Deciphering the LRRK code: LRRK1 and LRRK2 phosphorylate distinct Rab proteins and are regulated by diverse mechanisms

Reagents

[γ-³²P]ATP was purchased from PerkinElmer. HG-10-102-01, MLi-2, GSK2578215A, LRRK2-IN1, MRT67307, GDC0941, AG1478, BID1870, H-89, PD0325901, UO1216, Rapamycin and Phos-tag acrylamide were all synthesized by Natalia Shpiro (University of Dundee). Phos-tag acrylamide stocks are stored in aliquots at −80°C and working stocks are stored for a few weeks at 5 mM aqueous solution at 4°C in opaque tubes given the photo-sensitive nature of this reagent. iN04 was purchased from ChemBridge Corporation (#7989904). Full-length recombinant human LRRK2[G2019S] was purchased from Invitrogen (#A15202). GZD-824 was purchased from Cayman Chemical (#21508) and calyculin A (#ab141784) was purchased from Abcam, Inc. Phorbol 12-myristate 13-acetate (PMA) (#P8139), interleukin-1A (#I2778), oligomycin (#75351), antimycin A (#A8674), AICAR (#A9978) and forskolin (#F6886) were all purchased from Sigma–Aldrich. Human EGF (#8916), and human IGF-1 (#3093) were purchased from cell signaling technology (CST). PKC-specific inhibitor GO6983 was purchased from Selleckchem (#S2911). ON-TARGETplus SMARTpool human LRRK1 (#L-005320-00-0005), human LRRK2 (#L-049666-00-0005) and non-targeting control pool (#D-001810-10-20) siRNA were purchased from Horizon Discovery.

Plasmids

The following cDNA constructs were used for transfections: HA-empty vector (DU49303), HA-Rab10 (DU44250), HA-Rab8A (DU35414), HA-Rab7A wt (DU24784), HA-Rab7A[Q67L] (DU24813), HA-Rab29 (DU50222), GFP-Empty (DU44062), GFP-Rab7A wt (DU24785), GFP-Rab7A[S72A] (DU24814), GFP-LRRK2 wt (DU48062), GFP-LRRK2[D2017A] (DU48063), GFP-LRRK1 wt (DU30382), GFP-LRRK1[D1409A] (DU67084), GFP-LRRK1 [K746G] (DU67083), GFP-LRRK1[Y971F] (DU67289), GFP-LRRK1[K746G + Y971F] (DU66249), GFP-LRRK1[F1022C] (DU67082), GFP-LRRK1[G1411S] (DU67099), GFP-LRRK1[E929*] (DU66390), GFP-LRRK1[E929K] (DU66384), GFP-LRRK1[E929Q] (DU66391), GFP-LRRK1[Y971C] (DU66385), GFP-LRRK1[I1412F] (DU66395), GFP-LRRK1[E1980A-FS] (DU68320), FLAG-LRRK1[D1409A] (DU17400), FLAG-LRRK1[K746G] (DU67104), GFP-RILP (DU27496), HA-PPM1H wt (DU62789), HA-PPM1H[H153D] (DU62928), HA-PPM1J wt (DU68077), HA-PPM1J[H160D] (DU68170), HA-PPM1M wt (DU68124), and HA-PPM1M[H127D] (DU68165). These are available from MRC PPU Reagents and Services (https://mrcppureagents.dundee.ac.uk/). DNA constructs were amplified in Escherichia coli DH5α and purified using a Hi-Speed Plasmid Maxi Kit (Qiagen).

Generation of rabbit polyclonal pSer72 Rab7A

Rabbit immunization and rabbit antibody generation were performed by Abcam, Inc. (Burlingame, CA). The rabbits were immunized with peptides C-Ahx-AGQERFQS*LGVAFYR-amide and Ac-AGQERFQS*LGVAFYR-Ahx-C. Three subcutaneous injections were performed using the KLH immunogens, followed by two subcutaneous injections using the ovalbumin immunogens. At the time of each injection, an immunogen aliquot was thawed and combined with Freund's Complete (initial immunization) Adjuvant or Freund's incomplete Adjuvant (for the subsequent injections). Serum bleeds were obtained after the fourth and fifth immunizations. Antibodies were affinity-purified using the phosphorylated epitopes as a positive selection and also passed through a column containing the dephosphorylated peptide as a negative selection step. The affinity-purified antibodies were evaluated in parallel with serum. The subsequent rabbit polyclonal antibodies were diluted in 5% (by mass) BSA (bovine serum albumin) in TBST Buffer (20 mM Tris pH 7.5, 0.15 M NaCl and 0.1% (by vol) Tween-20) and used for immunoblotting analysis at a final concentration of 1 µg/ml. The antibody was generated by The Michael J. Fox Foundation's research tools program in partnership with Abcam. Development of a monoclonal antibody is underway. Please contact tools@michaeljfox.org with questions.

