Navigating Xenbase: An Integrated Xenopus Genomics and Gene Expression Database

3.1. How to Find a Specific Gene Page

1. Select “Gene Search” under the “Genes” menu to find specific Gene Pages or gene families. The default is to “search all,” but to scale down or speed up results, choose one of the more specific search options which include a partial or full gene name (e.g., “bone” or “bone morphogenetic protein 4”), gene symbol (e.g., bmp4) or synonym (e.g., bmp-4), orthologs (if any with different symbols/names), or gene function (e.g., “morphogenetic protein” which will return all bmp genes as well as related gene families). The menu will autofill with the matched text highlighted in yellow.

2. Alternatively, enter an NCBI accession number, Entrez gene ID, Unigene ID, OMIM ID, GO ID, or GO term. Also, a Xenbase accession number such as a “Gene Page ID” can be entered (e.g., XB-GENEPAGE-483057) to find Gene Page(s).

3. Checkboxes permit you to filter results to include only “manually curated Gene Pages” or “Gene Pages with expression images.”

4. Gene Pages can also be browsed alphabetically.

5. The “Advanced search” offers additional filters: to text-match specific letter combination (e.g., “rsp”) or parts of names (e.g., “receptor”).

3.2. Gene Pages

The most utilized, useful data and salient features for each gene are presented on the “Summary” tab on the Gene Page, under the following headings (as an example, enter “bmp4” into the quick search bar in the top right corner of the Xenbase hompage):

1. Summary: Official gene symbol and full name, synonyms, gene function, protein function, a list of cocited interactants (and a thumbnail of an interactive graphical display of interactants), and associated OMIM diseases are all detailed on the top of the Gene Page. Images that summarize the gene expression throughout a range of embryonic stages are shown to the right. Click the + link (the Xenbase symbol that additional text is available) to see all OMIM associations (if present), and click the link to “Nomenclature history” to open the Wiki tab, where changes to gene names and gene symbols are recorded. Xenopus gene names and symbols are identical to human gene names, whenever possible, and orthology to human genes is usually assigned by synteny. Gene names for X. laevis homeologs are appended with “L homeolog” or “Shomeolog” to distinguish the sub-genome with which they are associated.

2. Xenbase Gene ID: Xenbase IDs are allocated to each species/sub-genome specific gene. The chromosome location is indicated when known, and scaffold positions are given in cases where the location has not been fully determined (e.g., due to incomplete or in-progress genome annotations).

3. Molecules section lists and links-out to NCBI/Entrez Gene IDs, nucleotide, and protein data at Swiss-Prot and/or TrEMBL. mRNA RefSeq data has BLAST functionality (click on the rocket icon) and sequence files in FASTA format (click magnifying glass icon to pop up sequence file), can be viewed for any listed sequence. Complete data for Nucleotides and Proteins associated with the gene are listed on relevant “tabs” at the top of the Gene Page.

4. Genomic data is illustrated by gene model snapshots from the genome browser JBrowse. Clicking on these options will open the full view of the gene in JBrowse. The default display is the most current genome with an annotated model for the gene displayed, and earlier versions and GBrowse view can be selected from drop-down menus under each gene model snapshot.

5. Expression section links out to Ensembl and UniGene entries, and RNA-Seq profiles illustrating temporal and tissue expression patterns.

6. Data Mining section allows researchers to access a specific gene’s entry on XenMine, a comprehensive toolbox for NGS data analysis that is part of the Intermine project, and is hosted by Stanford University.

7. Phenotype section currently links to the morpholino screen data produced by the Smith Lab at the Gurdon Institute at the University of Cambridge. Full phenotype curation is a major priority for Xenbase in the coming year, and phenotype annotations will be posted in this section on Gene Pages.

8. Orthology section provides direct links to the orthologous genes recorded in human (OMIM:gene, HGNC, and GeneCards) and the relevant other model organism databases: mouse (MGI), zebrafish (Zfin), chicken (GEISHA), fruit fly (FlyBase) and worm (WormBase).

9. Publications lists the first article to mention the gene, and the most recent article. Click on the journal reference in parenthesis to see the Article Page in Xenbase, or click the “View All Papers” link to go to the complete list (which can also be access via the Gene Literature tab). A camera icon indicates the paper has images displayed.

10. Functional Ontologies section provides gene-specific links to GO terms (sourced from UniProt), gene information at PANTHER [11] (a Gene Ontology consortium project), KEGG orthology entry for this gene, and KOG classification of the gene (sourced from JGI).

11. Reagents section provides links to reagents and resources tailored to the relevant gene. A link is provided to our list of design tools for CRISPR/Cas constructs that includes information on which Xenopus genome builds are compatible with the various tools. Links are provided to several sources for sequence clones including the EXRC and GE Dharmacon, and to our own catalog of antibodies, morpholinos and ORF clones used in Xenopus research involving the specific gene (see Subheading 9 for more reagent details). We also provide links to the details of Affymetrix array probe-sets for Xenopus (note these require an Affymetrix log-in to access).

3.3. Expression Tab: Viewing Gene Expression Data and Images

Xenbase displays 66,000+ in situ hybridization and immunohisto-chemistry images that are posted on the Gene Page “Expression” tab, under two main headings: “Community Submitted” (mostly unpublished images from large scale screens) and “Literature Images” (from journal articles). Curators manually annotate the observed gene expression in these images using terms from the Xenopus Anatomy Ontology, the XAO, to generate a gene expression annotation table for each curated image. Out of the 15,878 Gene Pages currently in Xenbase (v4.7, January 2018), c. 24% (3775 genes) have gene expression images, mostly from in situ hybridization (a camera icon indicates that images are posted for that gene). Additionally, about 95% of genes have expression data from RNA-Seq and EST Transcriptome profiles and/or developmental stage profiles determined by microarray analyses (see Fig. 1B, C).

