Defining efficacy of chikungunya virus candidate vaccines: different endpoints derived from the virus—cytokine—ferritin (VCF) model. Front. Virol. 2021; 1:693439. doi: 10.3389/fviro.2021.693439 [DOI] [Google Scholar]
3.Danforth ME, Fischer M, Snyder RE, Lindsey NP, Martin SW, Kramer VL. Characterizing areas with increased burden of West Nile Virus disease in California, 2009–2018. Vector Borne Zoonotic Dis. 2021. Aug;21(8):620–627. doi: 10.1089/vbz.2021.0014 Epub 2021 Jun 2. ; PMCID: PMC8380797. [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Ronca SE, Ruff JC, Murray KO. A 20-year historical review of West Nile virus since its initial emergence in North America: Has West Nile virus become a neglected tropical disease? PLoS Negl Trop Dis. 2021; 15(5): e0009190. doi: 10.1371/journal.pntd.0009190 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Fredericks AC, Russell TA, Wallace LE, Davidson AD, Fernandez-Sesma A, Maringer K Aedes aegypti (Aag2)-derived clonal mosquito cell lines reveal the effects of pre-existing persistent infection with the insect-specific bunyavirus Phasi Charoen-like virus on arbovirus replication. PLoS Negl Trop Dis 2019;13(11): e0007346. doi: 10.1371/journal.pntd.0007346 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Bhatt S, Gething PW, Brady OJ, Messina JP, Farlow AW, Moyes CL, et al. The global distribution and burden of dengue. Nature. 2013. Apr 25;496(7446):504–7. doi: 10.1038/nature12060 Epub 2013 Apr 7. ; PMCID: PMC3651993. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Johnson K N. The Impact of Wolbachia on virus infection in mosquitoes. Viruses 2015; 7: 5705–5717; doi: 10.3390/v7112903 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Utarini A, Indriani C, Ahmad RA, Tantowijoyo W, Arguni E, Ansari MR, et al. AWED Study Group. Efficacy of Wolbachia-Infected mosquito deployments for the control of dengue. N Engl J Med. 2021. Jun 10;384 (23):2177–2186. doi: 10.1056/NEJMoa2030243 ; PMCID: PMC8103655. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Sudeep AB, Bondre VP, George R, Ghodke YS, Aher RV, Gokhale MD. Bagaza virus inhibits Japanese encephalitis and West Nile virus replication in Culex tritaeniorhynchus & Cx. quinquefasciatus mosquitoes. Indian J Med Res 2015; 142: 44–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Hobson-Peters J, Yam AWY, Lu JWF, Setoh YX, May FJ, et al. A new insect-specific flavivirus from Northern Australia suppresses replication of West Nile virus and Murray Valley encephalitis virus in co-infected mosquito cells. PLoS ONE 2013; 8(2): e56534. doi: 10.1371/journal.pone.0056534 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Öhlund P., Lundén H. & Blomström AL. Insect-specific virus evolution and potential effects on vector competence. Virus Genes 55, 127–137 (2019). doi: 10.1007/s11262-018-01629-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Elrefaey AM, Abdelnabi R, Rosales Rosas AL, Wang L, Basu S, Delang L. Understanding the mechanisms underlying host restriction of insect-specific viruses. Viruses. 2020. Aug 31;12(9):964. doi: 10.3390/v12090964 . [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Ramos-Nino ME, Fitzpatrick DM, Tighe S, Eckstrom KM, Hattaway LM, Hsueh AN, et al. High prevalence of Phasi Charoen-like virus from wild-caught Aedes aegypti in Grenada, W.I. as revealed by metagenomic analysis. PLoS One. 2020. Jan 31;15(1):e0227998. doi: 10.1371/journal.pone.0227998 ; PMCID: PMC6993974. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Zhang X, Huang S, Jin T, Lin P, Huang Y, Wu C, et al. Discovery and high prevalence of Phasi Charoen-like virus in field-captured Aedes aegypti in South China. Virology. 2018. Oct; 523:35–40. doi: 10.1016/j.virol.2018.07.021 [DOI] [PubMed] [Google Scholar]
15.Barraud PJ. The fauna of British India, including Ceylon and Burma. Diptera.Vol V. Family Culicidae. Tribes Megarhinini and Culicini. London: Taylor and Francis; 1934. [Google Scholar]
16.Xiao P, Han J, Zhang Y, Li C, Guo X, Wen S, et al. Metagenomic Analysis of Flaviviridae in mosquito viromes isolated from Yunnan Province in China reveals genes from dengue and Zika viruses. Front Cell Infect Microbiol. 2018;8:359. doi: 10.3389/fcimb.2018.00359 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Chrzastek K, Lee DH, Smith D, Sharma P, Suarez DL, Pantin-Jackwood M, et al. Use of Sequence-Independent, Single-Primer-Amplification (SISPA) for rapid detection, identification, and characterization of avian RNA viruses. Virology. 2017. Sep; 509: 159–166. doi: 10.1016/j.virol.2017.06.019 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.He B, Li Z, Yang F, Zheng J, Feng Y, Guo H, et al. Virome profiling of bats from Myanmar by metagenomic analysis of tissue samples reveals more novel Mammalian viruses. PLoS ONE 2013, 8:e61950. doi: 10.1371/journal.pone.0061950 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Deng Q, Wan L, Li X, Cao X, Zhou Y, Song C. Metagenomic evidence reveals denitrifying community diversity rather than abundance drives nitrate removal in storm water bio filters amended with different organic and inorganic electron donors. Chemosphere. 2020. Oct;257:127269. doi: 10.1016/j.chemosphere.2020.127269 [DOI] [PubMed] [Google Scholar]