Antibodies

The sheep polyclonal antibodies for LRRK1 (sheep number S405C, second bleed), total Akt (sheep number S695B, third bleed), PINK1 (suitable for immunoblot) (sheep number S086D, third bleed), PINK1 (suitable for immunoprecipitation) (sheep number DA039, third bleed), Rab3A (sheep number SA098, second Bleed) and Rab43 (sheep number SA135, sixth bleed) were generated by MRC Reagents and Services (https://mrcppureagents.dundee.ac.uk/). anti-LRRK1 was produced by immunization with C-terminal LRRK1 protein (residues 1695-end; GST tag cleaved) followed by three further injections 28 days apart, with bleeds performed seven days after each injection. Antibodies were affinity-purified from serum using LRRK1 antigen. For immunoblotting analysis, all sheep polyclonal antibodies were diluted in 5% (by mass) milk in TBST buffer. Rabbit monoclonal phospho-Ser935 LRRK2 (UDD2) was expressed and purified at University of Dundee as described previously [35]. The following antibodies were obtained from the indicated suppliers. Rabbit monoclonal MJFF-pRab10 (Thr73) (#ab230261, Abcam, Inc. [36]), rabbit monoclonal MJFF-pRab8 (Thr72) (#ab230260, Abcam, Inc. [36]), mouse monoclonal MJFF-total Rab10 antibody (#0680-100/Rab10-605B11, nanotools [36]), mouse monoclonal anti-LRRK2 (#75-253, NeuroMab), mouse monoclonal anti-Rab8A (#WH0004218M2, Sigma–Aldrich), mouse anti-α-Tubulin (#2144, Cell Signaling Technologies (CST)), rabbit polyclonal pERK1/2 (T202, Y204) (#9101, CST), rabbit monoclonal pEGFR (Y1173) (#4407, CST), rabbit monoclonal pAMPK (Thr172) (#4188, CST), mouse monoclonal total AMPK (CST, #2793), rabbit polyclonal pACC (Ser79) (CST, #3661), rabbit monoclonal pVASP (Ser157) (#84519, CST), rabbit polyclonal p-Ser PKC Substrate (#2261, CST), rabbit monoclonal pTBK1 (Ser172) (#5483, CST), rabbit polyclonal total TBK1 (#3013, CST), rabbit monoclonal pP105 (Ser933) (#4806, CST), rabbit monoclonal pP38 (Thr180, Tyr182) (#4631, CST), mouse monoclonal anti-Total Ub (#646302, BioLegend), mouse monoclonal anti-OPA-1 (#612607, BD Biosciences), mouse anti-GAPDH (#sc-32233, Santa Cruz Biotechnology), and rabbit anti-GFP (#PABG1, Chromotek), Rat anti-HA (#ROAHAHA, Sigma), mouse monoclonal anti-Rab7A (#R8779, Sigma), rabbit polyclonal anti-pAkt (Ser473) (#9271, CST), mouse monoclonal VPS35 (#SMC-605D, StressMarq Biosciences). Rabbit monoclonal anti-Total Rab35 (clone ID: 25) was kindly provided by Abcam, Inc. and will be available soon. Rabbit polyclonal pUbiquitin (Ser65) (21st Century Biochemicals Inc.) was kindly provided by the Muqit lab and described previously [37]. All antibodies were diluted in 5% (by mass) BSA (bovine serum albumin) in TBST Buffer and used for immunoblotting analysis at a final concentration of 1 µg/ml.

Mice

Heterozygous LRRK1 (wild type/knock-out) mice were purchased from the JAX laboratory (https://www.jax.org/strain/016120). Mice were maintained under specific pathogen-free conditions at the University of Dundee (U.K.). All animal studies were ethically reviewed and carried out in accordance with Animals (Scientific Procedures) Act 1986 and regulations set by the University of Dundee and the U.K. Home Office. Animal studies and breeding were approved by the University of Dundee ethical committee and performed under a U.K. Home Office project license. Mice were multiply housed at an ambient temperature (20–24°C) and humidity (45–55%) and maintained on a 12 h light/12 h dark cycle, with free access to food (SDS RM No. 3 autoclavable) and water.

LRRK1 KO primary MEF generation

Wild-type, heterozygous, and homozygous LRRK1 knock-out mouse embryonic fibroblasts (MEFs) were isolated from littermate-matched mouse embryos at day E12.5 resulting from crosses between heterozygous wild-type/KO mice as described previously [38]. Genotyping of mice, embryos and MEFs was performed by PCR using genomic DNA, Primer 1 (12041 com: 5′ TCACTGGAAGGCAAGGACAGTTGG 3′), Primer 2 (12042 mut rev: 5′ CCAACACATCCAACCTTTTCTTTGC 3′), and Primer 3 (12043 wt rev: 5′ CAGGATGCTTCACAGACAGG 3′). The wild type sequence leads to a 368 bp species whilst the knock-out produces a 220 bp species.

Cell culture and lysis

HEK293, HaCaT and HeLa cells were purchased from ATCC and cultured in DMEM containing 10% (by vol) fetal calf serum, 2 mM l-glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin. MEFs were grown in DMEM containing 10% (by vol) fetal calf serum, 2 mM l-glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin supplemented with non-essential amino acids and 1 mM sodium pyruvate. All cells were incubated at 37°C, 5% CO₂ (by vol) in a humidified atmosphere and regularly tested for mycoplasma contamination. Cells were lysed in an ice-cold lysis buffer containing 50 mM Tris–HCl, pH 7.4, 1% Triton X-100 (by vol), 10% glycerol (by vol), 150 mM NaCl, 1 mM sodium orthovanadate, 50 mM NaF, 10 mM 2-glycerophosphate, 5 mM sodium pyrophosphate, 1 µg/ml microcystin-LR, and complete EDTA-free protease inhibitor cocktail (Roche). Lysates were clarified by centrifugation at 20,800g at 4°C for 10 min and supernatant protein concentrations quantified using the Bradford assay.

Transient overexpression experiments

Twenty-four hours prior to transfection, cells were seeded into six-well plates at 3 × 10⁵ cells/well. Cells were transfected using Polyethylenimine [39] employing 1.6 µg of LRRK1/LRRK2 plasmids, 0.4 µg of the Rab protein plasmid. For phosphatase experiments, cells were transfected with 1.0 µg of LRRK1 plasmids, 0.25 µg of Rab protein plasmid and 0.5 µg of phosphatase plasmids. Twenty-four hours post-transfection, cells were treated with the indicated concentrations of inhibitors dissolved in DMSO (0.1% (by vol) final concentration) for 2 h prior to cell lysis. An equivalent volume of DMSO was added to cells not treated with an inhibitor.

siRNA knockdown experiments

HaCaT cells were seeded in six-well plates at 2 × 10⁵ cells/well. After 24 h cells were either left untransfected or transfected using 7.5 µl Lipofectamine RNAi Max (Thermofisher, #13778150) and 10 nM of LRRK1, LRRK2 or non-targeting control siRNA per well. Cells were then cultured for a further 60 h. Cells were subsequently deprived of serum for 16 h and then treated in the presence or absence of 50 ng/ml EGF for 15 min and then lysed.

HA-Rab7A and GFP-RILP immunoprecipitation

Cells were transiently transfected as described above. Twenty-four hours post transfection, cells were harvested in lysis buffer and lysates clarified by centrifugation at 17,000g for 10 min at 4°C. An amount of 500 µg of whole-cell lysate was incubated with 15 µl of packed beads of either nanobody anti-GFP binder-Sepharose or anti-HA frankenbody-Sepharose beads (generated by the MRC PPU Reagents and Services) for 1 h. Bound complexes were recovered by washing the beads three times with 50 mM Tris–HCl pH 7.5 150 mM NaCl before eluting with 2× SDS–PAGE sample buffer supplemented with 0.1% (by vol) 2-mercaptoethanol. The samples were denatured at 70°C for 10 min and the resin was separated from the sample by centrifugation through a 0.22 µm Spin-X® column (CLS8161, Sigma).