Gene expression data is organized on the “Expression” tab, under the following headings:

1. Anatomy terms: XAO terms compiled from manual curation by Xenbase, and NBCI cDNA libraries. Use the [+/−] toggle to expand or hide terms.

2. Anatomy stages in which gene expression has been recorded, often unfertilized egg to adult frog stage.

3. RNA-Seq and EST Transcriptome profiles. We link out to:

   1. Gurdon Institute EST database (e.g., X. tropicalis bmp4)
   2. Unigene EST Profiles, with heat map of tissue-specific expression (e.g., X. tropicalis bmp4)
   3. RNA-Seq and microarray profiles, publications available with temporal expression data including Owens et al. [12] and Sessions et al. [7]. Profiles from Yanai et al. [13] have been retired.
   4. GEO data: links to this NCBI resource and runs an automatic search for the gene symbol and “Xenopus.” Currently there are about 185k GEO entries for Xenopus, but not all genes are represented.
4. Developmental Stage Profiles:

   1. X. tropicalis RNA-Seq data for two batches of embryos, from Owens et al. [12]. Click to enlarge graph (see Fig. 1B). These graphs plot transcripts per embryo (TPE) values against developmental stages NF stage 1 to NF stage 42.
   2. X. laevis RNA-Seq data is displayed in dynamic graphs generated from the X. laevis genome sequencing project data [7] (see pop-out in Fig. 1B). These graphs plot transcripts per million (TPM) values against developmental stage (oocyte stage 1–2 to NF stage 40) for the X. laevis L and X. laevis S homeologs.

      • Click the graph thumbnail to open a larger interactive graph.
      • Use dialog boxes to add additional gene symbols to plot: type ahead suggests gene symbols from gene catalog, and there is no limit (Fig. 1B, blue arrow). After selecting click “Add.”
      • Interacting genes is limited to cocited genes.
      • Use “Display data” box to choose either “Raw” or “log2” transformation.
      • Mouse over a data point to display the underlying value and the stage.
      • Click “save to svg” button to download graph.
   3. X. laevis L versus X. laevis S homeolog expression in various tissues illustrated via a heatmap. Click to open a larger view.

5. Summary Images. A curated selection of gene expression images from in situ hybridization (ISH) or immunohistochemistry (IHC) across embryonic developmental stages. These are the same images that appear in Summary section of Gene Page, and they are selected from either “Community Submitted images” or “Literature Images” by Xenbase curators (Fig. 1C). Click image to enlarge and view annotation table.

6. Community Submitted Images come mostly from large scale screens, and are generally ISH. Laboratory of origin holds the copyright to these images. Double click the image to enlarge it and view the annotation table.

7. Literature images display the curated figures from research papers where we have redisplay permission or which are open access. Figures are often multipaneled, and gene expression annotation table is viewed by double clicking on the figure. These images may be protected by copyright; if so, this is indicated.

   Notes/Troubleshooting on viewing Expression on Gene Page:

   • Some genes are very well studied with hundreds of images posted. Click the [+] to toggle between more and less data [−].
   • Use “Sort By” to organize by developmental stage: “earliest to latest” or “latest to earliest.”
   • Literature images are also sortable by earliest or latest publication data.
   • Use thumbs up or thumbs down tool to vote for high quality images
   • Xenbase welcomes high quality images via community submission to populate poorly studied genes! Submit new gene expression images via the “Contact Us” (email: xenbase@ucal-gary.ca) in the footer of every Xenbase page.
   • As there is strong conservation in gene expression in the vast majority of the expressed orthologs and in situ probes designed for one species generally work equally well in the alternate Xenopus species [14], gene expression tables are largely accepted as applicable to both species, although there are exceptions.
   • Species (X. tropicalis or X. laevis) is indicated in the image caption for community submitted and large scale screen data.

3.4. Other Gene Page Tabs

At the top of each Gene Page, a series of file-like “tabs” collate additional gene-specific data as follows:

• 1

  Gene Literature lists all articles that refer to the gene in its data or text.

• 2

  GO Terms provide a quick overview of the cellular role of a gene and can also be used for analysis of high-throughput proteomics data. GO terms are presented under the three categories—Molecular Function, Biological Process, Cellular Component (sourced from UniProt). Click on the GO term for a full definition or the information button for evidence metadata.

• 3

  Nucleotides tab provides links to all gene models and mRNA data from JGI, Ensembl, NCBI, Unigene clusters, mRNA and ESTs for the gene. The rocket icon will autofill a BLAST request, and the magnifying glass icon will provide a pop-up of the sequence in FASTA format. Click on Clone name or Accession number for more details.

• 4

  Proteins tab links to all protein model data from JGI, NCBI, Ensembl and protein sequence from specific accessions in NCBI Protein, RefSeq and Swiss-Prot/UniProKB. The rocket icon will auto fill a BLAST request and the magnifying glass icon will provide a pop-up of the sequence in FASTA format.

• 5
  Interactants: An interactive graph illustrates the genes cocited with the gene of interest, which is placed in the center of the graph.

  • Drag the nodes to move them, and set them in place.
  • Double click to release node position.
  • Number of cocitations are marked on the edges of the graph.
  • Click on the gene symbol to go to the corresponding Gene Page.
  • Graph is downloadable in two formats: use buttons “save to svg” or “save to png.”

Cocited genes are then listed in ranked descending order in two columns, with links to Gene Pages and to literature (e.g., 1358 genes have been cocited with bmp4, the top hit being chrd.1 (chor-din, gene 1) in 190 articles; status June 2017). Finally, links are also provided to IHOP (Information Hyperlinked over Proteins) for both X. tropicalis and X. laevis. In the near future, interactants will include data on physically interacting proteins from human networks, and also genes in coexpression or coregulated networks.