20.Hameed M, Liu K, Anwar MN, Wahaab A, Li C, Di D, et al. A viral metagenomic analysis reveals rich viral abundance and diversity in mosquitoes from pig farms. Transbound Emerg Dis. 2020. Jan;67(1):328–343. doi: 10.1111/tbed.13355 [DOI] [PubMed] [Google Scholar]
21.Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011. Oct;28(10):2731–9. doi: 10.1093/molbev/msr121 Epub 2011 May 4. ; PMCID: PMC3203626. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Tamura K. Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G+C-content biases. Mol Biol Evol. 1992. Jul;9(4):678–87. doi: 10.1093/oxfordjournals.molbev.a040752 . [DOI] [PubMed] [Google Scholar]
23.Munivenkatappa A, Nyayanit DA, Yadav PD, Rangappa M, Patil S, Majumdar T, et al. Identification of Phasi Charoen-Like Phasivirus in field collected Aedes aegypti from Karnataka State, India. Vector Borne Zoonotic Dis. 2021;21(11):900–909. doi: 10.1089/vbz.2021.0011 Epub 2021 Sep 14. [DOI] [PubMed] [Google Scholar]
24.Shi C, Beller L, Deboutte W, Yinda KC, Delang L, Vega-Ru´a A, et al. Stable distinct core eukaryotic viromes in different mosquito species from Guadeloupe, using single mosquito viral metagenomics. Microbiome. 2019; doi: 10.1186/s40168-019-0734-2 . [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Chandler JA, Thongsripong P, Green A, Kittayapong P, Wilcox BA, Schroth GP, et al. Metagenomic shotgun sequencing of a Bunyavirus in wild-caught Aedes aegypti from Thailand informs the evolutionary and genomic history of the Phleboviruses. Virology. 2014; doi: 10.1016/j.virol.2014.06.036 . [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Walker T, Moriera LA. Can Wolbachia be used to control malaria? Mem Inst Oswaldo Cruz, Rio de Janeiro, 2011; Vol. 106 (Suppl. I): 212–217. doi: 10.1590/s0074-02762011000900026 [DOI] [PubMed] [Google Scholar]
27.Moreira LA, Iturbe-Ormaetxe I, Jeffery JA, Lu G, Pyke AT, Hedges LM, et al. A Wolbachia symbiont in Aedes aegypti limits infection with dengue, Chikungunya, and Plasmodium. Cell. 2009;139: 1268–1278. [DOI] [PubMed] [Google Scholar]
28.Glaser RL, Meola MA. The native Wolbachia endosymbionts of Drosophila melanogaster and Culex quinquefasciatus increase host resistance to West Nile virus infection. PLoS ONE. 2010; 5: e11977. doi: 10.1371/journal.pone.0011977 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Krupovic M, Ghabrial SA, Jiang D, Varsani A. Genomoviridae: a new family of widespread single-stranded DNA viruses. Arch Virol. 2016. Sep;161(9):2633–43. doi: 10.1007/s00705-016-2943-3 Epub 2016 Jun 24. . [DOI] [PubMed] [Google Scholar]
30.Cherian SS, Gunjikar RS, Banerjee A, Kumar S, Arankalle VA. Whole genomes of Chandipura virus isolates and comparative analysis with other rhabdoviruses. PLoS One. 2012;7(1):e30315. doi: 10.1371/journal.pone.0030315 Epub 2012 Jan 17. ; PMCID: PMC3260278. [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Tavares-Neto J, Travassos da Rosa AP, Ataide M, Morais-Souza H, Vasconcelos P, Travassos da Rosa J (1990) Frequency of neutralizing antibodies to the vesiculovirus Piry, in blood donors of Uberaba, Minas Gerais, Brazil. Rev Inst Med Trop Sao Paulo 32:211–214. [PubMed] [Google Scholar]
32.Zucherato VS, Giovanetti M, Costa LOA, Krause LMF, Alves DCC, Moreira RMA, et al. Molecular identification of the emerging Human Gemykibivirus-2 (HuGkV-2) among Brazilian blood donors. Transfus Apher Sci. 2022. Jul 26:103516. doi: 10.1016/j.transci.2022.103516 Epub ahead of print. . [DOI] [PubMed] [Google Scholar]
33.de Sousa AA, Reis R, Bento-Torres J, Trevia N, Lins NA, Passos A, et al. (2011) Influence of enriched environment on viral encephalitis outcomes: behavioral and neuropathological changes in albino Swiss mice. PLoS One 6:e15597. doi: 10.1371/journal.pone.0015597 [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Cunha MDP, Ioshino RS, Costa-da-Silva AL, Petersen V, Capurro ML, Zanotto PMA. A Metagenomic Approach Identified a Novel Phasi Charoen-Like virus co-infecting a chikungunya virus-Infected Aedes aegypti mosquito in Brazil. Microbiol Resour Announc. 2020. Jul 30;9(31):e01572–19. doi: 10.1128/MRA.01572-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Goenaga S, Goenaga J, Boaglio ER, Enria DA, Levis SDC. Superinfection exclusion studies using West Nile virus and Culex flavivirus strains from Argentina. Mem Inst Oswaldo Cruz. 2020. Jun 3;115:e200012. doi: 10.1590/0074-02760200012 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0277276.r001