PINK1 immunoprecipitation

For immunoprecipitation of endogenous PINK1, primary MEFs were first treated either with 1 µM oligomycin and 10 µM antimycin A or with DMSO for 24 h. Subsequently, 500 µg of whole-cell lysate was incubated overnight at 4°C with 10 µg of PINK1 antibody (DA039, MRC PPU reagents and Services) coupled to Protein A/G beads (10 µl of beads per reaction, Amintra). The immunoprecipitants were washed three times with lysis buffer containing 150 mM NaCl and eluted by resuspending in 20 µl of 2× LDS sample buffer and incubating at 37°C for 15 min under constant shaking (2000 rpm) followed by the addition of 0.1% (by vol) 2-mercaptoethanol.

Ubiquitin capture assay

For ubiquitin capture, primary MEFs were treated either with 1 µM Oligomycin and 10 µM Antimycin or with DMSO for 24 h and subsequently 500 µg of whole-cell lysate was used for pull-down with HALO-MultiDsk beads. In particular, MultiDsk (5× UBA domain of Dsk2 from yeast) was expressed as N-terminal GST and HALO tag recombinant protein in E. coli BL21 DE3, affinity purified on GSH–Sepharose. This was recovered by incubating the resin with TEV-protease for 3 h and dialyzed into 50 mM HEPES, 150 mM NaCl, 1 mM DTT). HALO-MultiDsk (2 mg) was incubated with 200 µl of HaloLink resin (Promega) in binding buffer (50 mM Tris–HCl pH 7.5, 150 mM NaCl, 0.05% (by vol) NP-40) overnight at 4°C under agitation. HALO-TUBE beads (20 µl) were then added to whole-cell lysates from MEFs lysed as described above except lysis buffer supplemented with 100 mM chloroacetamide to inhibit cysteine-dependent deubiquitylating enzymes and incubated at 4°C overnight under agitation. Beads were washed three times with lysis buffer containing 150 mM NaCl and eluted by resuspending in 20 µl 2× LDS sample buffer and incubating at 37°C for 15 min under constant shaking (2000 rpm) followed by the addition of 0.1% (by vol) 2-mercaptoethanol.

Immunoblotting

Lysates were incubated with a quarter of volume or 4× SDS–PAGE sample buffer [50 mM Tris–HCl, pH 6.8, 2% (by mass) SDS, 10% (by vol) glycerol, 0.02% (by mass) Bromophenol Blue and 1% (by vol) 2-mercaptoethanol] (Novex) and heated at 95°C for 5 min. For normal SDS–PAGE, 10–20 µg samples were loaded on to 4–12% Bis-tris gradient gels and electrophoresed at 180 V for 90 min. Proteins were transferred onto nitrocellulose membranes at 90 V for 90 min on ice in transfer buffer [48 mM Tris–HCl, 39 mM glycine and 20% (by vol) methanol]. Transferred membranes were blocked with 5% (by mass) milk in TBST Buffer at room temperature for 60 min. Membranes were then incubated with primary antibodies diluted in blocking buffer overnight at 4°C. After washing in TBST, membranes were incubated at room temperature for 1 h with near-infrared fluorescent IRDye antibodies (LI-COR) diluted 1 : 10 000 in TBST and developed using the LI-COR Odyssey CLx Western Blot imaging system and signal quantified using the Image Studio software

Phostag immunoblot analysis

Phos-tag SDS–PAGE was carried out as described previously [18]. Samples were supplemented with 10 mM MnCl₂ before loading. Gels for Phos-tag SDS–PAGE consisted of a stacking gel [4% (by mass) acrylamide, 125 mM Tris–HCl, pH 6.8, 0.1% (by mass) SDS, 0.2% (by vol) N,N,N′,N′-tetramethylethylenediamine (TEMED) and 0.08% (by mass) ammonium persulfate (APS)] and a separating gel [12% (by mass) acrylamide, 375 mM Tris–HCl, pH 8.8, 0.1% (by mass) SDS, 75 mM Phos-tag acrylamide, 150 mM MnCl₂, 0.1% (by vol) TEMED and 0.05% (by mass) APS]. An amount of 10–30 µg of samples were loaded and electrophoresed at 70 V for 30 min and at 120 V for 2 h in running buffer [25 mM Tris–HCl, 192 mM glycine and 0.1% (by mass) SDS]. Gels were washed in transfer buffer containing 10 mM EDTA and 0.05% (by mass) SDS three times for 10 min, followed by one wash in transfer buffer containing 0.05% (by mass) SDS for 10 min. Proteins were transferred onto nitrocellulose membranes (Amersham Protran 0.45 µm NC; GE Healthcare) at 100 V for 180 min on ice in the transfer buffer without SDS/EDTA. Subsequent immunoblotting was performed as previously described.

Immunofluorescence

For analysis of Rab29 co-localization with LRRK1 and LRRK2, HeLa cells were seeded in six-well plates on glass coverslips (VWR, 631-0125; square 22 × 22 mm thickness 1.5). Cells were transfected using Polyethylenimine method [39] employing 1.6 µg of LRRK1/LRRK2 plasmids and 0.4 µg of either HA-Rab29 or HA-empty. Twenty-four hours post transfection cells were fixed with 4% (by vol) paraformaldehyde at room temperature for 10 min. Next, cells were permeabilized using 1% (by vol) NP-40 in PBS for 10 min followed by blocking with 1% (by mass) BSA in PBS. Slides were incubated with mouse monoclonal anti-HA (#ab18181, Abcam, Inc.) primary antibody, diluted 1 : 1000 in 1% (by mass) BSA in PBS buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, 1.8 KH₂PO₄, pH 7.4) for 1 h at room temperature followed with three times for 15 min washes with 0.2% (by mass) BSA in PBS (no antibody used for GFP, fluorescence of GFP was measured directly). Then slides were incubated with Alexa Fluor® 405 goat anti-mouse secondary antibody (Invitrogen A-31553) diluted 1 : 500 and HCS CellMask™ Deep Red Stain (Invitrogen, H32721) at 0.5 µg/ml dilution in 1% (by mass) BSA in PBS for 1 h. Slides were washed three times for 15 min with 0.2% (by mass) BSA in PBS and rinsed with distilled water just before mounting. VECTASHIELD® HardSet™ Antifade Mounting Medium (Vector Laboratories, H-1400) was used to mount the coverslips on glass slides (VWR, 631-0117). Slides were then imaged using Leica TCS SP8 MP Multiphoton Microscope using a 40× oil immersion lens choosing the optimal imaging resolution with 1-pixel size of 63.3 nm × 63.3 nm.

