Nucleo-Cytoplasmic Transport of ZIKV Non-Structural 3 Protein Is Mediated by Importin-α/β and Exportin CRM-1

ZIKV NS3 protein localizes in the nuclei of Huh-7 cells early in infection and in the cytoplasm at later times postinfection.

Flaviviruses have a cytoplasmic replication cycle and translate and replicate their genomes in the endoplasmic reticulum (ER) (30). However, some viral proteins, such as C, NS1, and NS5, contain nuclear localization signals (NLSs) and are also present in the nuclei of the infected cells (10–12). Our group has described that DENV NS3 protein localizes in the nuclei of C636 mosquito cells, and, more recently, we reported that DENV NS3 localizes early in infection in the nuclei of Huh-7 hepatocarcinoma cells (28, 29). However, no information regarding the subcellular localization of ZIKV NS3 protein has been described.

To study the subcellular localization of ZIKV NS3 protein, Huh-7 cells were infected with ZIKV at a multiplicity of infection (MOI) of 3 and were analyzed by indirect immunofluorescence (IIF) and confocal microscopy at 8, 12, 16, and 24 h postinfection (hpi). As in DENV infection, NS3 protein from ZIKV was predominantly observed in the nuclei and to a lesser extent in the cytoplasm of Huh-7 cells at 8 and 12 hpi (Fig. 1A). No significant differences in the amount of nuclear NS3 protein at these two times postinfection were observed (Fig. 1B).

In contrast to what was observed earlier, at 16 and 24 hpi, the localization of ZIKV NS3 protein was predominantly in the cytoplasm and to a much lesser extent in the nucleus (Fig. 1A and B). These results were confirmed by a decrease in the fluorescence ratio between nuclear and cytoplasmic levels of NS3 (Fn/Fc) (Fig. 1C).

To further confirm the subcellular localization of ZIKV NS3 protein at 12 and 24 hpi, transmission electron microscopy (TEM) assays were performed using specific anti-NS3 antibodies. In agreement with the results shown in Fig. 1, NS3 protein was observed predominantly in the nuclei (N) and to a lesser extent in the cytoplasm (C) at 12 hpi (Fig. 2B and D). However, at 24 hpi, NS3 was observed mainly in the cytoplasm and to a lesser extent in the nuclei (Fig. 2C and D). As expected, some alterations in the ER, such as distended cisterns, were also observed in cells infected with ZIKV (Fig. 2B and C), in contrast to uninfected cells (Fig. 2A).

Ivermectin (IVM) and leptomycin B (LMB) inhibit nuclear import and export of ZIKV NS3 in Huh-7 cells.

The C and NS5 proteins from ZIKV use the classical nuclear import (importin-α/β) and export (CRM-1) pathways to be imported and exported from the nucleus. IVM is a specific drug used to inhibit the classical import pathway (importin-α/β); thus, it has been widely used to determine which proteins use this pathway for internalization into the nucleus. However, LMB is a specific inhibitor of the classical nuclear export pathway (CRM-1) and was previously used to study the nuclear export of C, NS5, and other proteins (31–33).

Thus, to analyze the participation of both pathways in the import and export of NS3 protein in infected cells, IVM and LMB were used. To determine the cell viability of Huh-7 cells in the presence of both drugs, we tested the concentrations used previously to analyze the import and export of ZIKV NS5 protein (31); therefore, concentrations of 12, 25, 50, 75, and 100 μM IVM and 5, 10, and 15 ng/mL LMB were tested. No significant differences in cell viability were observed at the different concentrations tested or in the cells treated with respective vehicle controls (dimethyl sulfoxide [DMSO] and ethanol) (Fig. S1A and B in the supplemental material).