Decision Letter 0

Humberto Lanz-Mendoza

26 Jul 2022

PONE-D-22-17294Abundance of Phasi-Charoen-like virus in Aedes aegypti mosquito populations in different states of IndiaPLOS ONE

Dear Dr. Sudeep,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

Authors must modify the discussion section regarding the IVS and other viruses also found. Please reorganize the tables and figures as suggested by one of the reviewers.

Please submit your revised manuscript by Sep 09 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Humberto Lanz-Mendoza

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf.

2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

3. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ.

4. Please ensure that you refer to Figure 2 in your text as, if accepted, production will need this reference to link the reader to the figure.

Additional Editor Comments:

Authors must modify the discussion section regarding the IVS and other viruses also found. Please reorganize the tables and figures as suggested by one of the reviewers.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Great manuscript! It opens the potential for future vector-based vaccines to kill dengue viruses inside the Aedes aegypti gut and salivary glands. These findings also may help to understand false positive ZIKV when PCR testing has been conducted in Culex, a non vector, in some locations of Brazil and Mexico. We invite these authors to pursue additional research efforts with rickettsial bacteria and related insect-living microorganisms

Reviewer #2: In the paper titled Abundance of Phasi-Charoen-like virus in Aedes aegypti mosquito populations in different states of India, by Kavita Lole and collaborators, the authors found the predominance of Phasi Charoen-like virus in Aedes aegypti mosquitoes field collected as well as, the presence of transovarial transmission verified in eggs, larvae, pupae, and male adults.

The data are interesting in the field of study and contribute to elucidating the virome of field mosquitoes.

However, as in other works, this article does not abound with evidence on the role that ISVs could have on infection with medically important viruses.

The discussion could focus on other viruses also found, on transovarian transmission, and the lack of evidence of viruses of medical importance in the samples.

There are tables that could be in supplementary material, and a map with the collected points is suggested. The presentation of the tables in the text should be in order and the legend figures should be more explanatory.

Introduction.

Line 71-73. The authors mention “These studies have shown inhibition/ reduced replication of Japanese encephalitis, Murray Valley encephalitis and West Nile viruses in respective vector mosquitoes that were experimentally infected with ISVs”. However in reference 10 in effect, they show inhibition or reduced replication but they observed it in cell culture, the authors should specify this point.

Line 75. The original reference is in Virus Genes volume55, pages 127–137 (2019)

Materials and Methods.

Line 86. Define which keys were used.

Line 89. The larvae reared until adults.

Line 98. Region specific primers (Table 1?)

Line 113. Rnase I ?

Line 118, Were these mosquitoes collected? Or are they the mosquitoes of the laboratory colony?

Line 144; Table 1. The author should reference where the random anchored primers were taken, (maybe reference 11).

Line 197. Space between table 1 and [11].

Line 206. These mosquitoes are representatives of the colony, right?

Line 210. In bold

Line 213. Mistake at the end f the sentence.

Results. Should the author clarify that the mosquito lysate spiked with cell culture with different viruses was done in order to have the best conditions to carry out the metagenomic virome analysis of field mosquitoes. The way it is currently written leaves some confusion, it should be clearer for the reader.

Why the author optimized the female mosquito lysate with cell culture virus. Wouldn't it have been better to have food mosquitoes (infected) with viruses as a better control?

Line 219. Mosquito of the laboratory colony.

Line 224. P5, P10, P12, and IDT-K

Line 243. I suggest that tables 2, 5, 6 could be presented as supplementary material.