Expression and purification of Rab proteins

4 × 500 ml of Lysogeny broth containing 100 µg/ml ampicillin antibiotic was inoculated with a single colony of BL21-CodonPlus(DE3)-RIPL strain of E. coli transformed with plasmids encoding for the expression of His-SUMO-Rab7A[wt] (Plasmid DU24781), His-SUMO-Rab7A[S72A] (DU24808) or His-SUMO-Rab10[wt] (Plasmid DU51062). Bacteria were cultured at 37°C to an OD₆₀₀ of 0.4–0.6, then temperature reduced to 15°C and protein expression was induced by addition of Isopropyl β-d-1-thiogalactopyranoside at 250 µM. Cells were cultured for 16 h before harvesting by centrifugation at 4200 × g for 20 min at 4°C. The pellet was resuspended in 200 ml ice cold E. coli lysis buffer [50 mM Tris–HCl pH7.5, 100 mM NaCl, 1 mM MgCl₂, 10 µM GDP, 2 mM TCEP (tris(2-carboxyethyl)phosphine)]. Cells were lysed using a cell disruptor (passing sample through twice) and extracts clarified by centrifugation at 15 000 rpm for 20 min at 4°C. Subsequent supernatants were run on 15 ml of Cobalt-Agarose resin (Amintra Cobalt NTA Affinity Resin, Expedeon), previously equilibrated in E. coli lysis buffer, at 4°C for 90 min. The column was then washed with 20 column volumes of High Salt Wash Buffer [50 mM Tris–HCl pH7.5, 500 mM NaCl, 1 mM MgCl₂, 10 µM GDP, 2 mM TCEP] until no unbound protein was present in the flow-through. The column was then washed with five column volumes of Low Salt Wash buffer [50 mM Tris/ HCl pH7.5, 150 mM NaCl, 2 mM MgCl₂, 10 µM GDP), 2mM TCEP]. His-SENP1 (DU39129) (1 : 30 dilution) was then added to the column overnight at 4°C to cleave the His-SUMO tag. Cleaved protein was collected and subjected to gel filtration on a Superdex 75 Hi load column, previously equilibrated in Equilibration buffer [50 mM Tris–HCl pH 7.5, 150 mM NaCl, 2 mM MgCl₂, 1 mM GTP, 0.5 mM TCEP]. An amount of 0.2 ml fractions were collected at a flow rate of 0.2 ml/min, with protein-containing fractions pooled, subjected to spin concentration using an Amicon Ultra 15 10 KDa and finally snap frozen.

Cloning, expression and purification of LRRK1

The DNA coding for the human LRRK1 residues 28 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGGAGACGCTTAACGGTGCCGGGGAC and the reverse primer TATCCACCTTTACTGCTTTACCTTCTCTTGCGAGTGCAAGC. The T4 polymerase-treated amplicon was inserted into the transfer vector pFB-6HZB (SGC) by ligation-independent cloning. The resulting plasmid was utilized for the generation of recombinant Baculoviruses according to the Bac-to-Bac expression system protocol (Invitrogen). Exponentially growing Sf9 cells (2 × 10⁰⁶ cells/ml in Lonza Insect-XPRESS medium) were infected with high-titre Baculovirus suspension. After 66 h of incubation (27°C and 90 rpm), cells were harvested by centrifugation. The expressed protein construct contained an N-terminal His₆-Z-tag, cleavable with TEV protease. For LRRK1 purification, the pelleted Sf9 cells were washed with PBS, re-suspended in lysis buffer (50 mM HEPES pH 7.4, 500 mM NaCl, 20 mM imidazole, 0.5 mM TCEP, 5% (by vol) glycerol) and lysed by sonication. The lysate was cleared by centrifugation and loaded onto a Ni NTA column. After vigorous rinsing with lysis buffer the His₆-Z-tagged protein was eluted in lysis buffer containing 300 mM imidazole. Immediately thereafter, the eluate was diluted with buffer containing no NaCl, to reduce NaCl to 250 mM and loaded onto an SP-Sepharose column. His₆-Z-TEV-LRRK1 was eluted with a 250 mM to 2.5 M NaCl gradient and treated with TEV protease overnight to cleave the His₆-Z-tag. Contaminating proteins, the cleaved tag, uncleaved protein and TEV protease were removed by another combined SP-Sepharose Ni NTA step. Finally, LRRK1 was concentrated and subjected to gel filtration in storage buffer (20 mM HEPES pH 7.4, 150 mM NaCl, 0.5 mM TCEP, 5% glycerol) using an AKTA Xpress system combined with an S200 gel filtration column. The final yield as calculated from UV absorbance was 0.1 mg/L.

LRRK1 and LRRK2 in vitro kinase assays

Kinase assays were set in a 20 µl final reaction mixture containing purified Rab proteins (2 µM, 1 µg), recombinant LRRK1 (20 nM, 100 ng, residues 28-2015) or full-length LRRK2[G2019S] (20 nM, 100 ng) and 50 mM Tris–HCl pH 7.5, 0.1 mM EGTA, 10 mM MgCl₂ and 1 mM ATP. The kinase reactions were carried out at 30°C for the indicated times and reactions terminated by the addition of 4× SDS–PAGE sample buffer containing 1% (by vol) 2-mercaptoethanol. Twenty percent of total reaction volume was used for Phos-tag Coomassie staining analysis; <10% was used for conventional immunoblot analysis.

