Differential Roles for DNA Polymerases Eta, Zeta, and REV1 in Lesion Bypass of Intrastrand versus Interstrand DNA Cross-Links^{▿ †}

Cell lines and culture conditions.

HeLa, U2OS, and 293T/17 cells were cultured in Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum. The BL2 human Burkitt's lymphoma cell lines were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum. Construction of POLI, POLH, and REV3L^−/− BL2 lines have been described (19, 22). Cisplatin [cis-diammineplatinum(II)dichloride] was purchased from Sigma-Aldrich and dissolved in 0.9% NaCl as a 3.3 mM stock solution. MMC was purchased from Roche, dissolved in 95% ethanol at a concentration of 0.2 mg/ml, and stored at −20°C.

RNA interference.

HeLa cells were seeded at a density of 10⁵ per well of a six-well plate. The introduction of small interfering RNA (siRNA) into HeLa or U2OS cells was carried out with X-tremeGENE (Roche). For single transfections, cells were exposed to 50 nM siRNA plus 5 μl of X-tremeGENE overnight in the presence of serum, followed by a change in medium the next morning. For double siRNA transfections, U2OS cells were transfected during the day, the medium was exchanged, and then the transfection was repeated the next day. For most experiments, cells were treated with cisplatin or MMC approximately 40 h after the addition of siRNA. When delivering siRNA into cells cultured in 12-well plates, the conditions for transfection was reduced by one-half. siRNAs directed against RAD18, Polη, REV1, REV3, REV7, FANCA, FANCD2, or RAD51 were obtained from Qiagen with the exception of REV1-B, REV1-C, and REV3-C, which were obtained from Ambion. The gene-specific target sequences were as follows: RAD18-3 (GAGCATGGATTATCTATTCAA), RAD18-4 (TGCGATGCTTTGCATCCTAAA), RAD18-6 (ATGGTTGTTGCCCGAGGTTAA), Polη-1 (CTGGTTGTGAGCATTCGTGTA), Polη-3 (CAGCCAAATGCCCATTCGCAA), Polη-6 (CCCGCTATGATGCTCACAAGA), REV1-1 (AGGAGATATGTCAGTATTGAA), REV1-2 (CAGCGCATCTGTGCCAAAGAA), REV1-3 (CTGCCAGGTCCAAGCAATATA), REV1-4 (ATCGGTGGAATCGGTTTGGAA), REV1-B (AAGCATCAAAGCTGGACGACT), REV1-C (AACCAGTAAATGGCTGTAATA), REV3-1 (CGGGATGTAGTCAAACTGCAA), REV3-2 (CCCACTGGAATTAATGCACAA), REV3-3 (CCCATTATCAACAGAACCAAA), REV3-4 (ATGAGTATGGATCATATACAA), REV3-C (AAGCAATTTTGAACCTTATGG), REV7-1 (GTGGAAGAGCGCGCTCATAAA), REV7-3 (AAGATGCAGCTTTACGTGGAA), REV7-4 (CACCCGGAGCTGAATCAGTAT), FANCA-6 (AGGCCTATGCTAATCATTCTA), FANCA-7 (CAGGGCCATGCTTTCTGATTT), FANCD2-2 (CAGAGTTTGCTTCACTCTCTA), FANCD2-5 (AAGCAGCTCTCTAGCACCGTA), and RAD51 (AAGCTGAAGCTATGTTCGCCA). The negative control Non-si sequence (AATTCTCCGAACGTGTCACGT) was purchased from Qiagen. To validate siRNA sequences as to their ability to downregulate expression of REV1 or REV3 in 293T/17 cells, Flag-tagged REV1 and V5-tagged REV3 expression constructs were generated. cDNA encoding REV1 (Enzymax) was subcloned into the pSG5 vector (Stratagene) such that the Flag epitope was placed at the amino terminus of the REV1 open reading frame. cDNA encoding human REV3L was amplified through reverse transcription-PCR (RT-PCR) from HeLa total RNA by using Pfu DNA polymerase (Stratagene). Primers for cDNA amplification were designed such that the entire coding frame for REV3L was subcloned in frame with the carboxy-terminal V5-His epitope tag of pEF6/V5-HisA (Invitrogen), and the insert was verified by DNA sequence analysis. For the data shown in Fig. 1E, 293T/17 cells were cotransfected with either Flag-REV1 or V5-REV3 expression plasmids plus the indicated siRNAs using X-tremeGENE (Roche) according to the manufacturer's suggestions. REV1-1,2 and REV3-1,2 indicate that a combination of REV1-1 and REV1-2 or REV3-1 and REV3-2 siRNAs were used together at a 1:1 ratio. Total cell lysates were separated by SDS-PAGE, transferred to nitrocellulose membrane and probed with anti-Flag (M2) antibody or anti-V5 monoclonal antibody (Invitrogen). Membranes were immunoblotted for topoisomerase 1 as a loading control. To create stable RAD18 knockdowns, U2OS cells were infected with pLKO.1 lentivirus (Sigma-Aldrich) that encodes no shRNA (control) or shRNA targeting the following sequences: RAD18-2 (TGCTTCGAGTATTTCAACATT) or RAD18-6 (ATGGTTGTTGCCCGAGGTTAA). Cells were selected in puromycin and used within 1 week after drug selection.