Line 271. I can't see the three amplification products in figure 1a. All amplified products have the same size. The legend of the figure is not descriptive with what is shown

Line 298-300. Again the question. These mosquitoes are of the laboratory colony?

Line 304. This table is not necessary, this could resume in the text.

Discussion.

Line 376. the role of PCLV… I suggest the authors include a reference and discuss more about this point.

Most of the discussion is about the potential inhibitor effect of ISV against vector-borne disease, however, there is no evidence of this inhibitory effect as the authors mention in lines 367-369. Therefore I would like to see more data about this point in this work.

The most relevant data are in table 4. I suggest to the authors focus on the others virus found in field mosquitoes and the implications or consequences of these.

Interestingly in all field mosquito samples, the authors found no medically important flavivirus, so it would be nice if they could include it in the discussion if this will be because there are no current outbreaks or the possible presence of ISVs in particular PCLV.

References:

Line 425. erase space between 1371/journal to active correctly the hyperlink

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2022 Dec 9;17(12):e0277276. doi: 10.1371/journal.pone.0277276.r002

Author response to Decision Letter 0

1 Sep 2022

PONE-D-22-17294

Abundance of Phasi-Charoen-like virus in Aedes aegypti mosquito populations in different states of India

PLOS ONE

Dear Dr. Sudeep,

==============================

Authors must modify the discussion section regarding the IVS and other viruses also found. Please reorganize the tables and figures as suggested by one of the reviewers.

Please include the following items when submitting your revised manuscript:

• A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

• A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

• An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Humberto Lanz-Mendoza

Academic Editor

PLOS ONE

Journal Requirements:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming.

2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files

3. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016.

4. Please ensure that you refer to Figure 2 in your text as, if accepted, production will need this reference to link the reader to the figure.

Additional Editor Comments:

1) Authors must modify the discussion section regarding the IVS and other viruses also found. Please reorganize the tables and figures as suggested by one of the reviewers. 4. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

________________________________________

5. Review Comments to the Author

The data are interesting in the field of study and contribute to elucidating the virome of field mosquitoes.

However, as in other works, this article does not abound with evidence on the role that ISVs could have on infection with medically important viruses.

The discussion could focus on other viruses also found, on transovarian transmission, and the lack of evidence of viruses of medical importance in the samples.

There are tables that could be in supplementary material, and a map with the collected points is suggested. The presentation of the tables in the text should be in your order and the legend figures should be more explanatory.

Response to reviewer's comments

Answer: Tables 2, 5 and 6 are shifted in the supplementary material as suggested. A map with sample collection points is added as Figure 1. The figure legends are now modified.

Introduction.

Answer: This has been now mentioned in the text (lines 70-74).

Line 75. The original reference is in Virus Genes volume55, pages 127–137 (2019)

Answer: The original reference ‘Öhlund, P., Lundén, H. & Blomström, AL. Insect-specific virus evolution and potential effects on vector competence. Virus Genes 55, 127–137 (2019). https://doi.org/10.1007/s11262-018-01629-9’ has been added in the list (ref 11)

Materials and Methods.

Line 86. Define which keys were used.

Answer: The keys described by Barraud PJ is included in the revised version (Ref. No. 15)

Line 89. The larvae reared until adults.

Answer: The line has been changed as suggested.

Line 98. Region specific primers (Table 1?)

Answer: Table 1 is now mentioned in the text as suggested.

Line 113. Rnase I ?

Answer: We are extremely sorry for this mistake. It is RNase A. This has been corrected in the text.

Line 118, Were these mosquitoes collected? Or are they the mosquitoes of the laboratory colony?

Answer: These were taken from a laboratory colony. This is now mentioned in the text.

Line 144; Table 1. The author should reference where the random anchored primers were taken, (maybe reference 11)

Answer: We are sorry for that. The references for primers are now added in the table 1. These references were already added in the list.

Line 197. Space between table 1 and [11].

Answer: The space has been added. Reference 11 is now 13 in the revised version.

Line 206. These mosquitoes are representatives of the colony, right?

Answer: These were either field-caught adult mosquitoes or larvae reared to adults. They were not from the colony.

Line 210. In bold

Answer: The subtitle, ‘Phylogentic analysis’ is now made bold.

Line 213. Mistake at the end f the sentence.

Answer: We are sorry for that. The sentence is corrected now.

Results.

Should the author clarify that the mosquito lysate spiked with cell culture with different viruses was done in order to have the best conditions to carry out the metagenomic virome analysis of field mosquitoes. The way it is currently written leaves some confusion, it should be clearer for the reader.

Answer: We have added a line in the text (lines 223-225). Thank you for this suggestion.

Why the author optimized the female mosquito lysate with cell culture virus. Wouldn't it have been better to have food mosquitoes (infected) with viruses as a better control?