Once we analyzed cell viability in the presence of both drugs, the subcellular localization of ZIKV NS3 was analyzed. Because our previous experiments indicated that at 12 hpi, the ZIKV NS3 protein is in the nucleus, if NS3 uses the importin-α/β pathway, IVM would inhibit NS3 import (Fig. 3A). Therefore, Huh-7 cells were infected with ZIKV at an MOI of 3 for 2 h, virus was removed, and culture medium with IVM at a concentration of 12.5 μM was added for 12 hpi. As a positive control, Huh-7 cells were transfected with the NLS-SV40-tetraGFP plasmid, which contains the NLS of the SV40 T antigen coupled to tetra-green fluorescent protein (tetra-GFP), and were treated with IVM for 24 h. Cellular localization of ZIKV NS3 was analyzed by confocal microscopy using an anti-NS3 antibody. As a control for effects of IVM on the import pathway, an anti-importin-α (anti-Imp-α) antibody was used.

As expected, localization of NLS-SV40-tetraGFP was observed mainly in the nuclei of transfected cells; however, after treatment with IVM, NLS-SV40-tetraGFP was present in the nuclei and the cytoplasm, indicating that IVM was able to inhibit this pathway. In the presence of IVM, the subcellular localization of ZIKV NS3 protein at 12 hpi was also affected because its location was observed mainly in the cytoplasm, in contrast to the infected, non-treated cells, where NS3 was observed in the nuclei (Fig. 4A and B), indicating that NS3 is imported to the nucleus by the importin-α/β pathway. These results were confirmed by a decrease in the nuclear fluorescence/cytoplasm fluorescence (Fn/Fc) ratio of NS3 in IVM-treated and untreated cells (Fig. 4C).

Because our previous experiments showed that at 24 hpi, the ZIKV NS3 protein is located mainly in the cytoplasm of the infected cells, to analyze if this protein is exported by the CRM-1 pathway, infected cells were treated with LMB (Fig. 3B). Huh-7 cells were infected with ZIKV at an MOI of 3 for 2 h, virus was removed, and fresh medium with LMB at a concentration of 15 ng/mL was added, as previously reported (32). The subcellular localization of ZIKV NS3 was analyzed at 24 hpi by IIF using an anti-NS3 antibody. As a control for LMB activity on the export pathway, subcellular localization of the CCNB1 protein, which uses the CRM-1 pathway for its export, was also assessed.

As expected, in the mock LMB-untreated cells, CCNB1 was observed in the cytoplasm and perinuclear area, while in the mock LMB-treated cells, CCNB1 was observed mainly in the nuclei (Fig. 5A), confirming that LMB was inhibiting the CRM-1 export pathway. As observed before, the subcellular localization of the ZIKV NS3 protein at 24 hpi was in the cytoplasm; however, increasing concentrations of LMB caused its retention in the nucleus, indicating that this protein uses the CRM-1 nuclear export pathway to relocate from the nucleus to the cytoplasm at late times postinfection (Fig. 5A and B).

This increase in nuclear localization of NS3 protein in the presence of LMB was quantified, and significant differences in NS3 nuclear and cytoplasmic localization between untreated and LMB-treated cells were observed (Fig. 5B). These results were confirmed by the increase in Fn/Fc ratio of NS3 protein in LMB-treated and untreated cells (Fig. 5C).

In silico prediction of nuclear localization signals (NLSs) and nuclear export signals (NESs) in ZIKV NS3 protein.

Importin-α/β-directed transport requires specific sequences that are recognized in the cargo proteins that cross the nuclear membrane from the cytoplasm. These NLSs contain repeated amino acids of arginine (Arg or R) and lysine (Lys or K) as the monopartite classic NLS reported in the SV40 large T antigen, which consists of the five amino acids KKKRK. Furthermore, some proteins possess a bipartite NLS composed of two groups of basic amino acids and separated by approximately 10 amino acids (21, 22).