Assessment of cell viability.

For clonogenic survival assays, HeLa cells were transfected overnight with siRNA as described above. When assessing survival after cisplatin treatment, cells were seeded at known densities the next day, allowed to attach to culture plates overnight, and then treated with cisplatin for 2 h. Cells were washed and allowed to form colonies for approximately 12 days. When assessing survival after MMC treatment, HeLa cells were transfected with siRNA overnight and, the following afternoon, the cells were treated with MMC for 24 h and then seeded at known cell densities for colony formation. Twelve days later, colonies were simultaneously stained and fixed in a solution containing 3:1 methanol and glacial acetic acid plus 1% trypan blue (Sigma). Colonies of 50 cells or greater were counted, and the surviving fractions for each siRNA treatment group represent the plating efficiency for each treatment divided by the plating efficiency of the corresponding untreated control. The BL2 lymphoma lines were treated with cisplatin for 2 h and then harvested 48 h later or treated with MMC continuously for 48 h. The cells were then washed with phosphate-buffered saline (PBS) and assessed as to their ability to exclude the trypan blue as a measure of viability.

Antibodies.

Rabbit polyclonal anti-Polη (H-300), anti-53BP1 (H-300), anti-GAPDH (FL-335), anti-RAD51 (H92), and anti-REV1 (H-300) antibodies were purchased from Santa Cruz Biotechnology. Rabbit polyclonal anti-phospho-CHK1 (ser345) and anti-phospho-Ser139 Histone H2AX were purchased from Cell Signaling and Active Motif, respectively. Rabbit polyclonal anti-FANCA and anti-FANCD2 were purchased from Bethyl Laboratories and GeneTex, respectively. The following mouse monoclonal antibodies were used in these studies: anti-phospho-ATM (Ser 1981; Rockland), anti-PCNA PC10 (Ab-1; Oncogene Research Products), anti-RAD18 (3H7; Abnova), anti-phospho-histone H2A.X (Ser139, clone JBW301; Millipore), anti-Topoisomerase I (BD Pharmingen), and anti-MAD2B/REV7 (BD Transduction Laboratories). The anti-β-tubulin (TUB 2.1) and anti-Flag M2 monoclonal antibodies were purchased from Sigma-Aldrich.

Immunoblotting and RT-PCR.