Answer: Yes, that would have been an ideal control. We used spiking approach so that we can try a range of virus concentrations for spiking during optimization experiments.

Line 219. Mosquito of the laboratory colony.

Answer: We have now mentioned that,’ Lysates prepared from the laboratory colony of mosquitoes were spiked with…………as suggested (line 221).

Line 224. P5, P10, P12, and IDT-K

Answer: This has been mentioned in the text now (line 226).

Line 243. I suggest that tables 2, 5, 6 could be presented as supplementary material.

Answer: The tables 2, 5 and 6 are now shifted in the supplementary material. The same is also mentioned in the text.

Line 271. I can't see the three amplification products in figure 1a. All amplified products have the same size. The legend of the figure is not descriptive with what is shown

Answer: We are extremely sorry for this inadvertent mistake. We did not include the gel picture representing S, M and L segment amplicons from Pune mosquitoes. The picture given as figure 1a was S region amplification from different states of India and different developmental stages of mosquito. We have now added a new gel picture for S, M and L segment amplification as figure 1a. The earlier gel picture in now figure 1b.

Line 298-300. Again the question. These mosquitoes are of the laboratory colony?

Answer: Yes, it was the laboratory colony. We obtained Ae. aegypti eggs from ICMR-Vector control Research Centre, Madurai, Tamil Nadu. These eggs were used to establish a colony to obtain larvae, pupae, adults and eggs. We have now modified the lines as, ‘To determine whether transovarial transmission of PCLV occurs in Ae. aegypti mosquitoes, a colony was established from Ae. aegypti eggs obtained from Madurai (Tamil Nadu state), larvae, pupae, adult and eggs from the colony were processed for S gene amplification.

Line 304. This table is not necessary, this could resume in the text.

Answer: Table 8 is deleted and the results are given in the text (lines 307-309) as suggested.

Discussion.

Line 376. the role of PCLV… I suggest the authors include a reference and discuss more about this point.

Answer: We have initiated experiments to isolate PCLV in C6/36 cells and hope to generate information on influence of PCLV on other arboviruses. As mentioned in the discussion (lines 409-412) we have seen no effect of PCLV on DENV and CHIKV transmission. We investigated one chikungunya outbreak recently (May 2022). We collected Ae. aegypti larvae obtained from containers from a patient’s house, reared to adults and processed for metagenomic analysis and obtained similar results (not included in this manuscript). These findings indirectly show that there is no influence of PCLV on CHIKV dissemination.

The most relevant data are in table 4. I suggest to the authors focus on the others virus found in field mosquitoes and the implications or consequences of these.

Answer: We have added more discussion on the other viruses detected in field caught mosquitoes (lines 385-406).

Answer: This is now mentioned in the text (lines 406-408)

References:

Line 425. erase space between 1371/journal to active correctly the hyperlink

Answer: The space is removed

PLoS One. doi: 10.1371/journal.pone.0277276.r003

Decision Letter 1

Humberto Lanz-Mendoza

25 Oct 2022

Abundance of Phasi-Charoen-like virus in Aedes aegypti mosquito populations in different states of India

PONE-D-22-17294R1

Dear Dr. Sudeep,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Humberto Lanz-Mendoza

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: N/A

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #1: Authors have considerede my comments. I really believe this is a very interesting manuscript. Research work related to arboviruses need to integrate these ISV results with PCR results and correlate local human diseases.

Reviewer #2: The authors have adequately addressed my comments raised in a previous round of review, this manuscript is now acceptable for publication.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Ildefonso Fernandez-Salas

Reviewer #2: Yes: Jorge Cime

**********

PLoS One. doi: 10.1371/journal.pone.0277276.r004

Acceptance letter

Humberto Lanz-Mendoza

14 Nov 2022

PONE-D-22-17294R1

Abundance of Phasi-Charoen-like virus in Aedes aegypti mosquito populations in different states of India

Dear Dr. Sudeep:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Humberto Lanz-Mendoza

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Detection of PCLV S, M and L segments from Pune adult female mosquito pools using RT-PCR.

Products were analysed on 2% agarose gel, lanes- L1: Complete S segment, L2: Partial M segment, L3: Partial L segment, L4: 100 bp DNA ladder, L5: Negative control.

(TIFF)

Click here for additional data file.^{(3MB, tiff)}

S2 Fig. Detection of PCLV S segment from mosquito samples from different locations from India using RT-PCR.

(TIF)

Click here for additional data file.^{(3MB, tif)}

S1 Table. Reads of representative sequencing runs after basecalling, adaptor and primer trimming.

(DOCX)

Click here for additional data file.^{(12.3KB, docx)}

S2 Table. PCLV genome coverage in samples from different locations in Pune.

(DOCX)

Click here for additional data file.^{(20.5KB, docx)}

S3 Table. GenBank accession numbers for ‘S’ segment sequences and sample details.