• 6

  Wiki: Nomenclature changes are recorded on the Wiki tab, which can be also accessed by clicking the “Nomenclature History” link. In addition, the Wiki is used to record any information about a gene that is not recorded elsewhere on Xenbase, such as synteny analysis methods, reagent or protocol notes. Registered users can add to Wiki content

3.5. Notes/Troubleshooting Genes Module

• Genes can also be searched using the Quick Search Menu (see Subheading 4 below).

• Can’t find a gene? If you cannot find a Gene Page for a gene of interest, try our Search Help page for hints. Xenopus genes are following human gene nomenclature, so searching by an old name may not work. We store old or “legacy” gene names as synonyms. If your search fails, it may mean Xenbase does not have that gene name or symbol in the database. Try the human, mouse, chicken, or zebrafish gene symbol. If this fails also, the ultimate gene finder requires you to BLAST the Xenbase genome database as detailed in Subheading 5.

• Gene nomenclature issues? Xenbase is the clearing house for Xenopus gene nomenclature. Gene Nomenclature Guidelines are posted under the Genes menu. As gene nomenclature is updated constantly by the HGNC, many gene names and symbols completely change over time. Although gene symbol synonyms are a powerful tool to track down the new name for a gene, they also can be misleading, especially when the same gene symbol has been used/reused in different species/model organisms. NCBI databases record a more comprehensive list of legacy synonyms and symbols than Xenbase, as we try to concentrate on just those symbols used/referred to in Xenopus literature. Note that our gene search does not search Wiki entries, which is where gene nomenclature changes are recorded, however the “Search with Google” in the Quick Search menu does search the Wiki (and everywhere else). Suggest adding a gene name, missing synonyms, or report errors or omissions by contacting Xenbase (xenbase@ucalgary.ca).

• Why is not there an L or S model for this gene? Not all X. laevis genes have both X. laevis homeologs. After the hybridization event that created X. laevis, there was a genome reduction that resulted in loss of some homeologous genes with a higher proportion of S genes being removed than L genes [7]. It is also possible that the homeologous locus is still being assembled fully, or both gene models exist, but only one has been properly annotated.

• Where did the A and B genes go? With the discovery that X. laevis contains two independently interacting legacy genomes that can be distinguished from each other, “A” and “B” genes were migrated to the more informative L and S nomenclature.

4.1. Accessing Xenbase Features from the Main Menus and Home Page Tiles

The following sections cover how to access and use the database features of Xenbase via the Main Navigation Menu, remembering that these options are reiterated on the Home Page Tiles. All topics discussed can be accessed via both options, and we discuss them here in order of the main menu, from left to right, excluding the Gene Search, which is covered above in Subheading 3.

5.1. How to Use Xenbase BLAST

1. Choose from the alignment program query options (e.g., blastn: DNA query to DNA database or blastp: Protein query to protein database) (red arrow, Fig. 4A).

2. Choose the target database or genome build to which you want to compare/align your sequence (e.g., Xenopus laevis and tropicalis mRNA or X. laevis J-strain 9.1) (black arrow, Fig. 4B). Xenbase BLAST allows users to compare nucleotide or protein sequences to the latest (and legacy) X. laevis and X. tropicalis genome builds, mRNA and protein sequences, with these options available in the second drop-down menu labeled “Database.”

3. Enter (i.e., type or copy and paste) a single query sequence into the data box in GenBank/FASTA format (green arrow, Fig. 4A). Alternatively, upload a query sequence file using the “choose file” dialog box (orange arrow, Fig. 4A).

4. For almost all Xenopus-to-Xenopus comparisons, the default “Options” settings will result in a high scoring, statistically significant alignment, although more advanced users can choose a custom set of options.

5. Click the “Submit Job” button to compute the sequence alignment.

6. BLAST results are displayed graphically in three sections:

   1. A color key for alignment scores grades the alignment matches from red (highest scores) to black (lowest scores) (Fig. 4B.1). Click on the color-coded bars to skip directly to the high scoring pair alignments described below (see Fig. 4B.3).
   2. An “Overview of Results” table has five columns: “Hit ID” (i.e., accession ID number of hit or scaffold number), “Hit Description” (name of the sequence hit), Gene Page (i.e., link via gene symbol), HSP “Score” and E-value. Click “Hit ID” (black arrow, Fig. 4B.2) to open the match on GBrowse. Click “Hit Description” (Fig. 4B.2, white arrow) to skip to the High-scoring Segment Pair (HSP) alignments, with computed percent identity, and links to chromosome locations and GBrowse.
   3. Click the gene symbol (green arrow, Fig. 4B.2) to go to the Xenbase “Gene Page.”

5.2. How to Use BLAST to Inform Design of Xenopus-Specific Primer or Morpholino

1. Select “blastn - DNA-to DNA query.”

2. Select the database “Xenopus laevis and tropicalis mRNA.”

3. Enter the sequence into the query sequence box (e.g., CTCACTGGACATCCAGGTCTGAG, a potential scl4a1 PCR primer sequence).

4. Click “Submit Job.” Results are displayed in the same formats as shown in Fig. 4B in the above example, indicating that 24/24 bases match X. laevis scl4a1.L homeolog, and 23/24 bases match X. laevis scl4a1.S homeolog.

5.3. Troubleshooting BLAST

• BLAST searches are usually almost instant, but occasionally can take some time to complete. Very long sequences (e.g., a scaffold), sequences with repeats, or sequences with low complexity increase the chance of a BLAST run being slow, or even timing out. In these cases, try entering a smaller sequence, or change the E-value to get a more sensitive alignment.