Cells were lysed in a sodium dodecyl sulfate (SDS) sample buffer (10 mM Tris [pH 8.0], 2% SDS, 1× protease inhibitor cocktail [Roche], and 1× phosphatase inhibitor cocktails 1 and 2 [Sigma-Aldrich]), sonicated, heated at 95°C, and equal amounts of protein were separated on SDS-PAGE gels. Proteins were transferred onto a nitrocellulose membrane and probed with the appropriate primary antibodies described above, followed by secondary horseradish peroxidase (HRP)-conjugated goat anti-rabbit or mouse antibody (Thermo Scientific). Proteins were visualized by using SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific). To detect REV3L mRNA, total cellular RNA was extracted with TRIzol reagent (Invitrogen), and 1 μg of RNA was reverse transcribed with a high-capacity RT kit (Applied Biosystems) according to the manufacturer's protocol. REV3L cDNA were PCR amplified by using primers flanking either side of the REV3L siRNA targeting sequence. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA primers were included in each RT-PCR reaction as an internal control. The following PCR primers were used in these studies: REV3L forward (5′-CTT TCT CAG ATG GCA TTC AG-3′) and reverse (5′-TTT CGG AAC TTG ACA GCA GC-3′) and GAPDH forward (5′-AAG GTC GGA GTC AAC GGA TTT GGT-3′) and reverse (5′-AGT GAT GGC ATG GAC TGT GGT CAT-3′). The PCR protocol was as follows: 94°C for 5 min, followed by 25 cycles of 94°C for 30 s, 59°C for 30 s, and 72°C for 2 min. The RT-PCR products were separated on 1% agarose gels and visualized by ethidium bromide staining.

Immunofluorescence.

For γ-H2AX, S1981P-ATM, and 53BP1 immunofluorescence, cells cultured on glass coverslips were washed in PBS and then fixed in ice-cold 100% methanol for 10 min. Samples were blocked with 5% fetal bovine serum, 0.05% Triton X-100, and 1% goat serum and then incubated with primary antibodies for 45 min. Coverslips were washed three times with PBS and then incubated with the appropriate secondary goat anti-rabbit or goat anti-mouse Alexa Fluor dye-conjugated secondary antibody (Molecular Probes) for 45 min, washed with PBS, counterstained with DAPI to visualize nuclear DNA, and then mounted onto slides with ProLong Gold antifade reagent (Invitrogen). For experiments assessing PCNA colocalization with enhanced green fluorescent protein (EGFP), soluble proteins were first extracted with a Triton X-100 containing buffer (0.5% Triton X-100, 20 mM HEPES [pH 7.4], 3 mM MgCl₂, 50 mM NaCl, and 300 mM sucrose) for 5 min at 4°C in order to reveal detergent extraction-resistant proteins in the nucleus. Cells were then fixed with a 3.7% paraformaldehyde solution for 20 min at 4°C, washed once with PBS, and then fixed again in ice-cold 100% methanol to expose the PCNA (PC-10) epitope. Immunofluorescence staining for PCNA was performed as described above. To visualize EGFP-tagged proteins and FANCD2 in lentiviral transduced U2OS cells, cells were fixed in buffered 3.7% paraformaldehyde solution containing 0.5% Triton X-100 for 20 min, permeabilized in PBS containing 0.5% Triton X-100, and then stained for FANCD2 protein as described above. Imaging was performed on either an Olympus BX-51 fluorescence microscope or Olympus FV-500 confocal microscope. Images were further processed and merged by using Adobe Photoshop CS.

Flow cytometry.

For single parameter flow cytometry, cells were fixed with ice-cold 70% ethanol and then resuspended in PBS containing RNase A and propidium iodide to determine DNA content. For two parameter flow cytometry, cells were fixed with 70% ice-cold ethanol, blocked with 5% fetal bovine serum, 1% goat serum plus 0.05% Tween 20, and then stained with anti-γ-H2AX monoclonal antibody. Cells were washed, incubated with goat anti-mouse fluorescein isothiocyanate-conjugated secondary antibody, and then counterstained with propidium iodide in PBS containing RNase A. Cells were acquired on a BD FACSCalibur system by using CellQuest software.

Analysis of chromosomal aberrations.

HeLa or BL2 cells were treated with either cisplatin for 1 h or MMC continuously. After 24 h, mitotic cells were enriched by the addition of 50 ng of Colcemid (Gibco)/ml for 45 min prior to cell harvesting. Cells were treated for 18 min at 37°C with a hypotonic solution consisting of 0.075 M KCl and then fixed in Carnoy's fixative (methanol-glacial acetic acid [3:1]). Cells were dropped onto slides and allowed to dry for a day, and then the chromosomes were stained with Giemsa prior to analysis as described previously (10). A total of 50 mitotic spreads were analyzed for each treatment. For comparisons of the average number of gaps and breaks per metaphase between control and drug-treated treatment groups, a Student t test was used.

Lentiviral vectors and virus production.

The cDNA for human POLH (Polη) and REV1L were purchased from Enzymax. Human RAD18 cDNA was PCR amplified from IMAGE clone 3451960 (American Tissue Culture Collection). POLH, REV1, and RAD18 cDNAs were subcloned into pEGFP-C1 (Clontech) such that EGFP was fused in frame at the amino-terminal end of each protein. The entire cDNA encoding EGFP fused with the open reading frame of Polη, Rev1, or Rad18 was excised and then subcloned into pLenti EV (University of Michigan Vector core facility) to generate pLLEV-EGFP-Polη, pLLEV-EGFP-REV1, and pLLEV-EGFP-RAD18. To generate lentivirus, 293T/17 cells were cotransfected with individual lentiviral vectors plus the following packaging plasmids at a 1:1:1:1 ratio (pLP1, pLP2, and pLP/VSVG, Invitrogen) using the calcium phosphate method to deliver plasmid DNA into cells. U2OS cells were seeded onto coverslips in 12-well plates and then infected with 293T/17 supernatant in the presence of 4 μg of Polybrene/ml overnight. The following morning, the medium was changed, and treatments were initiated 24 h later.

Replicative bypass of cisplatin intrastrand cross-links requires PCNA monoubiquitination, Polη, and the REV1/Polζ functional complex.

Upon entering a cell, cisplatin forms covalent bonds with the N⁷ position of adjacent guanines within the same DNA strand (major adduct) or on opposite strands to form interstrand cross-links (minor adduct) (32). Both cisplatin intrastrand and interstrand cross-links have been proposed to contribute to the cytotoxicity of this anticancer drug. To assess the importance of each component of the TLS pathway hypothesized as being necessary for replicative bypass of cisplatin DNA adducts (a simplistic model is shown in Fig. 1A), we transiently depleted HeLa cells of RAD18, Polη, REV1, REV3, or REV7 using siRNA and then analyzed the ability of cisplatin-treated cells to progress through the cell cycle along with their cellular response to DNA damage. Our ability to specifically deplete endogenous proteins with siRNA in HeLa cells was determined by immunoblot analysis (RAD18, Polη, REV1, or REV7) (Fig. 1C and D). Since antibodies are not available to detect endogenous REV3, RT-PCR was used to confirm reduction of REV3 mRNA after transfection with REV3-specific siRNA (Fig. 1B). We further validated the specificity and potency of the siRNAs used in the present study by examining the ability of different siRNA sequences targeting REV1 or REV3 to deplete ectopically expressed proteins in 293T cells (Fig. 1E). In addition, depletion of RAD18 via siRNA prevented efficient monoubiquitination of PCNA in response to UV-C or cisplatin demonstrating effective knockdown of the principle regulator of the TLS pathway (Fig. 1D).

Phosphorylation of the histone variant H2AX at serine 139 occurs in response to DNA damage such as DSBs or replication fork stalling, is primarily mediated by ATM or ATR, respectively (20), and is an extremely sensitive marker for the presence of DNA damage or perturbation of DNA replication. We therefore determined whether RAD18, Polη, REV1, or REV3 knockdown in HeLa cells leads to enhanced γ-H2AX staining by immunofluorescence after cisplatin treatment (Fig. 2A). Rather than seeing individual foci in cisplatin-treated cells, the nuclei of RAD18, Polη, REV1, or REV3 siRNA-transfected cells exhibited indistinguishable, intense, and almost diffuse staining patterns 24 h after drug exposure. In comparison, nonspecific (Non-si) siRNA-transfected cells displayed little staining, suggesting that these cells were capable of replicating DNA containing cisplatin intrastrand cross-links in the presence of an intact TLS pathway. Similar results were found when HeLa cells were transfected with several different siRNAs targeting RAD18, Polη, REV1, REV3, or REV7, thus demonstrating that the enhanced γ-H2AX response induced by cisplatin treatment is not due to siRNA off-target effects. (data not shown). In response to ionizing radiation, γ-H2AX staining patterns present as individual foci directly correlating with the number of DSBs (47). Since it is unlikely that the intense γ-H2AX staining observed in RAD18, Polη, REV1, or REV3 knockdown cells represents mass accumulations of DSBs, we interpret this staining pattern as an indication of extensive DNA replication stalling due to the inability to perform lesion bypass, and this in turn results in the induction of a sustained checkpoint response mediated by ATR (7, 9).

To determine whether the increased γ-H2AX staining detected by immunofluorescence was specifically associated with cells residing in S phase, HeLa cells were costained with propidium iodide for DNA content along with γ-H2AX and analyzed individually by flow cytometry. We also examined whether REV7 depletion gives rise to the same phenotype as observed with the knockdown of RAD18, Polη, REV1, or REV3. Transfection of siRNA specific for each component of the TLS pathway, including REV7 (Fig. 1A), was associated with essentially identical γ-H2AX responses in that the majority of cells arrested primarily in S and G₂ phases of the cell cycle and stained positive for γ-H2AX after cisplatin treatment (Fig. 2B and C). This result also demonstrates that the gene identified as human REV7 (MAD2L2 or MAD2B) is likely to be the true homologue of yeast REV7. Depletion of TLS proteins using several different siRNA sequences targeting RAD18, Polη, REV1, REV3, or REV7 lead to similar cell cycle arrest profiles after cisplatin treatment demonstrating that the effects observed here are gene specific (data not shown). Time course studies analyzing γ-H2AX formation by immunoblot analysis indicate that the γ-H2AX response developed slowly over time and became prominent by 16 h after cisplatin treatment as cells accumulated in S phase (see Fig. S1 in the supplemental material). Consistent with enhanced ATR-dependent checkpoint activation in response to replication fork stalling, depletion of RAD18, Polη, REV1, REV3, or REV7 led to increased phosphorylation of the CHK1 cell cycle checkpoint kinase, a direct and specific target of the ATR kinase (Fig. 2D) (13).

RAD18, Polη, and REV1 colocalize with PCNA at sites of cisplatin-induced replication stress.

To gain additional evidence that RAD18, Polη, and REV1 are involved in replicative bypass of cisplatin intrastrand cross-links, we assessed whether these proteins colocalize with PCNA foci in a cisplatin-dependent manner. EGFP-tagged RAD18, Polη, or REV1 were delivered into cells via lentivirus such that nearly 100% of cells express EGFP-tagged protein. Since HeLa cells expressed extremely low levels of EGFP-REV1 protein, U2OS osteosarcoma cells were used for these studies. In agreement with previous studies, untreated cells exhibited EGFP-Polη foci that colocalize nearly 1 to 1 with PCNA foci (2, 30). After cisplatin treatment, the number of EGFP-Polη foci within in a given cell increased dramatically (Fig. 3A). In contrast, a significant number of untreated cells exhibited EGFP-REV1 or RAD18 foci that failed to show colocalization with PCNA, suggesting these two proteins do not strictly localize to replication factories. In response to cisplatin treatment, the majority of cisplatin-induced EGFP-REV1 or RAD18 foci colocalized with PCNA, similar to EGFP-Polη (Fig. 3A).

To distinguish whether cisplatin-induced PCNA foci represent sites of replication stress (e.g., stalled replication forks) as opposed to unperturbed DNA replication, we determined whether cisplatin-induced PCNA foci colocalize with γ-H2AX. As expected, untreated U2OS cells exhibited both PCNA and γ-H2AX foci; however, these foci rarely colocalized (see Fig. S2 in the supplemental material). In response to agents known to cause replicative fork stalling and monoubiquitination of PCNA, such as UV-C or cisplatin, PCNA focus formation greatly increased and exhibited extensive colocalization with γ-H2AX (see Fig. S2 in the supplemental material). Cisplatin-induced EGFP-Polη, REV1, and RAD18 foci also exhibited extensive colocalization with γ-H2AX (Fig. 3B). In addition, cisplatin-induced Polη or REV1 focus formation was abrogated in U2OS cells depleted of RAD18 protein (Fig. 3C and D). Consistent with the model that Polη and REV1 cooperate to perform lesion bypass of cisplatin-DNA adducts, cisplatin induced the formation of foci consisting of EGFP-Polη and Flag-REV1 colocalized together (Fig. 3E).

The Fanconi anemia (FA) core complex recruits REV1, but not Polη, to replication foci in cisplatin-treated cells.

Several lines of evidence implicate the FA pathway in regulating REV1 and Polζ-dependent TLS. First, cells deficient in components of the FA pathway have been characterized as being hypomutagenic at the HPRT locus (27, 33, 43). In addition to the genetic epistasis observed between FANCC and REV1 or REV3 for cisplatin sensitivity in DT40 cells, FANCC-deleted cells are also deficient for somatic hypermutation of abasic sites at the IgM locus, a process dependent upon the TLS pathway (38). Mirchandani et al. have recently shown that the FA core complex is necessary for both spontaneous and UV-C induced mutagenesis, as well as the proper recruitment of ectopically expressed REV1 protein to nuclear foci upon exposure to UV-C irradiation (35). Interestingly, regulation of REV1 localization into UV-C induced foci does not require the FA proteins, FANCI or FANCD2, which are believed to act downstream of the FA core complex to direct checkpoint signaling and DNA repair. Regulation of REV1 focus formation by the FA core complex appears to be a parallel pathway to RAD18-dependent PCNA monoubiquitination since localization of RAD18 and its activity are unperturbed in UV-C irradiated cells deficient in FA core complex function (35). Based on these observations, we tested whether the FA pathway is necessary for the recruitment of REV1 or Polη into foci after cisplatin treatment.

U2OS cells were transfected twice with two different siRNAs specific for either FANCA or FANCD2 mRNA, and then infected with lentivirus encoding EGFP-RAD18, EGFP-Polη, or EGFP-REV1. Cells were exposed to cisplatin, fixed, and then analyzed for focus formation as in Fig. 3. Eliminating FANCA or FANCD2 expression had little impact on cisplatin-induced RAD18 or Polη focus formation (Fig. 4A and B). However, cells depleted of FANCA protein failed to exhibit cisplatin-induced EGFP-REV1 foci demonstrating that the FA core complex specifically regulates REV1 localization at stalled replication forks. The efficiency of FANCA knockdown was confirmed by assessing disruption of cisplatin-induced FANCD2 focus formation (Fig. 4C) and also by demonstrating that FANCD2 monoubiquitination was abrogated in FANCA siRNA-transfected cells (Fig. 4D). Both FANCD2 focus formation and monoubiquitination are known to require a functional FA core complex (36).

REV1, REV3, and REV7 protect against cisplatin-induced cytotoxicity and formation of chromosomal aberrations.

Since depletion of RAD18, Polη, REV1, REV3, or REV7 lead to indistinguishable responses with regard to phosphorylation of H2AX and cell cycle redistribution (Fig. 2), we expected that knockdown of these proteins in HeLa cells would result in equivalent hypersensitivity to cisplatin. Instead, we found that REV1, REV3, or REV7 siRNA-transfected HeLa cells exhibited greater sensitivity to cisplatin-induced loss in clonogenicity at lower drug concentrations (e.g., 1 and 3 μM), suggesting that REV1 and Polζ may perform additional roles in promoting tolerance to cisplatin (Fig. 5A). To confirm this observation, we treated human Burkitt's lymphoma BL2 cells deleted of POLH (eta), POLI (iota), or REV3L with various concentrations of cisplatin for 2 h and measured viability 48 h later by trypan blue dye exclusion (Fig. 5B). Consistent with the results observed in HeLa cells transfected with REV3 siRNA, REV3 knockout BL2 cells were significantly more sensitive to cisplatin cytotoxicity compared to Polη or Polι knockout cells.

Cisplatin is known to create a small percentage of interstrand DNA cross-links (1 to 3%) in addition to intrastrand cross-links (32). Given the proposed role of REV1 and Polζ in interstrand DNA cross-link repair and the genetic epistasis observed between the FANCC gene and REV1 and REV3 in cisplatin resistance in DT40 cells, we investigated whether REV1 or Polζ-deficient cells are more sensitive to cisplatin-induced chromosome aberrations, a hallmark of interstrand DNA cross-link repair deficiency. Depletion of RAD18 or Polη in HeLa cells did not result in a significant increase in cisplatin-induced chromatid gaps and breaks per metaphase compared to controls, (Fig. 5C). In contrast, depletion of REV1, REV3, or REV7 resulted in a three- to fourfold increase in chromatid gaps and breaks per metaphase in cisplatin-treated cells, a finding consistent with the hypothesis that REV1 and Polζ play an important role in interstrand DNA cross-link repair. Similar results were observed in BL2 cells where REV3L knockout cells accumulated twice as many chromosomal aberrations compared to POLH knockout cells treated with cisplatin (Fig. 5D). Representative images of chromosomal aberrations observed in control or Rev3-depleted HeLa cells are displayed in Fig. 5E.

To further test our hypothesis that REV1, REV3, and REV7 contribute to interstrand DNA cross-link repair in human cells, we examined the formation and resolution of DSBs in cisplatin-treated cells as an indirect measurement of interstrand DNA cross-link repair (16, 26, 37, 48). Since γ-H2AX is not a reliable surrogate marker for the presence of DSBs under conditions of pronounced replication stalling (Fig. 2), we examined the formation of foci marked by activated ATM colocalized with 53BP1 in cisplatin-treated cells. ATM is a central cell cycle checkpoint kinase that is specifically activated in response to DSBs. Activation of ATM is associated with rapid transphosphorylation on S1981 and localization to sites of DSBs (4). 53BP1 is involved in DNA damage signaling and repair and is well characterized for its ability to localize to DSBs in cells exposed to DNA-damaging agents (51, 59). By examining colocalization of S1981P-ATM and 53BP1, we reasoned this would be a more specific surrogate marker of DSBs under conditions of DNA replication arrest. HeLa cells were transfected with individual siRNAs, treated with 3 μM cisplatin for 1 h, and then allowed to recover for 24 or 48 h before fixation and imaging of S1981P-ATM and 53BP1 by indirect immunofluorescence. At 24 h, all cisplatin-treated cells appeared to accumulate similar numbers of foci containing S1981P-ATM and 53BP1 regardless of which gene the siRNA was targeting (including the nonspecific Non-si siRNA) (see Fig. S4 in the supplemental material). However, at 48 h, ca. 60% of HeLa cells depleted of REV1, REV3, or REV7 still exhibited more than 10 foci per cell (Fig. 6A and B). In contrast, the majority of Non-si, RAD18 or Polη siRNA-transfected cells contained fewer than 10 foci per cell 48 h after cisplatin treatment, suggesting that interstrand cross-link repair was not impacted to a significant degree. These results were again confirmed by using two additional siRNA sequences targeting Rad18, Polη, REV1, REV3, or REV7 (data not shown). To confirm the validity of the focus retention assay, we also analyzed the effect of depletion of RAD51 on focus resolution after cisplatin. Similar to REV1-, REV3-, or REV7-depleted cells, RAD51-deficient cells (i.e., homologous recombination repair deficient cells) failed to resolve S1981P-ATM and 53BP1 foci in a timely manner (Fig. 6C and D).

The REV1/Polζ functional complex is necessary for efficient repair of MMC interstrand cross-links.

The observation that REV1-, REV3-, or REV7-depleted HeLa cells accumulated or failed to resolve greater numbers of cisplatin-induced DSBs could be explained by increased replication fork instability and collapse due to the inability to complete replicative bypass of cisplatin intrastrand cross-links rather than deficient interstrand DNA cross-link repair. We therefore tested whether REV1 or REV3 depleted cells are uniquely sensitive to MMC, a clinically relevant anticancer agent that produces monoadducts, intrastrand cross-links, and a far greater percentage of interstrand DNA cross-links (20%) compared to cisplatin (17). As shown in Fig. 7A, REV1, REV3, or REV7 siRNA-transfected HeLa cells are significantly more sensitive to loss in clonogenic cell survival compared to RAD18 or Polη siRNA transfected cells. Similarly, REV3L knockout BL2 cells were also more sensitive to loss in viability when exposed to relatively low doses of MMC compared to Polη or Polι knockout cells (Fig. 7B). Consistent with a deficiency in the repair of interstrand DNA cross-links, REV1-, REV3-, or REV7-depleted HeLa cells displayed greater numbers of MMC-induced chromosomal aberrations per metaphase that primarily consisted of chromatid gaps and breaks compared to Polη-depleted cells (Fig. 7C). For comparative purposes, we also depleted HeLa cells of RAD51 via siRNA. As expected, RAD51-depleted cells exhibited similar numbers of chromatid gaps and breaks per metaphase compared to REV1-, REV3-, or REV7-depleted cells, a finding consistent with the model that both translesion DNA synthesis and homologous recombination repair are necessary for efficient repair of interstrand DNA cross-links. We also confirmed the requirement of REV3 for protection against MMC-induced chromosome instability in the BL2 model system, where we consistently observed greater numbers of chromosomal aberrations in REV3L knockout cells compared to wild-type or POLH knockout cells (Fig. 7D). Representative images of chromosomal aberrations observed in mitotic spreads isolated from Non-si or REV3-2 siRNA-transfected HeLa cells treated with MMC are displayed in Fig. 7E.

To further test the hypothesis that REV1 and Polζ are necessary for efficient interstrand DNA cross-link repair, we assessed whether siRNA-transfected HeLa cells exhibit residual DSBs after a brief exposure to MMC. At 24 h, all MMC-treated cells accumulated similar numbers of foci containing S1981P-ATM and 53BP1 regardless of which gene the siRNA was targeting (including the nonspecific Non-si siRNA) (see Fig. S5 in the supplemental material). However, REV1-, REV3-, or REV7-depleted HeLa cells, but not RAD18- or Polη-depleted cells, were deficient in resolving DSBs marked by foci containing S1981P-ATM colocalized with 53BP1 48 h after MMC treatment (Fig. 8A and B). Similar results were found using two additional siRNA sequences to deplete Rad18, Polη, REV1, REV3, or REV7 protein, confirming that deficiencies in resolving MMC-induced DSBs are not due to off-target effects (data not shown). Again, we validated this assay by demonstrating that focus retention after MMC treatment is also a major phenotype in RAD51-depleted cells (Fig. 8C through E). Finally, HeLa cells deficient in REV1, REV3, or REV7, but not RAD18 or Polη, displayed prominent cell cycle arrests in late S and G₂ phases of the cell cycle indicative of prolonged cell cycle checkpoint induction after treatment with a relatively low dose of MMC (3 ng/ml), a phenotype characteristically displayed by cells deficient in components of the FA pathway (Fig. 8F).