(DOCX)

Click here for additional data file.^{(11.5KB, docx)}

S1 File

(PDF)

Click here for additional data file.^{(91.5KB, pdf)}

Data Availability Statement

All relevant data are within the article and its supporting information files.

[pone.0277276.ref001] 1.Petersen LR, Powers AM. Chikungunya: epidemiology. F1000Res. 2016. Jan 19;5:F1000 Faculty Rev-82. doi: 10.12688/f1000research.7171.1 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref002] 2.Lim SM, Dutta SK and Martina BEE. Defining efficacy of chikungunya virus candidate vaccines: different endpoints derived from the virus—cytokine—ferritin (VCF) model. Front. Virol. 2021; 1:693439. doi: 10.3389/fviro.2021.693439 [DOI] [Google Scholar]

[pone.0277276.ref003] 3.Danforth ME, Fischer M, Snyder RE, Lindsey NP, Martin SW, Kramer VL. Characterizing areas with increased burden of West Nile Virus disease in California, 2009–2018. Vector Borne Zoonotic Dis. 2021. Aug;21(8):620–627. doi: 10.1089/vbz.2021.0014 Epub 2021 Jun 2. ; PMCID: PMC8380797. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref004] 4.Ronca SE, Ruff JC, Murray KO. A 20-year historical review of West Nile virus since its initial emergence in North America: Has West Nile virus become a neglected tropical disease? PLoS Negl Trop Dis. 2021; 15(5): e0009190. doi: 10.1371/journal.pntd.0009190 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref005] 5.Fredericks AC, Russell TA, Wallace LE, Davidson AD, Fernandez-Sesma A, Maringer K Aedes aegypti (Aag2)-derived clonal mosquito cell lines reveal the effects of pre-existing persistent infection with the insect-specific bunyavirus Phasi Charoen-like virus on arbovirus replication. PLoS Negl Trop Dis 2019;13(11): e0007346. doi: 10.1371/journal.pntd.0007346 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref006] 6.Bhatt S, Gething PW, Brady OJ, Messina JP, Farlow AW, Moyes CL, et al. The global distribution and burden of dengue. Nature. 2013. Apr 25;496(7446):504–7. doi: 10.1038/nature12060 Epub 2013 Apr 7. ; PMCID: PMC3651993. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref007] 7.Johnson K N. The Impact of Wolbachia on virus infection in mosquitoes. Viruses 2015; 7: 5705–5717; doi: 10.3390/v7112903 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref008] 8.Utarini A, Indriani C, Ahmad RA, Tantowijoyo W, Arguni E, Ansari MR, et al. AWED Study Group. Efficacy of Wolbachia-Infected mosquito deployments for the control of dengue. N Engl J Med. 2021. Jun 10;384 (23):2177–2186. doi: 10.1056/NEJMoa2030243 ; PMCID: PMC8103655. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref009] 9.Sudeep AB, Bondre VP, George R, Ghodke YS, Aher RV, Gokhale MD. Bagaza virus inhibits Japanese encephalitis and West Nile virus replication in Culex tritaeniorhynchus & Cx. quinquefasciatus mosquitoes. Indian J Med Res 2015; 142: 44–51. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref010] 10.Hobson-Peters J, Yam AWY, Lu JWF, Setoh YX, May FJ, et al. A new insect-specific flavivirus from Northern Australia suppresses replication of West Nile virus and Murray Valley encephalitis virus in co-infected mosquito cells. PLoS ONE 2013; 8(2): e56534. doi: 10.1371/journal.pone.0056534 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref011] 11.Öhlund P., Lundén H. & Blomström AL. Insect-specific virus evolution and potential effects on vector competence. Virus Genes 55, 127–137 (2019). doi: 10.1007/s11262-018-01629-9 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref012] 12.Elrefaey AM, Abdelnabi R, Rosales Rosas AL, Wang L, Basu S, Delang L. Understanding the mechanisms underlying host restriction of insect-specific viruses. Viruses. 2020. Aug 31;12(9):964. doi: 10.3390/v12090964 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref013] 13.Ramos-Nino ME, Fitzpatrick DM, Tighe S, Eckstrom KM, Hattaway LM, Hsueh AN, et al. High prevalence of Phasi Charoen-like virus from wild-caught Aedes aegypti in Grenada, W.I. as revealed by metagenomic analysis. PLoS One. 2020. Jan 31;15(1):e0227998. doi: 10.1371/journal.pone.0227998 ; PMCID: PMC6993974. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref014] 14.Zhang X, Huang S, Jin T, Lin P, Huang Y, Wu C, et al. Discovery and high prevalence of Phasi Charoen-like virus in field-captured Aedes aegypti in South China. Virology. 2018. Oct; 523:35–40. doi: 10.1016/j.virol.2018.07.021 [DOI] [PubMed] [Google Scholar]