• If a BLAST query results in no alignments, check that the correct database and BLAST program has been selected, increase the E-value, or rerun the same BLAST. A warning message will be displayed if an incorrect database is selected for the selected alignment program.

• Mitochondrial genomes form a distinct data unit in BLAST and therefore must be selected from the option in the main menu. No mitochondrial annotations are currently available.

• If BLAST times out after ~30 s, it can be due to heavy use of the service. Try again during an “off peak” time slot and if problems persist, please contact Xenbase. This typically only occurs with very large jobs or complex tblastn or tblastx runs. Once again, feel free to email us if this occurs.

• There is no fully annotated genome available for X. victorianus, only mtDNA.

6.1. Download Xenopus Genomes

The Xenbase Data Downloads page provides access to genome assemblies, gene models, sequences, and database reports. Most files are in a tab-delimited format. Use the toggle [+] to see all files. Click the [readme] link to view information on the files, including the header row for these files. To download a file, click on the corresponding FASTA link. More files are located at our FTP File Browser.

6.2. GBrowse

GBrowse is an open source, browser based, interactive genome visualization software that allows gene models to be viewed within the genome next to RNA-seq and ChIP-Seq data. Xenbase GBrowse can be accessed from the menu bar, via BLAST against a genome, or clicking a snapshot on a Gene Page, or a snapshot morpholino page. Xenbase hosts the most recent and several legacy genome assemblies for both X. tropicalis and X. laevis. The main view of GBrowse on Xenbase shows all selected tracks for the chosen genome. Tracks can include gene model annotations, RNA-Seq alignments, ChIP-Seq alignments, and morpholino alignments. Tracks are binned into categories, such as gene models, tissue RNA-Seq, stage RNA-Seq, and methylation ChIP-Seqs. To customize which tracks are displayed, click the “Select Tracks” tab, and use checkboxes.

6.3. Xenbase UCSC Track Hub

Track hubs are web-accessible directories of genomic data that can be viewed on an external genome browser, and are helpful tools for quickly visualizing large genome-wide data sets, including numerous custom tracks [17]. Xenbase hosts a University of California, Santa Cruz (UCSC) Track Hub that can be loaded into a UCSC instance. A link to the track hub is accessible from the Xenbase home page under the Genomes menu. The UCSC Track Hub includes gene models for X. tropicalisv7.1, v8.0, and v9.0, and X. laevis v9.1 genome builds, plus a large number of RNA-Seq and ChIP-Seq tracks. Xenbase is currently processing additional NGS datasets including them in the track hub (sese RNA-Seq (red) and ChIP-Seq (orange) tracks in Fig. 5C).

6.4. Other Genome Assemblies

Xenbase also links out to other genome resources from the Genomes menu, including the Japanese National Institute of Genetics X. laevis genome project.

7.1. Method 1: Expression Search

The “Search Gene Expression” interface offers numerous user-defined criteria to include/exclude data types, the goal of which is to filter a large catalog of images to answer specific or general questions. As such it can be used to find all examples of gene expression in a specific gene, tissue, or combinations of these, as well as a range of additional criteria. Put simply, there are three tiers of filters that can be selected. First, choose from variables such as species or embryonic stage (details in Subheading 7.1.1). Secondly, choose the anatomy terms to search (details in Subheading 7.1.2), and third, add optional filters based on experimenter (i.e., laboratory or researcher) or database associations (details in Subheading 7.1.3). An example of a three-tiered query might be for “genes expressed in the ‘pronephric duct’ in tadpole stages (NF stage 28 to NF stage 35 and 36) from the Lienkamp laboratory screen,” or “all genes expressed in the foregut progenitor tissues, but not the heart, in gastrula stage embryos.” Equally a query might focus on the unknown tissues, “where is shh expressed besides the notochord”?

7.2. Method 2: Gene Expression via Anatomy Search

What are the best markers for cardiac mesoderm?

Which genes are known to be expressed on the migrating neural crest cells?

Are there any clones/plasmids available for this gene?

Searching for gene expression in a specific anatomical feature is an especially useful query to find both standard and novel molecular markers for a tissue/organ via the image catalog; a comprehensive list of all genes observed to be expressed in a tissue; available clones for that marker; or the body of literature that contains gene expression data for a specific cell type, tissue or organ. This is a simple two-step process. Firstly, find the XAO page for the tissue or organ (see Subheading 7.2.1 below), then secondly, click the “Expression” tab for that term. Details of how to assess the results table from this page are given in Subheading 7.2.2 below.

7.3. miRNA Catalog

MicroRNAs (miRNAs) are small, noncoding RNAs that play a role in regulating gene expression [24, 25]. The data in the miRNA Catalog contains miRNA in situ expression in Xenopus embryos that was submitted by courtesy of the Wheeler Laboratory [24] and XenMARK [25]. The miRNAs have been correlated with Xenopus records in miRBase to provide more information. Click the miRNA links (e.g., xtr-miR-133a) to view more information about the miRNA, including in situ images.

7.4. Expression Data at GEO

Select this menu option to run a preset search for Xenopus NGS data sets through the NCBI Gene Expression Omnibus (GEO) database.

7.5. RNA-Seq Data at the NCBISRA

Select this menu option to run a preset search for Xenopus sequence data through the NCBI Sequence Read Archive (SRA) database.

8.1. Organ Atlas

The organ systems in Xenopus are illustrated here with a variety of imaging methodologies, including confocal microscopy. Currently, the organ atlas covers only heart and pronephric kidney development, and is undergoing a significant expansion to cover more organ systems in the future (e.g., cranial cartilages from the XenHead project [26], the nervous system and musclular skeletal system).

8.2. NF Developmental Stages

A complete Xenopus laevis stage series (NF stage 1–NF stage 66) [http://www.xenbase.org/anatomy/alldev.do] based on Nieuwkoop and Faber [27] illustrations are shown. A new developmental stage series, the Zahn drawings, and complementary bright field photographs, all of which are open access, posted here on Xenbase [26]. The Zahn drawings can be downloaded and used in the laboratory setting to illustrate gene expression domains, pheno-types, and other changing patterns during normal and abnormal development, and can be reused under the creative commons license under which they will be published. Examples of the new images, which include anterior, dorsal, and ventral views, perspectives not included in Nieuwkoop and Faber [27], are shown in Fig. 9.

8.3. Images of Xenopus Embryos

These image files are in the Wiki, and are generally whole-mount microscopy, illustrating each developmental stage as a researcher would see the live embryo.

8.4. Development Stage/Temperature Charts

The rate of Xenopus development is influenced by temperature, and although X. laevis and X. tropicalis embryos develop at similar rates, X. tropicalis tolerate a narrower range of temperatures [14]. The charts provide a standard reference with which to plan experiments and were supplied by the Khokha Laboratory, Yale University.

8.5. Movies of Xenopus Development

High quality movies of the developing Xenopus embryos are pro vided as educational resources, covering key developmental pro cesses including cleavage, gastrulation and neurulation, and the synchronous development of Xenopus laevis embryos during early embryogenesis.

8.6. Cell Fate Maps

Cell fate is illustrated with mouse-over animations in forward direction (blastomere-to-tissue) from NF stage 5 (16-cell) to NFstage 10.5 (beginning of gastrulation) (Fig. 10A), and reverse direction (tissue-to-blastomere) (Fig. 10B), based on the classic studies by Moody [28, 29], and Bauer et al. [30]. To use these dynamic fate maps, simply move the cursor over the blastomere to highlight which cells in later stage embryos are derived from the 16-cell and 32-cell stage blastomeres. The 16-cell blastomeres and their descendants appear in orange (upper panels), while 32-cell descendants will appear in blue (lower panels). Due to the two-dimensional nature of the illustrations, and that NF stage 8 and NF stage 10.5 embryos are shown as sections, only some derivatives of the blastomeres of the NF stage 8 (32-cell) embryo show up in blue on later stage figures. In the reverse fate maps (Fig. 10B), move the cursor over an anatomy term to highlight blastomeres that make major contribution (in red), a minor contribution (in green) or rarely contribute (in orange) cells to the adult tissue.

8.7. The Xenopus Anatomy Ontology

The Xenopus Anatomy Ontology, aka the XAO, is a comprehensive set of anatomical terms that describe the entire course of development and organogenesis in Xenopus from unfertilized egg to the adult frog [31]. The XAO forms the backbone of our gene expression curation and is updated frequently in response to the latest research and community input. The goal of the XAO is to describe all anatomical structures in a formal language hierarchy, with each term being defined and related to other terms. XAO terms have “is_a”, “part_of”, “develops_from”, and “develops_ into” relationships, as well as specific developmental timing boundaries, using NF stages [27], such that each term has “starts_during” and “ends_during” stage relationships (see [31]). Cross referencing the XAO to mouse and human phenotype ontologies will ensure the interoperability of Xenbase phenotype annotation (new feature to be launched on Xenbase), with human disease phenotype.

8.8. Notes/Troubleshooting

Anomalies in the time temperature charts have been reported by some researchers and this table is currently under revision. Contact Xenbase (xenbase@ucalgary.ca) with any questions.

9.1. CRISPr and TALEN Support

New genome editing technologies work well in Xenopus [32, 33]. CRISPr/Cas and TALEN/ZFN editing technologies function by inducing site-specific DNA strand breaks anywhere in the Xenopus genome. Mutations are induced by inefficient, error-prone nonhomologous end joining (NHEJ). In addition, site-specific DNA breaks promote precise knockin, homologous recombination (HR) gene editing. This module provides a review of the techniques with links to Xenopus literature, protocol guides, and other resources for CRISPr and TALENS.

9.2. Antibodies

Antibodies used in Xenopus research are curated from published articles, and the Xenbase antibody catalog has over 1200 entries (at time of press). Xenbase antibodies are named from either the antigen/gene symbol or tissue (where antigen is unknown), in the order they exit our curation pipeline, not the order in which they are published. Antibodies may be searched by common name (e.g., Xlim-1), synonym (e.g., WGA), catalog number (e.g., 3G8), Xenbase name (e.g., Kidney Ab2), antigen gene symbol (e.g., lhx1), or anatomy/XAO terms (e.g., kidney or visual system). Antibody pages contain relevant experimental information including host source, antigen, posttranslational modifications, cross-species interactivity, RRID (Research Resource Identifiers), and a list of experimental applications with confirmed utility in Xenopus research (see Fig. 11). Additional tabs give information on “Attributions,” a “Wiki” for additional notes, images in Xenopus (when available) and links to commercial sources for the antibody.

Notes/Troubleshooting Antibodies

• Start with “Search All” (default setting) to cover all options.

• Use browser back button to return from the Wiki pages.

• Contact Xenbase (xenbase@ucalgary.ca) to submit images and additional usage data for validated antibodies.

• Text box does not autofill from XAO terms or gene symbols.

• GO terms may also be matched to Antibody entries.

9.3. Morpholinos

Morpholinos (MOs) are chemically modified oligonucleotides used to reduce the expression of a gene of interest [34, 35]. MOs knockdown gene expression by inhibiting mRNA translation, blocking RNA splicing, or inhibiting miRNA activity and maturation [34]. MOs have been shown to be effective in both X. laevis and X. tropicalis [36] and are widely used in experimental Xenopus embryology. Xenbase has manually curated 2400+ published Xenopus-specific MOs. How to use the MO search interface, and an example MO entry (e.g., sox2 MO1) is illustrated in Fig. 12. Search for published MOs through the interface, via the MO name or target gene symbol (e.g., sox2), a MO sequence, or use the “Alphabetic Search” (Fig. 12A). Note that the search for “sox2” also returns MOs for “sox21” (blue arrows, Fig. 12A). Each MO is assigned a unique name based on the targeted mRNA/gene (Fig. 12B), and we record any synonyms, the 5′ to 3′ sequence of the oligonucleotide, and whether it is designed to be splice-blocking or translation-blocking. We BLAST the MO sequence to identify on-target and off-target hits (Fig. 12C), and display the MO’s scaffold position in a GBrowse snapshot of each MO page (Fig. 12B), as well as give scaffold positions orange arrow, Fig. 12C). All curated MOs are mapped to the genome and are displayed in the full genome view on GBrowse. Note that MOs are listed on Gene Pages under “Reagents,” and are also displayed on associated Article Page(s), the latter being accessible under “publications” section (Fig. 12D).

Our catalog of MOs can be searched under the Reagents and Protocols menu via the Search Morpholinos using the steps:

1. Choose search options from drop-down menu and enter text in the search field (red arrow, Fig. 12A). Options include:

   • Target gene/mRNA symbol (e.g., sox2).
   • MO name (e.g., sox2 MO2).
   • MO synonym, as used in a publication(s) (e.g., MO-sox2).
   • MO sequence (e.g., AGCTCGGTCTCCATCATGCT GTAC).

2. Hit Search button.

3. A single search hit will go straight to that MO page (e.g., sox2 MO2: XB-MORPHOLINO-17250375). Multiple search hits (such as resulting from a search for “sox2”) will be displayed in a table (Fig. 12A).

4. Click the Xenbase MO name from left hand column to examine details on the MO page (black arrow, Fig. 12A).

5. Click the GBrowse snapshot (Fig. 12B) or the specific scaffold position (orange arrow, Fig. 12C) to view MOs in the full genome browser tool,

6. Use browser back button to return to the MO page or search results table.

Notes/Troubleshooting MOs

• An “Alphabetic Search” is also enabled on the MO search interface.

• MOs can also be found using the Quick Search Menu, using the Xenbase accession number option (e.g., XB-MOR PHOLINO-17249151).

• Nucleotide searches must be exact matches to find a specific MO, and exclude the 5′ prefix and 3′ suffix.

• “Browse All” will provide an alphanumeric list of the entire MO catalog of 2400+ entries, so using at least a gene symbol or synonym will help finding a specific record.

• Click on the GBrowse snapshot to view positional information or search for off-target interactions.

• Xenbase curates MOs (and numbers them in serial sequence) in the order in which they exit our curation pipeline, not in order of publication.

• Gene symbol search uses text-matching, so that a search for MOs to the gene symbol “apln” will return MOs for apln, aplnr, and hapln3.

• Phenotypes generated using a specific MO will be posted on each MO Page as well as on the Article Page, when Phenotypes are launched on Xenbase.

9.4. ORFeome

The Xenopus ORFeome project generated a comprehensive set of 8600+ full-length, end-sequence validated, high quality open reading frame clones in the Gateway cloning system, suitable for recombinant protein expression [37]. ORF sequences represent 7800+ unique genes, including 2724 genes with human ortholog disease association (e.g., optn ORF1, associated with glaucoma (OMIM #137760)). In total the ORFeome clones represent approximately 40% of the nonredundant X. laevis genome [37]. ORFeome reagents allow high-throughput in vivo functional-genomic screening of frog genes in a manner previously not feasible. Details of each ORF clone are given on individual “ORF Page” including gene symbol, gene name, Entrez ID, 5′ and 3′ sequence, predicted translation, confidence estimates, and links to suppliers.

Notes/Troubleshooting ORFeome clones

• Xenbase ORF Page IDs in the form “XB-ORF-#” (e.g., XB-ORF-17287509), can be used on the ORF search page or from the quick search menu using Xenbase Accession option.

• Xenbase does not supply ORFeome clones. Researchers must contact the supplier(s) directly.

9.5. Small Molecules Wiki

Useful small molecules are manually catalogued from published literature in a Wiki format. Entries are listed under the following headings:

1. Alphabetic list with literature references.

2. Small Molecules affecting Pathways: e.g., Retinoic Acid: Citral; or Hedgehog: cyclopamine.

3. Small Molecules affecting Biological Functions and Processes: e.g., angiogenesis: suramin, apoptosis: cyclohexaminde, or neurotransmission: diazepam.

4. Drugs by class: e.g., kinases: KT5720, a specific, cell-permeable inhibitor of protein kinase A (PKA).

Notes/Troubleshooting Small Molecules Wiki

• Registered users can add to this Wiki.

• Minimal information required includes a description, genes/pathways/functions affected, source/supplier, reference(s), as well as a structural diagram (such as those available in PubChem).

• Click the Textpresso link at the bottom of a Wiki entry, to run a search for the term in Xenopus articles.

9.6. Protocols Wiki

Entries are listed under the following headings:

1. Books for Xenopus Research and Protocols

2. Online Resources

   1. Journal of Visualized Experiments (JOVE) video demon-strations, showing protocols and techniques (e.g., host transfer methods of oocyte fertilization; dissections of retinal tissue; electroporation; live-cell imaging for quantitative analysis; and patch clamp and perfusion techniques).
   2. Cold Spring Harbor (CSH) Xenopus Protocols.

3. General Research Protocols covering Animal Husbandry, Lab solution recipes and reagents, Generating Embryos, Transgenesis, in situ Hybridization, Immunohistochemistry, ChIP-Seq protocols, Histology, Embryo Staining Protocols, Immunohistochemistry and Protein Protocols, Nucleic Acid Protocols, Oocyte Transfer Technique, Xenopus Oocyte and Egg Extracts, and Xenopus Tissue Culture.

Notes/Troubleshooting Protocols Wiki

• Reference books, text-books and chapters without PubMed IDs cannot be added to the literature module in Xenbase.

• Both JOVE and CSH Xenopus Protocols require institutional licensing to access.

• Registered Xenbase users can add to the Protocols Wiki.

• Protocols are submitted to Xenbase by specific laboratories, as indicated, and researchers should contact the lab directly (via Xenbase Laboratory profile) to troubleshoot the specific protocol. Contact Xenbase if there are errors or updates in the protocol as published.

9.7. Search Clones

The clone catalog in Xenbase houses data on over one million plasmids developed from both X. laevis and X. tropicalis. Access the clone search interface via Reagents and Protocols menu, and choose from search options: search all, gene symbol (e.g., aldh1a2.L), NCBI/GenBank accession number, clone name (e.g., IMAGE:3421129), source tissue (e.g., cornea, gonad, or oocyte), clone page ID (e.g., XB-CLONE-242125). Each Clone Page gives the clone name, the gene to which it is mapped, and source species, as well as sequence data, Unigene accession number, source/external databases, a description of tissue or embryonic stage from which it was generated, the vector details, and a vector map.

Notes/Troubleshooting Clones

• Wildcard * can be used to search clones.

• Use the checkbox to filter clones only available from the EXRC.

• Alphabetic search is for clone name, not gene symbol (these often do not match).

9.8. Clone Libraries

Several cDNA libraries were used to generate the Xenopus ESTs, many of which are from the Xenopus Gene Collection Library. The Library name and tissue used are listed here for X. tropicalis and X. laevis.

9.9. Vectors

Select this menu option to see a list of standard vectors used in Xenopus research. Click the vector name (e.g., pCS107) to view the plasmid and phagemid Vector Page, with map and supplier details. Use the + toggle to see the sequence if available.

9.10. Obtain Frogs

This table gives contact details of Stock Centers, commercial sup pliers of frogs, oocytes, wet lab and aquarium equipment.

10.1. Article Pages

An Article Page header includes the Xenbase accession number (sequentially numbered as they are added to the database), and each article page carries the following information:

1. Reference: Journal, Title and Authors appear at the top of each entry, followed by a full Abstract, PubMed ID and PMC ID. PubMed/PMC links redirect to the article record at those resources.

2. Article link goes directly to journal website. If the article link is missing, click the PubMed Link to access the journal website. This may require a subscription.

3. Grant support gives details of sources of funding (when available), with a link to the funding website.

4. Genes referenced in the article come from both text matching and manual curation.

5. Antibodies referenced lists the curated primary antibodies used in the research.

6. Morpholinos referenced lists the curated morpholinos used in the research.

7. References cited in the article are listed here, use the [+] to expand. Links to the PubMed record and/or the Xenbase Article Page for the references are provided.

8. Resources URL (when shown) provides links to external databases where raw or supplementary data files are deposited, such as NCBI/GEO or DRYAD (e.g., XB-ART-42630 with micro-array data at NCBI/GEO). Not all article have this link.

9. Article Images and their captions are posted for open access articles and for those journals with whom Xenbase has negotiated permission to redisplay figures. Use the [+] toggle to see full captions. These images may be subject to copyright, and if so, this is indicated.

10.2. Notes/Troubleshooting Article Pages

• Xenbase only curates gene expression data from images that we can display (i.e., when open access or redisplay permission has been obtained from the copyright holder).

• Two new data links will soon be added to the Article Page: ORFeome clones and curated Phenotypes described in the article.

• Use the “thumbs up” or “thumbs down” icons to “vote” on image/data quality.

• Articles can only be uploaded via PubMed ID.

• Articles that do not cite “Xenopus,” and use alternate terms such as “vertebrate” or “amphibian” instead, may be missed by the loader, yet can be manually uploaded via PubMed ID by Xenbase staff and registered users. To do this, log in, click the “Literature/papers” menu heading, then the “Click here to manually add an article by PubMed ID” link.

• Books and book chapters are entered separately under the Literature/Books menu and can be searched via Title, Author, ISBN number, publisher, or Xenbase accession (e.g., XB-BOOK-202).

10.3. Textpresso

Advanced querying of the full text of most Xenopus papers can be achieved by using a Xenbase-specific instance of Textpresso, an information extraction and processing software package for scientific literature developed by the California Institute of Technology, and used under license on Xenbase. Simple keyword searches can be entered in a free text field, and/or up to five category terms can be chosen from a preset list which includes higher level GO terms, experimental techniques and relational terms. The most advanced and flexible option for a Textpresso search is the “Query Language” which is available toward the top of the page, in the menu under the Textpresso logo. This tool allows the user to assemble sets of commands to build complex queries, and allows users not only to specify a variety of query fields, categories, and keywords, but also to set specific thresholds for the number of instances of those key-words and combine previously defined searches using Boolean operators (i.e., AND, OR, NOT).

Notes/Troubleshooting Textpresso

1. The user guide for Textpresso can be found here on Xenbase: http://www.xenbase.org/cgi-bin/textpresso/xenopus/user_guide

2. The “Advanced Search” allows users to specify which sections of the paper should be searched. Select “on” next to the “Advanced search options” text.

3. “Body” option is used for papers that could not be properly sectioned into the other elements. “Scope” option allows a choice between “sentence,” “document,” and “field.” “Sort by” option offers a variety of criteria including year of publication, number of citations, title, author, or score.

4. Option available to exclude supplementary data and/or abstracts.

5. Filter by “Author,” “Journal,” “Year,” or “Doc ID” (i.e., PubMed ID).

6. Too many results? Exclude terms using filter option by entering “+” or “−” signs in front of terms. Enter the field type (e.g., author or title) in square brackets and phrases in double quotes (e.g., “+Patel-Zheng[author]”). Click on the “Filter!” button to activate.

7. Too few results? Broaden the scope by allowing the search to include synonyms for your keywords or by increasing the sections of the literature searched, including “unsectioned” manuscripts.

11.1. Find Researcher, Lab, and Organization Profiles

Register with Xenbase to make a personal and/or lab profile page, with contact details and a description of your research and link papers, which are shown on the “Publications” tab. Click the “Register” link in the top right corner of the site and follow prompts to record your name and contact information, and log-in details. Lab Pages are associated with individual profiles of the Principle Investigator as well as Lab members (e.g., postdocs, graduate students). Find a People, Lab, or Organization profile (e.g., a Xenopus supplier or stock center), by clicking the Community Menu/Tile to the search interface. Search via researcher name, institution or research interests.

11.2. Job Postings

A jobs board is available for registered users to post open positions in a laboratory or institution, and covers all levels of research from entry-level lab technician and student scholarships to professorships and division directors.

11.3. Xine

Xine is a Xenopus community email group hosted at the National Xenopus Resource (NXR). Xine’s goal is to inform researchers about important developments and to disseminate information of wide interest. Xenbase archived Xine releases and supplements from 2001–2011. Xine depends on contributions from members of the Xenopus community for its content. Not a member? Join here: https://lists.mbl.edu/mailman/listinfo/xenopus. If you encounter problems, contact the Xine editor (xenopus@mbl.edu).

11.4. Xenbase Forums

Xenbase forums, an avenue for researchers to take part in Xenopus-related discussion, was relaunched in May 2017, and users must register to post items.

11.5. Meetings and Resources

We provide details to upcoming conferences, workshops, and technical courses relevant to the Xenopus research community. These are updated biannually.

11.6. Xenopus White Papers

The Xenopus Community White Papers, which provide a succinct, authoritative report and literature review of recent Xenopus research, are posted on Xenbase to maximize their distribution. White Papers provide recommendations on how continued, focused funding from the National Institutes of Health (NIH) can maximize the impact of biomedical research using the Xenopus system (see [3]), and therefore they serve as a very useful resource. Researchers are encouraged to reference the most recent Xenopus Community White Papers in their NIH grant proposals.

11.7. International Xenopus Board

We host information and history about the International Xenopus Board (IXB). The IXB was incorporated in 2015 as a tax-exempt, nonprofit organization with a remit to organize a biennial International Xenopus Conference, organize an annual Resources and Emerging Technologies meeting, represent and promote communication among Xenopus researchers, and promote the development and use of Xenopus resources.

Xenbase provides a list of the current members of the IXB and posts documents containing a report on the creation of the IXB, minutes from previous Resources and Emerging Technologies meetings, the by-laws and certificate of incorporation of the IXB.

11.8. Notes/Troubleshooting Community Support Pages

Contact Xenbase (xenbase@ucalgary.ca) to post a meeting or work-shop, or if you find omissions, errors, or bugs in these pages.

12.1. Xenopus Lines

Standardized nomenclature is critical to make research accessible to the broader scientific community and to ensure consistency and provenance, and researchers are encouraged to follow the working Transgenic Nomenclature Guidelines which are posted on Xenbase under the Genes tile on the home page. Xenbase names transgenic (Tg) and mutant lines according to these guidelines, which were developed in consultation with the Xenopus stock centers, following best practices used by all other model organisms (see review in [38]). We only curate published, stable lines, and those available at stock centers using these criteria. Common names or Stock Center shorthand names are recorded as synonyms. For example the Tg line called line “511” or line “275,” has been named officially as Xla.Tg(actc1:GFP)^Amaya. It is a X. laevis (Xla) line with a transgene (Tg) which has the promoter for the X. laevis cardiac actin gene (actc1), driving expression of a green fluorescent protein (GFP); the line comes from the Amaya lab (^Amaya). Each Tg line page (e.g., XB-LINE-935) has an “Attributions” tab which details associated papers, and the “Transgene” tab gives details of the transgenic constructs used to produce the line.

12.2. Xenopus Strains

Wild type strains of Xenopus are named with a species code (Xla or Xtr), geographic origin or common names, and supplier/source (e.g., Xla.J-strain^EXRC or Xtr.Nigerian^NBRP).

12.3. Transgenes

We curate transgenic constructs from published research articles. “Transgenes” are searchable via the “Stock Center” menu. While some of the transgenes are the basis for Tg lines, many have been used for transient transgenesis or are expression constructs. Transgenes are named following the mutant and Tg line nomenclature guidelines, with two exceptions: we omit species prefix and the originating lab code.

12.4. Notes/Troubleshooting

• Consult nomenclature guidelines for Genes, Chromosomes and Tg/Mutant lines when naming your transgenic constructs and frogs.

  • –
    Gene nomenclature: http://www.xenbase.org/gene/static/geneNomenclature.jsp
  • –
    Chromosome nomenclature: http://www.xenbase.org/gene/static/chromosomeNomenclature.jsp
  • –
    Transgenic and Mutant Line nomenclature: http://www.xenbase.org/gene/static/tgNomenclature.jsp

• Contact Xenbase (xenbase@ucalgary.ca) if you experience omissions, errors or bugs in these pages, or if you need advice with nomenclature.