Phosphosite identification by MS and Edman sequencing

The phosphorylation sites on Rab7A were identified as previously described [16]. Purified Rab7A (12.5 µM, 7.5 µg) was phosphorylated using recombinant full-length wild type LRRK1 (80 nM, 400 ng) in a buffer containing 50 mM Tris–HCl pH 7.5, 10 mM MgOAc, 0.1 mM [γ-³²P]ATP (specific activity: ∼3000 Ci/pmol) for 1 h at 30°C. The reactions were stopped by the addition of 4× SDS–PAGE sample buffer containing 1% (by vol) 2-mercaptoethanol, and samples were subjected to electrophoresis on a 4–12% SDS–PAGE gels. The gels were was stained with Coomassie blue and the band corresponding to Rab7A was excised and washed with water (10 min) and subsequently subjected to two rounds of washes with 100% acetonitrile and 50 mM Tris–HCl pH 8.0 (5 min per wash). Gel pieces were then reduced by incubation in 5 mM DTT in 50 mM Tris–HCl pH 8.0 at 65°C for 20 min. This was followed by alkylation of the samples by addition of 20 mM iodoacetamide in 50 mM Tris–HCl pH 8.0 for 20 min. The gel pieces were then washed with 100% acetonitrile, 50 mM Triethylammonium bicarbonate and again 100% acetonitrile (5 min each). Any remaining acetonitrile was removed with a pipette before adding trypsin (5 mg/ml in 50 mM Triethylammonium bicarbonate in a volume sufficient to cover the gel pieces) for overnight digestion at 30°C. The resulting tryptic peptides were extracted from the gel pieces by addition of 100% acetonitrile. These were subsequently resuspended in 0.1% (by vol) trifluoroacetate (TFA) in 5% (by vol) acetonitrile before being separated on a reverse-phase HPLC Vydac C18 column (Separations Group) with an on-line radioactivity detector. The column was equilibrated in 0.1% (v/v) trifluoroacetic acid and developed with a linear acetonitrile gradient at a flow rate of 0.2 ml/min. Fractions (0.1 ml each) were collected and analyzed for ³²P radioactivity by Cerenkov counting with a tricarb scintillation counter. All the identified phosphopeptide fractions were analyzed by liquid chromatography (LC)–MS/MS using a Thermo U3000 RSLC nano liquid chromatography system (Thermo Fisher Scientific) coupled to a Thermo LTQ-Orbitrap Velos mass spectrometer (Thermo Fisher Scientific) to determine the primary sequence of the phosphopeptides. Data files were searched using Mascot (www.matrixscience.com) run on an in-house system against a database containing the appropriate Rab sequences, with a 10 ppm mass accuracy for precursor ions, a 0.6 Da tolerance for fragment ions, and allowing for Phospho (ST), Phospho (Y), Oxidation (M), and Dioxidation (M) as variable modifications. Individual MS/MS spectra were inspected using Xcalibur 2.2 (Thermo Fisher Scientific), and Proteome Discoverer with phosphoRS 3.1 (Thermo Fisher Scientific) was used to assist with phosphosite assignment. The site of phosphorylation of ³²P-labeled peptides was determined by solid-phase Edman degradation on a Shimadzu PPSQ33A Sequencer of the peptide coupled to Sequelon-AA membrane (Applied Biosystems) as described previously [40].

In-gel digestion for LC/MS–MS

In-gel digestion and targeted mass spectrometry was performed as described [41]. Briefly, 50 µg of lysates from each of the two independent clones of LRRK1 KO and LRRK1 wt cells, as technical duplicates were reduced by adding 5 mM Dithiothreitol and incubated at 56°C for 20 min on a Thermo mixer with continuous agitation at 800 rpm. The tubes were brought to room temperature and alkylated by adding 20 mM Iodoacetamide at room temperature in the dark on a Thermomixer with continuous agitation for 20 min. The protein lysates were then resolved by SDS–PAGE. The gel was stained with colloidal Coomassie (NUPAGE), destained overnight and subjected to in-gel digestion. The region between 30 to 20 kDa was excised and destained with 200 µl, 40 mM Ammonium bicarbonate in 40% Acetonitrile buffer and incubated at room temperature on a Thermomixer with continuous agitation at 1200 rpm for 30 min. The gel pieces were completely destained by repeating the above step, then rehydrated by adding 200 µl of Acetonitrile and incubated on a Thermomixer. Acetonitrile was then removed, and slices subjected to vacuum drying for 10 min to ensure the complete Acetonitrile removal. The trypsin was prepared in 0.5% (by mass) sodium deoxycholate (final) in 20 mM TEABC buffer, 500 ng trypsin to each sample was added and kept under incubation at 37°C overnight on a Thermomixer with a continuous agitation at 1200 rpm. The tryptic peptides were extracted by adding 200 µl of extraction buffer (99% Isopropanol in 1% (by vol) TFA, incubated on a Thermomixer with an agitation at 1200 rpm for 20 min. The extraction was completed by repeating again and the eluate was directly loaded on in-house prepared SDB-RP Stage-tips and subjected to the SDC-RP clean up. Two disks were prepared by punching with 16-gauge needle and loaded on to 250 µl pipette tips. The peptide digest was loaded and centrifuged at room temperature at 2000g for 10 min. The flow through was reapplied and subsequently the stage tips were washed once with 150 µl wash buffer I (99% Isopropanol in 1% TFA) and washed again with 150 µl wash buffer II (3% Acetonitrile in 0.2% TFA). All the centrifugation was done at room temperature for 10 min. The peptides were eluted by adding 60 µl of elution buffer I (50% Acetonitrile in 1.25% Ammonium Hydroxide), Furthermore, the elution was repeated by adding 60 µl of elution buffer II (80% Acetonitrile in 1.25% Ammonium Hydroxide). All the centrifugation was done at room temperature at 1500g for 4 min. The peptide eluate was immediately snap frozen and vacuum dried for 90 min.

LC–MS/MS and data analysis

We undertook a multiplexed parallel reaction monitoring approach to identify and quantify Rab proteins phosphorylated on their effector binding motifs in wild type and LRRK1 knock-out MEFs. We synthesized heavy labeled stable isotope synthetic phosphopeptides encompassing the tryptic peptide sequences of pRab3, pRab7A, pRab8, pRab10, pRab35 and pRab43 (>98% purity, AAA analyzed from JPT Peptide Technologies, GmbH, Germany, sequences and masses listed on Supplementary File S1). An amount of 25 fmol the phospho Rab peptide mixture was spiked into the in-gel digested samples prior to loading into Evotips as described [42]. The Evotips (evosep.com, Odense, Denmark) were used according to the manufacturer. The disposable Evotips were loaded onto the EvoSep liquid chromatography (LC) system. EvoSep LC system employs a preformed gradient to ensure the focused separation of the peptides into the mass spectrometer and to minimize sample to sample carryover and overhead time between runs. The instrument was run using the ‘60 sample per day, 21 min run’ method. Peptides were separated on 8 cm analytical columns (EV-1064, Dr Maisch C18 AQ, 3 µm beads, 100 µm ID, 8 cm long). The EvoSep LC system was interfaced with QE-HFX mass spectrometer (Thermo Fisher Scientific, Bremen). The inclusion list for heavy and endogenous phosphopeptides along with the scheduled retention times for the targeted PRM method was generated using Skyline software imported directly into the QE-HFX Excalibur method. A full scan, MS1 between 300 to 800 m/z mass range was acquired at 120 000 at 200 m/z resolution and a PRM scan was acquired at 30 000 at 200 m/z resolution. The quadrupole isolation width of 0.7 m/z was set, and the peptides were fragmented using 27% normalized higher-energy collisional dissociation (HCD) by maintaining the loop count to 10 (which acquires 10 MS2 scans per duty cycle). Both the AGC target and Ion injection times were set as 3 × 10⁶ for MS1 and 1 × 10⁵ for PRM and 50 ms for MS1 and 250 ms for PRM scan. The mass spectrometry raw data were imported into Skyline version 19.1.0.193 (University of Washington, Seattle U.S.A.,) software suite [43]. Skyline automatically processes and generates the peak area values for both heavy internal standards and endogenous phosphopeptides by selecting most intense fragment ions based on the pre-generated library which is a mix of heavy phosphopeptides. The elution profiles of each phosphopeptide was further manually verified and peak area values of both internal standard and endogenous phosphopeptides were used to generate the ratio values for each phosphopeptide. These ratio values were then compared between samples derived from the wild type and LRRK1 knock-out MEFs, enabling the relative levels of pRab3 (Thr86 in Rab3A,B,D & Thr94 in Rab3C), pRab7A (Ser72), pRab8 (Thr72), pRab10 (Thr73), pRab35 (Thr72) and pRab43 (Thr82) to be quantified.

Ser72 phosphorylation of endogenous Rab7A is decreased in LRRK1 knock-out MEFs

To test whether LRRK1 might regulate the phosphorylation of Rab proteins, we generated littermate-matched wild type, heterozygous and LRRK1 homozygous knock-out mouse embryonic fibroblasts (MEFs), derived from previously described heterozygous LRRK1 knockout mice purchased from JAX laboratory (https://www.jax.org/strain/016120). To measure phosphorylation of endogenous Rab proteins in these cells, we used a combination of previously described quantitative targeted multiplex parallel reaction monitoring (PRM) mass spectrometry assays [15,41]. For this experiment, we analyzed two independent clones for each genotype, derived from separate embryos. Briefly, 50 µg of each extract was electrophoresed on an SDS–polyacrylamide gel and the region encompassing Rab proteins (20–30 kDa) was excised and digested with trypsin. A mixture of heavy labeled phosphorylated peptides that encompass the tryptic peptide of Rab3, Rab7A, Rab8, Rab10, Rab35 and Rab43 (25 fmol of each) was spiked in. The resulting sample was subjected to targeted LC–MS/MS analysis enabling the levels of basal endogenous phosphorylation of each Rab protein in wild type and LRRK1 knock-out cells to be quantified. The analysis revealed that in each of the independent clones there was a ∼4-fold decrease in the phosphopeptide encompassing Rab7A phosphorylated at Ser72 in the LRRK1 knock-out compared with wild type cells (Figure 1A, upper panel). Ser72 is the residue equivalent to the LRRK2 phosphorylation sites on Rab8A and Rab10. The levels of peptides corresponding to Rab3, Rab8, Rab10, Rab35 and Rab43 phosphorylated residues were similar in wild type and LRRK1 knock-out extracts. Immunoblot analysis revealed that the levels of total Rab7A, Rab8A, Rab10, Rab35 and Rab43 were also similar in the wild type and knock-out MEFs, though total Rab3A levels were moderately lower in one of the knock-out clones (Figure 1A, lower panel).

To further demonstrate that basal phosphorylation of Rab7A at Ser72 was reduced in LRRK1 knock-out cells, we utilized an affinity purified, phospho-specific pRab7A (Ser72) rabbit polyclonal antibody that we generated (see Materials and Methods). Using this antibody, we were able to detect endogenous Rab7A phosphorylation at Ser72 in all wild type MEF clones, that was virtually abolished in all of the LRRK1 knock-out cells (Figure 1B). We also studied LRRK1 heterozygous MEFs which displayed ∼50% lower levels of total LRRK1 and phosphorylated, compared with the wild type cells (Figure 1B). We observed that the LRRK1 deficient cells expressed similar levels of LRRK2 protein that was also similarly phosphorylated at Ser935. Treatment of MEFs with the LRRK2 MLi-2 inhibitor [44], did not impact Rab7A phosphorylation at Ser72, but consistent with previous work [45], inhibited phosphorylation of LRRK2 at Ser935 (Figure 1B). Overall, these data suggest that LRRK1 is able to phosphorylate endogenous Rab7A at Ser72.

Overexpression of LRRK1 induces phosphorylation of Rab7A but not Rab8A or Rab10

We next explored whether LRRK1 overexpression could induce phosphorylation of Rab7A at Ser72. We co-expressed wild type or kinase inactive LRRK1[D1409A] mutant with Rab7A in HEK293 cells. Immunoblot analysis of cell extracts revealed that wild type LRRK1 but not kinase inactive LRRK1[D1409A] induced significant phosphorylation of Rab7A (Figure 2A). In parallel experiments, wild type LRRK2 that was expressed at a similar level to LRRK1, did not induce phosphorylation of Rab7A (Figure 2A). We also demonstrated that wild type LRRK1 does not significantly phosphorylate Rab8A at Thr72 or Rab10 at Thr73 when overexpressed in HEK293 cells under conditions which LRRK2 efficiently phosphorylates these substrates (Figure 2A). To confirm the specificity of the pRab7A(Ser72) phospho-specific antibody, we mutated Ser72 to Ala in Rab7A, and demonstrated that no phospho-signal was detected when this protein was co-expressed with wild type LRRK1 (Figure 2B).

LRRK1 directly phosphorylates Rab7A at Ser72 in vitro

To test whether LRRK1 can phosphorylate Rab7A directly, we first expressed and purified to homogeneity recombinant LRRK1 (lacking the first 27 residues i.e. residues 28 to 2015/end) in Sf9 insect cells (Supplementary Figure S1). We also purified recombinant wild type Rab7A and Rab7A[S72A] mutant. Immunoblot analysis revealed that LRRK1 (20 nM) in the presence of MgATP, readily phosphorylated wild type Rab7A complexed to GDP (2 µM) (Figure 3A). To probe stoichiometry of Rab7A phosphorylation by LRRK1, we utilized the ‘phos-tag’ approach that has previously been exploited to resolve dephosphorylated and LRRK2 phosphorylated Rab proteins by electrophoresis [18]. This revealed that a significant proportion of the wild type Rab7A was phosphorylated by LRRK1 under the kinase assay conditions we deployed (Figure 3A). In parallel experiments, immunoblot and phos-tag analysis revealed that the Rab7A[S72A] mutant was not phosphorylated by LRRK1 (Figure 3A). We also phosphorylated wild type Rab7A with LRRK1 in the presence of γ³²P-ATP (Figure 3B) and subjected the ³²P-labeled Rab7A protein to classical trypsin digestion-phosphopeptide mapping analysis followed by Edman degradation sequencing and mass spectrometry analysis. This confirmed unambiguously that Rab7A was phosphorylated by LRRK1 at a single site, namely Ser72 (Figure 3C). We also found that LRRK1 does not phosphorylate Rab10 in vitro, and vice versa, LRRK2 does not phosphorylate Rab7A (Figure 3D). These results are consistent with a previous report that LRRK1 phosphorylates Rab7A at Ser72 in vitro [28].

Phorbol ester enhances LRRK1-mediated Rab7A phosphorylation in MEFs

As previous work had demonstrated that LRRK1 co-immunoprecipitates with components of the EGF receptor signaling pathway [24–26], we tested a range of agonists including EGF, IGF1, and phorbol esters to see whether any of these promote Rab7A phosphorylation in wild type MEFs. For each agonist we verified that it induced phosphorylation of a known component of its respective signaling pathway (Supplementary Figure S2). These experiments revealed that the phorbol ester, phorbol 12-myristate 13-acetate (PMA, 30 min, 100 ng/ml) markedly stimulated Rab7A phosphorylation (Figure 4A and Supplementary Figure S2). In contrast, none of the other agonists that we tested in MEFs increased Rab7A phosphorylation other than the potent PP1 and PP2A phosphatase inhibitor, calyculin-A (Figure 4A). In the LRRK1 knock-out cell line, PMA stimulation failed to induce Rab7A phosphorylation (Figure 4B); reduced phosphorylation of Rab7A was seen in heterozygous cells (Figure 4B). Time-course analysis revealed that PMA induces Rab7A phosphorylation after ∼5 min, with maximal phosphorylation at 40 min that then declines to lower levels by 5 h (Figure 4C). We next pre-treated wild type MEFs with a panel of well-characterized kinase inhibitors (Figure 4D and Supplementary Figure S3). Only Go-6983 [46], a general PKC inhibitor, suppressed Rab7A phosphorylation induced by PMA (Figure 4D and Supplementary Figure S3). We also studied Rab7A phosphorylation in human immortalized skin keratinocyte HaCaT cell line. EGF stimulation, but not phorbol ester, enhanced Rab7A phosphorylation (Supplementary Figure S4A) and siRNA knock-down of LRRK1 inhibited Rab7A phosphorylation induced by EGF (Supplementary Figure S4B).

PINK1 or TBK1 activation does not promote Rab7A phosphorylation in MEFs

Previous work had suggested that a PINK1–TBK1 signaling pathway was responsible for Rab7A phosphorylation in vivo, especially after short time points following mitochondrial depolarization [48,49]. To investigate whether TBK1 induces phosphorylation of Rab7A in MEFs, we stimulated cells with interleukin-1A (IL-1A) a known activator of TBK1 in MEFs [50]. We confirmed that IL-1A stimulation (15 min, 5 ng/ml) promoted TBK1 activation as judged by an increase in Ser172 phosphorylation (Figure 4E), an autophosphorylation site that is used as a reporter for TBK1 activation [51]. However, Rab7A was not significantly phosphorylated following IL-1A treatment (Figure 4E). Moreover, PMA did not promote TBK1 phosphorylation at Ser172 (Figure 4E). We also stimulated MEFs with IL-1A for up to 5 h but no significant phosphorylation of Rab7A was observed at any timepoint studied, although it could be argued that the slightest increase beyond background levels was observed at the 20 min timepoint (Supplementary Figure S5). We also treated previously reported wild type and PINK1 knock-out MEFs [47] with oligomycin (1 µM) and antimycin (10 µM) for 24 h to induce mitochondrial depolarization and activate the PINK1 protein kinase [37,52]. PINK1 kinase was stabilized and activated in wild type but not PINK1 knock-out MEFs as judged by monitoring phosphorylation of ubiquitin at Ser65 (Figure 4F). Oligomycin and antimycin also induced cleavage of OPA-1, confirming mitochondrial depolarization (Figure 4F). However, oligomycin and antimycin A failed to induce phosphorylation of TBK1 or Rab7A in these experiments (Figure 4F).

Identification of mutations that enhance LRRK1 activity

We next studied whether mutations equivalent to the common Parkinson's causing LRRK2 mutations would affect LRRK1's ability to phosphorylate Rab7A in cells. The mutants generated were LRRK1[K746G] (equivalent to LRRK2[R1441G]), LRRK1[F1022C] (equivalent to LRRK2[Y1699C]), LRRK1[G1411S] (equivalent to LRRK2[G2019S]) and LRRK1[I1412T] (equivalent to LRRK2[I2020T]) (Figure 5A,B). In addition, we also generated the previously described LRRK1[Y971F] mutant located within the COR domain (Figure 5B), reported to activate LRRK1 by blocking an inhibitory EGF receptor-mediated phosphorylation ([27,28]). In overexpression studies, we observed that the LRRK1[K746G] and LRRK1[Y971F] mutations markedly increased Rab7A phosphorylation ∼5-fold (Figure 5C). The LRRK1[I1412T] mutation enhanced Rab7A phosphorylation more moderately (∼2-fold; Figure 5C). In contrast, the LRRK1[F1022C] (equivalent to LRRK2[Y1699C]) and LRRK1[G1411S] (equivalent to LRRK2[G2019S]) displayed similar activity to wild type LRRK1 (Figure 5C). We also generated a LRRK1[K746G + Y971F] double mutant but found that this displayed similar elevated activity as the single mutants (Supplementary Figure S6).

We also analyzed the impact of two LRRK1 mutations (E929 truncation [9] and E1980A-FS [6]) reported to cause OSMD. The E1980A-FS mutation adds a 66 amino acid extension to the WD40 domain at the C-terminus (Figure 5B). These mutations block Rab7A phosphorylation in HEK293 cell overexpression assay (Figure 5D). We also tested 4 LRRK1 variants that have been reported in a SNP database (Supplementary Table S1) (https://www.ncbi.nlm.nih.gov/snp/; [53]) namely LRRK1[E929K], LRRK1[E929Q], LRRK1[Y971C] and LRRK1[I1412F]. Three of these mutations (LRRK1[E929K], LRRK1[E929Q] and LRRK1[I1412F]) induced a moderate, under 2-fold increase in pRab7A phosphorylation. The LRRK1[Y971C] variant, unlike the Y971F mutation, does not alter LRRK1-mediated Rab7A phosphorylation (Figure 5D).

GZD-824 but not selective LRRK2 inhibitors inhibits LRRK1

As there was no robust assay for measuring LRRK1 activity, it was not known whether widely utilized LRRK2 inhibitors also inhibit LRRK1. We therefore tested whether some of the most widely used LRRK2 inhibitors impact LRRK1-mediated Rab7A phosphorylation. These studies revealed that none of the following inhibitors influenced Rab7A phosphorylation when tested in a HEK293 cell overexpression experiment when used at a 10-fold higher concentration than required to suppress LRRK2 activity: MLi-2 [44] (Figure 6A), GSK2578215A [54] (Supplementary Figure S7A), HG10-102-01 [55] (Supplementary Figure S7B), and LRRK2-IN1 [56] (Supplementary Figure S7C). All inhibitors ablated LRRK2-mediated phosphorylation of Rab10 at Thr73 and LRRK2 at Ser935 in parallel experiments. An earlier study reported that a compound identified form a virtual homology screen termed iN04 inhibited LRRK1, but no experimental data was presented to demonstrate this [57]. We found that iN04, when used at 5 µM had no impact on LRRK1-mediated Rab7A phosphorylation (Supplementary Figure S7D).

The only kinase inhibitor that we could identify that suppressed LRRK1 activity was a compound originally identified as a poorly selective Abl tyrosine kinase inhibitor, termed GZD-824 [58]. This inhibitor has also been reported to target LRRK2 [59]. GZD-824 is a Type-2 kinase inhibitor that binds to the protein kinase domain, trapping them in the open, inactive conformation [59]. We found that GZD-824 potently inhibited wild type LRRK1-mediated Rab7A phosphorylation in HEK293 cells with an IC50 of ∼75 nM, and LRRK1[K746G] mutant with an IC50 of ∼275 nM (Figure 6B and Supplementary Figure S8). GZD-824 also inhibited LRRK1 mediated phosphorylation of Rab7A an in vitro assay undertaken with 1 mM ATP with an IC50 value of ∼20 nM (Figure 6C and Supplementary Figure S8). Overall, this inhibitor appears to be potent towards LRRK1, however it is not sufficiently selective to use to probe detailed physiological function of LRRK1.

LRRK1 mediated Rab7A phosphorylation is not regulated by VPS35 or Rab29

The Parkinson's causing VPS35[D620N] mutation markedly enhances LRRK2-mediated Rab protein phosphorylation [23]. To verify whether this mutation would also impact LRRK1, we studied the phosphorylation of Rab7A in previously described wild type and VPS35[D620N] knock-in MEFs [23]. This revealed that basal as well as PMA stimulated Rab7A phosphorylation were unaffected by the VPS35[D620N] mutation (Figure 7A). As expected, LRRK2 regulated Rab10 Thr73 phosphorylation was markedly increased by VPS35[D620N] (Figure 7A). Previous work has also demonstrated that LRRK2 interacts with Rab29 that is localized on the Golgi apparatus [21,22]. LRRK2 is normally largely cytosolic, but when co-expressed with Rab29 becomes significantly relocalized to the Golgi (Figure 7B). LRRK1 is also largely cytosolic but does not relocalize to the Golgi when co-expressed with Rab29 in parallel studies (Figure 7B). Consistent with this data, recent work indicates that Rab29 interacts with the Armadillo domain in LRRK2 [60], which is absent from LRRK1 (Figure 5B).

LRRK1 phosphorylation of Rab7A does not affect interaction with RILP

Phosphorylation of Rab7A at Ser72 has been reported to enhance interaction with its downstream effector Rab-interacting lysosomal protein (RILP), in a manner dependent on Rab7A being bound to GTP, in its ‘active’ state [28]. In an attempt to confirm this, we co-expressed RILP with either wild type Rab7A or Rab7A[Q67L] (GTP trapped conformation) in the presence of LRRK1[K746G] to induce Rab7A phosphorylation. As a control we used the kinase inactive LRRK1[D1409A] mutant instead of the active LRRK1. Phos-tag analysis revealed that Rab7A and Rab7A[Q67L] were phosphorylated to a stoichiometry of ∼50% and ∼30%, respectively (Figure 8, lower panel). Immunoprecipitation of RILP (Figure 8, upper panel) resulted in robust co-immunoprecipitation of Rab7A and vice versa immunoprecipitation of Rab7A (Figure 8, middle panel) resulted in co-immunoprecipitation of RILP. The co-immunoprecipitation of RILP with Rab7A was unaffected by Rab7A phosphorylation at Ser72, though there was a marginal decrease in co-immunoprecipitation with Rab7A[Q67L] in comparison with wild type (Figure 8). As a result, this data indicates that Rab7A phosphorylation at Ser72 does not affect its interaction with RILP.

PPM1H, but not PPM1J or PPM1M, dephosphorylates Rab7A at Ser72

We next evaluated whether overexpression of PPM1H, a protein phosphatase that dephosphorylates LRRK2 phosphorylated Rab proteins [42], would also act on LRRK1 phosphorylated Rab7A. To test this, we transiently co-expressed Rab7A with LRRK1[K746G] to induce Rab7A phosphorylation and found that co-expression with wild type PPM1H, but not a catalytically inactive PPM1H[D153D] mutant [42], blocked Rab7A phosphorylation (Figure 9, upper panel). Overexpression of two other phosphatases most closely related to PPM1H namely PPM1J (Figure 9, middle panel) and PPM1M (Figure 9, lower panel) did not impact on LRRK1 mediated Rab7A phosphorylation.