[pone.0277276.ref015] 15.Barraud PJ. The fauna of British India, including Ceylon and Burma. Diptera.Vol V. Family Culicidae. Tribes Megarhinini and Culicini. London: Taylor and Francis; 1934. [Google Scholar]

[pone.0277276.ref016] 16.Xiao P, Han J, Zhang Y, Li C, Guo X, Wen S, et al. Metagenomic Analysis of Flaviviridae in mosquito viromes isolated from Yunnan Province in China reveals genes from dengue and Zika viruses. Front Cell Infect Microbiol. 2018;8:359. doi: 10.3389/fcimb.2018.00359 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref017] 17.Chrzastek K, Lee DH, Smith D, Sharma P, Suarez DL, Pantin-Jackwood M, et al. Use of Sequence-Independent, Single-Primer-Amplification (SISPA) for rapid detection, identification, and characterization of avian RNA viruses. Virology. 2017. Sep; 509: 159–166. doi: 10.1016/j.virol.2017.06.019 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref018] 18.He B, Li Z, Yang F, Zheng J, Feng Y, Guo H, et al. Virome profiling of bats from Myanmar by metagenomic analysis of tissue samples reveals more novel Mammalian viruses. PLoS ONE 2013, 8:e61950. doi: 10.1371/journal.pone.0061950 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref019] 19.Deng Q, Wan L, Li X, Cao X, Zhou Y, Song C. Metagenomic evidence reveals denitrifying community diversity rather than abundance drives nitrate removal in storm water bio filters amended with different organic and inorganic electron donors. Chemosphere. 2020. Oct;257:127269. doi: 10.1016/j.chemosphere.2020.127269 [DOI] [PubMed] [Google Scholar]

[pone.0277276.ref020] 20.Hameed M, Liu K, Anwar MN, Wahaab A, Li C, Di D, et al. A viral metagenomic analysis reveals rich viral abundance and diversity in mosquitoes from pig farms. Transbound Emerg Dis. 2020. Jan;67(1):328–343. doi: 10.1111/tbed.13355 [DOI] [PubMed] [Google Scholar]

[pone.0277276.ref021] 21.Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011. Oct;28(10):2731–9. doi: 10.1093/molbev/msr121 Epub 2011 May 4. ; PMCID: PMC3203626. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref022] 22.Tamura K. Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G+C-content biases. Mol Biol Evol. 1992. Jul;9(4):678–87. doi: 10.1093/oxfordjournals.molbev.a040752 . [DOI] [PubMed] [Google Scholar]

[pone.0277276.ref023] 23.Munivenkatappa A, Nyayanit DA, Yadav PD, Rangappa M, Patil S, Majumdar T, et al. Identification of Phasi Charoen-Like Phasivirus in field collected Aedes aegypti from Karnataka State, India. Vector Borne Zoonotic Dis. 2021;21(11):900–909. doi: 10.1089/vbz.2021.0011 Epub 2021 Sep 14. [DOI] [PubMed] [Google Scholar]

[pone.0277276.ref024] 24.Shi C, Beller L, Deboutte W, Yinda KC, Delang L, Vega-Ru´a A, et al. Stable distinct core eukaryotic viromes in different mosquito species from Guadeloupe, using single mosquito viral metagenomics. Microbiome. 2019; doi: 10.1186/s40168-019-0734-2 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref025] 25.Chandler JA, Thongsripong P, Green A, Kittayapong P, Wilcox BA, Schroth GP, et al. Metagenomic shotgun sequencing of a Bunyavirus in wild-caught Aedes aegypti from Thailand informs the evolutionary and genomic history of the Phleboviruses. Virology. 2014; doi: 10.1016/j.virol.2014.06.036 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref026] 26.Walker T, Moriera LA. Can Wolbachia be used to control malaria? Mem Inst Oswaldo Cruz, Rio de Janeiro, 2011; Vol. 106 (Suppl. I): 212–217. doi: 10.1590/s0074-02762011000900026 [DOI] [PubMed] [Google Scholar]

[pone.0277276.ref027] 27.Moreira LA, Iturbe-Ormaetxe I, Jeffery JA, Lu G, Pyke AT, Hedges LM, et al. A Wolbachia symbiont in Aedes aegypti limits infection with dengue, Chikungunya, and Plasmodium. Cell. 2009;139: 1268–1278. [DOI] [PubMed] [Google Scholar]

[pone.0277276.ref028] 28.Glaser RL, Meola MA. The native Wolbachia endosymbionts of Drosophila melanogaster and Culex quinquefasciatus increase host resistance to West Nile virus infection. PLoS ONE. 2010; 5: e11977. doi: 10.1371/journal.pone.0011977 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref029] 29.Krupovic M, Ghabrial SA, Jiang D, Varsani A. Genomoviridae: a new family of widespread single-stranded DNA viruses. Arch Virol. 2016. Sep;161(9):2633–43. doi: 10.1007/s00705-016-2943-3 Epub 2016 Jun 24. . [DOI] [PubMed] [Google Scholar]