To determine if the ZIKV NS3 protein contains an NLS, an in silico analysis using NLS predictors, such as cNLS Mapper, Wregex, and Prosite, was performed (34–36). One monopartite (210 REAIKKRLRTV) and three bipartite (169 RREEETPVECFEPSMLKKQL, 202 RRVLPEIVREAIKKRLR, and 583 RHGEKRVLKPRWMDARVCSDHAALKSFKE) NLSs were predicted in the ZIKV NS3 protein. Interestingly, the monopartite NLS 210 is contained in the bipartite NLS 202. Therefore, this sequence could function as a monopartite or bipartite NLS (Fig. 6A to D).

Nuclear localization of the NS3 protein has been described in other members of the Flaviviridae family, such as hepatitis C virus (HCV) (37, 38), JEV, WNV (39), and DENV (28, 29). Thus, the degree of conservation of these sequences in different members of the Flavivirus genus was analyzed. Sequence alignment performed with ClustalW2 (40) revealed a high degree of conservation of the monopartite/bipartite NLS (202/210), with an identity of 41.18 to 76.47%, and the bipartite NLS 583, with an identity of 27.59 to 89.66%, in the different members of the Flavivirus genus analyzed (Fig. 6E).

However, NESs are composed of sequences rich in leucine or hydrophobic amino acids, such as valine (Val or V), isoleucine (Ile or I), phenylalanine (Phe or F), or methionine (Met or M) (23–25). To identify these sequences in the ZIKV NS3 protein in silico, the NES predictors LocNES and NetNES were used (41, 42). Two probable NESs (85 LDAAWDGLSEVQLLAVPPGE and 248 TRVVAAEMEEALRGL) were identified (Fig. 7A to C). Analysis of the degree of conservation of these sequences in the different members of the Flavivirus genus found that NES 248 was the sequence with the highest sequence identity (66.67 to 93.33%) (Fig. 7D).

Molecular docking analysis of the interaction between importin-α and the NLS of the ZIKV NS3 protein.

Once a putative monopartite (210 REAIKKRLRTV) and three putative bipartite (169 RREEETPVECFEPSMLKKQL, 202 RRVLPEIVREAIKKRLR, and 583 RHGEKRVLKPRWMDARVCSDHAALKSFKE) NLSs were identified in silico, we wanted to determine if they were responsible for the nuclear import of ZIKV NS3 via the importin-α/β pathway. Thus, a molecular docking assay was performed using importin-α and ZIKV NS3.

Structural modeling of the ZIKV NS3 protein was performed because the protease/helicase region is not reported in databases such as the Protein Data Bank (PDB). The structural homology modeling servers I-TASSER, RaptorX, and Swiss-Model were used to model the ZIKV NS3 protein, taking DENV-4 NS3 protein (PDB ID: 2WHX) as a template (43). By the Ramachandran graph, different modeled structures of NS3 were evaluated using the SAVES v6.0 server (44). According to the percentage of residues in the allowed areas of the graph, we chose the model with the highest percentage (92%) of residues in the permitted areas of the Ramachandran plot, obtained with Swiss-Model (data not shown). This model was used in the molecular docking test.

For the molecular docking test, we used the HDOCK server (45). ZIKV NS5 NLS (RKRPRV), SV40 large T antigen NLS (PKKKRKV), and HAT-KAT8 NLS (RNQKRKHDEI) sequences were used as positive controls that bind to importin-α, and ATP synthase-alpha (located in mitochondria) and Fas-L member 6 (located in the cell membrane) were used as negative controls. We found that the docking scores (DSs) obtained from the positive controls ranged between −199.21 and −215.02 kcal/mol between the different NLSs and importin-α, and the DSs obtained for the negative controls ranged between −72 and −86 kcal/mol (Fig. S2).

Once the ability of the server to predict the specific binding between the different NLSs and importin-α was corroborated, the putative NLS responsible for the nuclear import of ZIKV NS3 protein by the importin-α/β pathway was determined by molecular docking assay by using importin-α (PDB ID: 5W41) and the ZIKV NS3 protein, as previously modeled. Importin-α is composed of two domains, an autoinhibitory N-terminal domain called importin-β binding (IBB), and a C-terminal arm domain (armadillo), which recognizes and binds to the NLSs of the cargo proteins (46). The ZIKV NS3 protein binds to the armadillo region of importin-α with a DS of −213.21 kcal/mol binding energy as in the previous controls (Fig. 8A and B).

Next, an molecular mechanics with generalised Born and surface area solvation (MM/GBSA) analysis with the HawkDock server (47), which predicts the free energy of a protein-protein complex for each residue, was performed. We found a high binding energy at residues 210 to 218 (REAIKKRLR) of ZIKV NS3 protein (Fig. 8C), a region previously predicted as a putative NLS (NLS 210). Interestingly, residues K214, K215, and R216 provided the highest energy between NS3 and importin-α.

A mutation on the putative NLS 210 from ZIKV NS3 protein prevents its nuclear localization.

To determine if an alteration of the NLS could affect the import of ZIKV NS3 protein to the nucleus, we first analyzed its subcellular location during transfection at 8, 12, 16, 24, and 48 h posttransfection (hpt) by confocal microscopy.

No differences in NS2B3-wild type (WT) subcellular localization at 8, 12, 16, and 24 hpt were found, because the expressed protein was located mainly in the cytoplasm and, to a lesser extent, in the nuclei of transfected cells. However, a significant amount of NS2B3-WT in the nucleus was observed at 48 hpt; thus, the nuclear import and export assays were performed at this time posttransfection (Fig. S3).

To determine the role of amino acids KKR in the import of the ZIKV NS3 protein, site-directed mutagenesis of the plasmid NS2B3-210NLS (kindly donated by Jonathan Ball, University of Nottingham, UK) containing the NS2B3 sequence from ZIKV was performed using the Q5 site-directed mutagenesis kit (NEB). Residues K214, K215, and R216, which provided the highest binding energy between NS3 and importin-α proteins, were changed to A214, A215, and A216 by direct mutagenesis, and the plasmid NS2B3-210NLS-Mut was obtained. The oligonucleotides containing the REAIAAALR mutation were designed following the manufacturer’s instructions (Fig. S4).

Huh-7 cells were independently transfected with the NS2B3-WT and NS2B3-210NLS-Mut plasmids, and the subcellular localization of ZIKV NS3 protein was analyzed at 48 h posttransfection by confocal microscopy. NS2B3-WT was located mainly in the cytoplasm and to a lesser extent in the nuclei of transfected cells, while NS2B3-210NLS-Mut was observed only in the cytoplasm (Fig. 9A and B). The Fn/Fc ratio indicated a more significant amount of nuclear NS3 protein in cells transfected with NS2B3-WT than in cells transfected with NS2B3-210NLS-Mut (Fig. 9C). Pearson’s correlation coefficient analysis indicated a positive correlation between importin-α and NS2B3-WT but not NS2B3-210NLS-Mut (Fig. 9D), indicating that the NLS 210 region is involved in nuclear localization of the NS3 protein.

Putative NES 248 deletion of the ZIKV NS3 protein retains NS3 in the nucleus.

Although we could not predict the binding of CRM-1 exportin to ZIKV NS3 by molecular docking analysis due to its structural complexity in its repeated domains, the deletion of both putative NESs (85 or 248) in the NS2B3 sequence was performed by direct mutagenesis to determine which sequence participates in the nuclear export of ZIKV NS3. Oligonucleotides containing the deletion of putative NESs 85 or 248 were designed following the manufacturer’s instructions (Fig. S5).

Huh-7 cells were independently transfected with NS2B3-WT, NS2B3-NES-Mut85, or NES-Mut248 plasmids, and the subcellular localization of ZIKV NS3 protein was analyzed 48 hpt by confocal microscopy. Both NS2B3-WT and NES-Mut85 were localized mainly in the cytoplasm and to a lesser extent in the nuclei of transfected cells, while NS2B3 NES-Mut248 was found mainly in the cell nuclei and to a lesser extent in the cytoplasm compared to NS2B3-WT (Fig. 10A and B).

The Fn/Fc ratio indicated a significantly greater amount of nuclear NS3 protein in cells transfected with NS2B3-NES-Mut248 than in cells transfected with NS2B3-WT and NES-Mut85 (Fig. 10C), indicating that region NES 248 participates in the nuclear export of NS3. However, the Pearson correlation coefficient for colocalization between CMR-1 and NES-Mut248 (r = 0.163 ± 0.01) was significantly lower than those coefficients calculated for colocalization between CRM-1 and NS2B3-WT and between CRM-1 and NES-Mut85 (r = 0.261 ± 0.01 and r = 0.255 ± 0.012, respectively) (Fig. 10D), corroborating that NES 248 participates in the binding of NS3 with the exportin CRM-1 and its nuclear export.

Cell culture and virus.

The Huh-7 human hepatoma cell line (kindly donated by Rivas from Universidad Autonoma de Nuevo Leon) was cultured in advanced Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 2 mM glutamine, penicillin (5 × 10⁴ U/mL), streptomycin (50 μg/mL), 1 mL/L of amphotericin B (Fungizone), and 8% fetal bovine serum (FBS) at 37°C and in a 5% CO₂ humidified atmosphere.

The propagation of ZIKV strain MEX_CIENI551 was performed in CD-1 suckling mouse brains (provided by Unidad de Producción y Experimentación de Animales de Laboratorio [UPEAL]). Virus titer was determined by focus-forming assay in Huh-7 cells. Brain extracts from mock-infected CD-1 mice were used as controls.

Subsequently, cells were infected with ZIKV at an MOI of 3, and infection was allowed for 8, 12, 16, 24, and 48 h, as appropriate.

Generation of the NLS or NES mutation of NS3 protein and expression in Huh7 cells.

The plasmid containing the NS2B3 sequence (kindly donated by Jonathan Ball of the University of Nottingham, UK) was propagated in competent Escherichia coli DH5α cells and purified using the Zyppy plasmid miniprep kit (Zymo Research) following the instructions provided by the supplier.

Mutation of the putative NLS or NES in the NS3 protein sequence was performed in the plasmid NS2B3 using the Q5 hot start high-fidelity DNA polymerase PCR kit (New England Biolabs). The primer pair forward (agcaCTCCGTACTGTGATCTTAG) and reverse (gctgcTATGGCTTCACGGACTATTTC) was used to introduce mutations in the putative NLS 210, following the manufacturer’s recommendations (98°C for 30 s, 25 cycles of 98°C for 10 s, 60°C for 20 s, and 72°C for 1 min). Deletions of the putative NESs were performed with the primers GTGCCCCCCGGAGAGAGA (forward) and CTTCCATGGACCACAGTATGACAC (reverse) for the NES 85 deletion and CTTCCATGGACCACAGTATGACAC (forward) and CTTCCATGGACCACAGTATGACAC (reverse) for the NES 248 deletion. Both deletions were performed with the kit and conditions described above.

Huh7 cells at a confluence of 70 to 80% were transfected with the different plasmids by electroporation following the protocol of Hashemi et al., with some modifications (66). Briefly, 1 × 10⁷ cells were washed with phosphate-buffered saline (PBS) and resuspended in 200 μL of Opti-MEM with 5 μg of DNA. The cells were transferred to a Gene Pulser cuvette with a 4-mm electrode gap.

Electroporation of the plasmid with the NS3 or NLS SV40-tetraGFP protein sequences was performed on a Gene Pulser Xcell (Bio-Rad, Germany), with electric field strength and pulse length of 170 V and 40 ms, respectively, in exponential decay. Cells were cultured in advanced DMEM with 15% FBS, and transfection was evaluated at 48 h.

Confocal microscopy assays.

Subconfluent monolayers of Huh7 cells were cultured on coverslips for infection with ZIKV or transfection with NS2B3 plasmids. Cells were fixed with 4% paraformaldehyde (PFA), permeabilized and blocked with 0.2% saponin and 1% FBS-PBS, and incubated with the primary antibodies to NS3 protein (rabbit polyclonal, 1:200, GTX-124252), E protein (mouse monoclonal, 1:200, 4G2), importin-α (mouse monoclonal, 1:100, sc-101292), and CRM-1 (mouse monoclonal, 1:100, sc-74454) and with secondary antibodies conjugated to Alexa 488 anti-mouse and to Alexa 594 anti-rabbit (Life Technologies) diluted in saponin and FBS-PBS.

Cell nuclei were stained with Hoechst (Santa-Cruz), and samples were visualized on a Leica TCS SP8 confocal microscope. The images obtained were processed with Leica Application Suite X Core Offline software.

Transmission immunoelectron microscopy (TIM) assays.

Huh7 cells grown in T-75 flasks (Corning) were mock infected or infected with ZIKV at an MOI of 3. After 8 and 24 h, the cells were fixed with 4% paraformaldehyde/0.5% glutaraldehyde for 1 h at room temperature (RT), dehydrated with increasing concentrations of ethanol, embedded in acrylic resin (LR White), and polymerized under UV irradiation at 4°C overnight. Resin-embedded cell sections of 70 nm were mounted on Formvar-covered nickel grids and incubated in PBS with 10% FBS for 1 h to block nonspecific binding and were reacted with an anti-NS3 antibody diluted 1:20 in PBS with 5% FBS. The samples were washed three times with PBS and 10% FBS and were incubated with an anti-rabbit IgG secondary antibody conjugated to 20-nm colloidal gold particles (Ted Pella Inc., Redding, CA, USA) at RT for 1 h. Finally, sections were contrasted with uranyl acetate and lead citrate before being examined under a Jeol JEM-1011 transmission electron microscope (Jeol Ltd., Tokyo, Japan).

In silico prediction of NLSs or NESs of flavivirus NS3 protein.

The amino acid sequence of the NS3 protein from ZIKV strain Mr-766 (access number Q32ZE1) was collected from the UniProt KnowledgeBase (UniProtKB). NLSs of ZIKV NS3 were identified using the cNLS Mapper software (server for prediction of importin-α-dependent nuclear localization signals) (34) with a predetermined cutoff score (5.0), while for NES prediction in CRM1 cargo proteins, LocNES (a computational tool for locating classical NESs) was used (41). TRG_NLS_MonoExtN_4 and TRG_NES_CRM1_1 motifs were determined with WREGEX (weighted regular expression) v2.1, a server for amino acid motif searching (35). To compare whether the putative ZIKV NS3 nuclear localization sequences were conserved in flaviviruses, a multiple sequence alignment was performed using ClustalW. The NS3 protein sequences were obtained from UniProtKB IDs and correspond to DENV (P14340), LANTV (P29837), yellow fever virus (YFV) (Q6J3P1), DENV4 (Q58HT7), DENV1 (P27909), DENV3 (Q6YMS4), WNV (Q9Q6P4), and JEV (P27395).

Three-dimensional (3D) modeling of NS3 protein from ZIKV and molecular docking of NS3-importin-α.

The amino acid sequence of the NS3 protein from ZIKV strain Mr-766 (access number Q32ZE1) was collected from the UniProtKB and used for 3D structure prediction performed using RaptorX (67) and analyzed with the VMD v1.9.3 software. Validation was performed using the Ramachandran graph and the SAVES v6.0 server; 91% of the amino acids were in the allowed area of psi and phi angles (0.2; values not shown).

Molecular docking of NS3-importin-α was analyzed with the HDOCK server using the previously modeled ZIKV NS3 and the structure of importin-α (PDB ID: 4WV6). As positive controls, the NLS of the ZIKV NS5 protein (PDB ID: 5W41) and the SV40 NLS (1EJL) were used because both use the classical pathway of nuclear import. The cytoplasmic protein ATP synthase α (PDB ID: 1QO1) and the cellular membrane protein Fas-L member 6 (PDB ID: 5L19), which lack NLSs, were used as negative controls.

Cell viability to IVM or LMB.

Cell viability was evaluated with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazole bromide (MTT) method. Briefly, Huh-7 cells were cultured in 96-well plates (70 to 80% confluence) and treated for 48 h at 37°C with the vehicles (DMSO and ethanol) and drugs at different concentrations (IVM [12, 25, 50, 75, and 100 μM] or LMB [1, 3, and 5 ng]). MTT (10 μL) was added in 100 μL of culture medium per well and incubated for 3 h at 37°C, according to the manufacturer’s instructions. The MTT was removed, and 100 μL of DMSO was added per well. To remove the background, the plate was read at a wavelength of 630 nm, and the absorbances obtained were subtracted from the absorbances obtained at a wavelength of 562 nm. Absorbance was determined in the spectrophotometer at a wavelength of 562 nm.

Classical nuclear import (importin-α/β) inhibition with IVM and nuclear export (CRM-1) inhibition with LMB.

Huh7 cells cultured with DMEM/7.5% (vol/vol) FBS were mock infected or infected with ZIKV at an MOI of 3 for 2 h at 37°C with 5% CO₂ in advanced DMEM without serum, followed by treatment with 12.5 μM IVM (Sigma, 18898-250MG) diluted in DMSO, which inhibits protein import into the nucleus via importin-α/β1 (33). The infection was allowed for 12 h. Huh-7 cells transfected with the plasmid containing NLS SV40-tetraGFP were treated with IVM as a control.

To inhibit the nuclear export pathway by CRM-1, cells were mock infected or infected for 2 h, followed by treatment with 15 nM LMB diluted in ethanol added to the fresh culture medium (Santa Cruz, 87081-35-4) (32). Infection was allowed for 24 h.

The localization of NS3 protein in cells infected with ZIKV and treated with IVM or LMB was analyzed using indirect immunofluorescence. As a control of the inhibition of nuclear import and export by IVM and LMB, the localization of NLS SV40-tetraGFP in transfected cells treated with IVM was analyzed. On the other hand, the localization of CCNB1 in untreated and LMB-treated cells was analyzed.

Imaging and statistical analysis.

Images obtained by confocal microscopy were analyzed using the Icy image analysis software. Three different images for each condition (8, 12, 16, 24, and 48 h or NS2B3 WT/Mut-NLS as appropriate) were imported, and the mean fluorescence intensity (MFI) for pixel values were obtained for every selected region of interest (ROI) to quantify the nuclear fluorescence (Fn) in relation with the cytoplasm fluorescence (Fc). The Fn/Fc ratio was determined according to Fn/Fc = (Fn − Fb)/Fc − Fb, where Fb is the background fluorescence (68). Pearson’s correlation coefficients were determined for selected ROIs. MFI arbitrary units and correlation coefficients were expressed as means, and standard error of the mean (SEM) was determined. The ordinary one-way analysis of variance (ANOVA) with Dunnett multiple comparisons post hoc testing was used to determine significant differences among means of each condition (12, 16, 24, and 48 h or NS2B3-Mut-NLS and NES-Mut as indicated) against the control (8 h) or NS2B3-WT using RStudio version 1.4 and R version 4.1 software. The results were considered statistically significant when two-sided P values were less than 0.05.

Ethics statement.

This study was conducted by the Official Mexican Standard Guidelines for Production, Care, and Use of Laboratory Animals (NOM-062-ZOO-1999), and the protocol (number 048-02) was approved by the Animal Care and Use Committee (CICUAL) at CINVESTAV-IPN, Mexico.