[pone.0277276.ref030] 30.Cherian SS, Gunjikar RS, Banerjee A, Kumar S, Arankalle VA. Whole genomes of Chandipura virus isolates and comparative analysis with other rhabdoviruses. PLoS One. 2012;7(1):e30315. doi: 10.1371/journal.pone.0030315 Epub 2012 Jan 17. ; PMCID: PMC3260278. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref031] 31.Tavares-Neto J, Travassos da Rosa AP, Ataide M, Morais-Souza H, Vasconcelos P, Travassos da Rosa J (1990) Frequency of neutralizing antibodies to the vesiculovirus Piry, in blood donors of Uberaba, Minas Gerais, Brazil. Rev Inst Med Trop Sao Paulo 32:211–214. [PubMed] [Google Scholar]

[pone.0277276.ref032] 32.Zucherato VS, Giovanetti M, Costa LOA, Krause LMF, Alves DCC, Moreira RMA, et al. Molecular identification of the emerging Human Gemykibivirus-2 (HuGkV-2) among Brazilian blood donors. Transfus Apher Sci. 2022. Jul 26:103516. doi: 10.1016/j.transci.2022.103516 Epub ahead of print. . [DOI] [PubMed] [Google Scholar]

[pone.0277276.ref033] 33.de Sousa AA, Reis R, Bento-Torres J, Trevia N, Lins NA, Passos A, et al. (2011) Influence of enriched environment on viral encephalitis outcomes: behavioral and neuropathological changes in albino Swiss mice. PLoS One 6:e15597. doi: 10.1371/journal.pone.0015597 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref034] 34.Cunha MDP, Ioshino RS, Costa-da-Silva AL, Petersen V, Capurro ML, Zanotto PMA. A Metagenomic Approach Identified a Novel Phasi Charoen-Like virus co-infecting a chikungunya virus-Infected Aedes aegypti mosquito in Brazil. Microbiol Resour Announc. 2020. Jul 30;9(31):e01572–19. doi: 10.1128/MRA.01572-19 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277276.ref035] 35.Goenaga S, Goenaga J, Boaglio ER, Enria DA, Levis SDC. Superinfection exclusion studies using West Nile virus and Culex flavivirus strains from Argentina. Mem Inst Oswaldo Cruz. 2020. Jun 3;115:e200012. doi: 10.1590/0074-02760200012 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Abundance of Phasi-Charoen-like virus in Aedes aegypti mosquito populations in different states of India

Kavita Lole

Ashwini Ramdasi

Sucheta Patil

Shivani Thakar

Amol Nath

Onkar Ghuge

Abhranil Gangopadhayya

Anakkathil B Sudeep

Sarah Cherian

Roles

Abstract

Introduction

Materials and methods

(i) Mosquito collection and processing

Fig 1. Geo-reference map of locations from where the mosquitoes were collected.

Table 1. Primers used in the study.

(ii) Next generation sequencing based Aedes aegypti virome analysis using Oxford Nanopore technology

Mosquito homogenization and sample processing

Viral RNA enrichment

Optimization of the workflow for NGS based virome analysis

Viral RNA extraction and library preparation

Reverse transcription and double strand cDNA synthesis

Sequence-Independent Single-Primer Amplification (SISPA)

Library preparation and sequencing on Oxford Nanopore MinION Mk1B sequencer

Basecalling and data QC

Metagenomic classification

Confirmation of presence of PCLV with conventional RT-PCR and sequencing

Vertical transmission of PCLV

Phylogenetic analysis

Results

Optimization of library preparation for metagenome analysis

Metagenomic virome analysis of field caught Aedes aegypti mosquitoes

Table 2. Classified reads after classification against a database containing human and viral genomes.

Table 3. Species identified with minimum 50 reads.

Confirmation of the presence of PCLV in Aedes aegypti mosquitoes by conventional RT-PCR and sequence analysis

Fig 2.

Detection of PCLV in Aedes aegypti mosquitoes collected from other states of India

Table 4. Percent Nucleotide identities of PCLV S segment sequences from various life cycle stages of Ae. aegypti mosquitoes collected from different parts of India compared to PCLV sequences across the world.

Transovrial transmission of PCLV in Aedes aegypti

Fig 3. Phylogenetic tree for PCLV S segment sequences.

Discussion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Humberto Lanz-Mendoza

Roles

Author response to Decision Letter 0

Decision Letter 1

Humberto Lanz-Mendoza

Roles

Acceptance letter

Humberto Lanz-Mendoza

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases