Recombinant RGD-disintegrin DisBa-01 blocks integrin α_vβ₃ and impairs VEGF signaling in endothelial cells

DisBa-01 expression and purification

Recombinant disintegrin DisBa-01, a His-tag protein (GenBank accession AY259516) was produced from a cDNA venom gland library of a Bothrops alternatus snake, as previously described [35]. Strains of Escherichia coli BL21 (DE3) were transformed with a pET28-a plasmid containing the DisBa-01 gene. Bacterial liquid culture was grown before expression assays were performed. Cell lysis extract was purified in a three-step chromatographic process, using an affinity column (HIS-Select® Nickel Affinity Gel, Sigma-Aldrich®), followed by a size-exclusion chromatography (Superdex 75 10/300 GL, GE Healthcare) and an anion exchange column (Mono-Q 5/50 GL, GE Healthcare). Total protein was determined by colorimetric detection of bicinchoninic acid assay (Pierce™ BCA Protein Assay, Thermo Scientific). Recombinant human VEGF₁₆₅ was from Peprotech.

Cell culture

Human umbilical vein endothelial cells (HUVEC, American Type Culture Collection [ATCC® CRL-1730]) were cultivated in Dulbecco’s Modified Eagle Medium (DMEM, Vitrocell) supplemented with 10% fetal bovine serum (FBS, Nutricell), penicillin (10.000 U.I./mL) and streptomycin (10 mg/mL) (Vitrocell). Cells were maintained incubated at 37 °C, on atmosphere with 5% CO₂. Subcultures of cells were performed as instructed by the supplier, using trypsin-EDTA. Cells were used between passages 8 to 15 and counted on a TC20 automated cell counter (Bio-Rad) using trypan blue stain solution at 0.4% (Thermo Scientific).

Cell viability assay

Cell viability or possible cytotoxicity of treatments was tested in a 96-well plate, where HUVECs (5 × 10³ cells/well) were plated on serum-supplemented medium and left to adhere for 24 h on incubator. A 24-h starvation period on serum-free DMEM occurred, followed by the treatment of cells with DisBa-01 (1000 nM) and/or VEGF (10 ng/ml; PeproTech)). Cells were cultured for 24 h at 37 °C, 5% CO₂. Viable cells were identified using MTT solution (0.5 mg/ml of 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide, ThermoFisher Scientific) for 3.5 h. Samples were diluted in isopropanol for measurement of cell concentration by spectrophotometry SpectraMax i3x (OD_{540 nm}, Molecular Devices).

Cell invasion assay

Cell invasion was tested using a 24-well plate Matrigel™ invasion chamber (Corning) previously hydrated with serum-supplemented DMEM. HUVECs (2 × 10⁵ cells/well) were treated with 1000 nM DisBa-01 and/or VEGF (10 ng/ml) on serum-free DMEM medium for 30 min at 4 °C. Cells were pipetted into the Boyden’s chamber whilst it was inserted on well containing DMEM 10% FBS. The negative control comprised of serum-free DMEM on the wells. Invasion was allowed to occur for 18 h at 37 °C. After that, samples were fixed in 4% paraformaldehyde and cell nuclei were stained with DAPI (0.7 ng/μl). Using Vectashield® mounting media (Vector Laboratories), membranes were assembled into slides for cell counting on automated fluorescence microscope system, ImageXpress Micro (Molecular Devices).

Transwell migration assay

The ability of cells to migrate was tested in a transwell assay, using a ThinCert™ translucent PET membrane RoTrac®, 8.0 μm pore (Greiner Bio-one®). HUVECs (1 × 10⁵ cells/well) were exposed to DisBa-01 (1, 10, 100 and 1000 nM), VEGF (10 ng/ml) or VEGF plus DisBa-01 (1000 nM) and immediately inserted into the Boyden’s chamber. The chambers were immersed in 10% FBS medium and allowed to migrate for 6 h at 37 °C. As negative control, chambers were inserted on serum-free medium and incubated as indicated above. Migrated cells were fixated on the membranes with 4% paraformaldehyde and its nuclei were stained in DAPI solution (0.7 ng/μl). Membranes were assembled in histological slides using Vectashield® mounting media (Vector Laboratories) for automated cell counting on ImageXpress Micro microscope (Molecular Devices).

Inhibition of adhesion

HUVECs inhibition of adhesion to fibronectin (FN) and vitronectin (VN) was determined in an assay using a 96-well black plate whose wells were pre-coated with either solution (1 μg/cm² (FN) and 0.2 μg/cm² (VN), Sigma-Aldrich). The negative control comprised coating of 2% BSA. Non-specific binding was blocked with 1% BSA for 1 h at 37 °C, 5% CO₂. After its removal, wells were washed with PBS. Meanwhile, HUVECs (1 × 10⁵ cells/well) were treated with DisBa-01 (1000 nM) and/or VEGF (10 ng/ml) and immediately seeded in their respective wells. Cells were allowed to adhere for 1 h at 37 °C, 5% CO₂. Wells were extensively washed with PBS before fixation using 4% paraformaldehyde solution (pH 7.5) for 15 min. Cell nuclei were stained with DAPI (0.7 ng/μl) and counted automatically using ImageXpress (Molecular Devices).

Endothelial cell tube formation assay

Tubulogenesis assay on Matrigel was performed to evaluate the effect of DisBa-01 on HUVECs tube formation. According to the manufacturer’s instructions, Matrigel solution (Corning® Matrigel® Basement Membrane Matrix, *LDEV-Free) was thawed in a refrigerator at 4 °C overnight. Wells of a pre-cooled 96-well plate was coated with Matrigel (35 μl/well), followed by immediate placement in a humidified CO₂ incubator at 37 °C for 1 h for coating solidification. HUVECs (3 × 10⁴ cells/well) were treated for 30 min with VEGF (10 ng/ml, PeproTech), DisBa-01 (1, 10, 100 and 1000 nM) or VEGF plus DisBa-01 (1000 nM) in DMEM containing 0.5% FBS and then seeded on the solidified Matrigel. The plate was placed in a humidified CO₂ incubator at 37 °C for 14 h to allow the formation of tubes. Images were photographed using the AxionVision Rel.4.8 software of a Vert.A1 microscope (Zeiss) and analysed using the Angiogenesis Analyser plugin for ImageJ software (version 1.51n).

Analysis of gene expression by quantitative PCR

RNA extraction started with the plating of HUVECs (5 × 10⁵/well) in 6-well plates with DMEM 10% FBS, followed by a 24-h starvation period on serum-free medium. Cells were treated with DisBa-01 (1000 nM) and/or VEGF (10 ng/ml) for 24 h and collected for RNA extraction using TRIZOL reagent (Invitrogen). Total RNA was extracted according to the manufacturer’s instructions. RNA pellet was resuspended in nuclease-free water and stored at − 80 °C. Nanodrop 2000 (Thermo Scientific) was used for measuring the RNA concentration and purity (260/280 nm and 260/230 nm ratios). RNA (1 μg) was treated with deoxyribonuclease I, Amplification Grade (Invitrogen) and iScriptTM cDNA Synthesis (BioRad Laboratories) was used for reverse transcription according to the manufacturer’s specifications. CFX 96 real-time PCR detection system (Bio-Rad) was used for qPCR reaction. Each reaction used 20 ng of cDNA, 400 nM of each primer and 5 μl of SsoFast™ Evagreen Supermix (Bio-Rad) in a total volume of 10 μl per reaction. Gene specific primers: KDR sense primer (5′-3′) GTACATAGTTGTCGTTGTAGG antisense primer (3′-5′) TCAATCCCCACATTTAGTTC (Sigma-Aldrich); ITGB-3 sense primer (5′-3′) CTCCGGCCAGAATCC antisense primer (3′-5′) TCCTTCATGGAGTAAGACAG (Sigma-Aldrich) and GAPDH sense primer (5′-3′) GACTTCAACAGCGCGACACCCAC antisense primer (3′-5′) CACCACCCTGTTGCTGTAG (Exxtend). The thermal cycling program was set for 10 min at 95 °C, followed by 40 cycles of 15 s at 95 °C, 30 s at 60 °C and 30 s at 72 °C. After the run, the melting curve was analysed to confirm the specificity of the amplification products. GAPDH was used as a housekeeping gene. The relative expression of qRT-PCR products was determined through ΔΔCt method, in which relative expression was calculated using the following equation: fold induction = 2 ^–ΔΔCt [40].

Flow cytometry

HUVECs (5 × 10⁵/well) were seeded in 6-well plates with DMEM 10% FBS, followed by a 24-h starvation period on serum-free medium. Cells were treated with DisBa-01 (1000 nM) and/or VEGF (10 ng/ml) for 24 h. The characterization of β₃ integrin in HUVECs was measured by flow cytometry using specific fluorescent-labelled antibodies. Cells (1 × 10⁶) were incubated with 1 mg of anti-integrin β₃ antibody (human anti-mouse, 1 μg, Santa Cruz) at 4 °C for 40 min, followed by wash with PBS and centrifugation at 4 °C for 10 min at 1300 rpm. Then, 0.5 mg of secondary antibody (goat anti-mouse IgG, Biosciences BD) labelled with the fluorophore FITC (Fluorescein Isothiocyanate, 2.5 μl/tube) was added to each sample and incubated for 45 min at 4 °C in the dark. Cells were washed with PBS, centrifuged and analysed with Accuri flow cytometer (BD Biosciences).

Western blot

HUVECs (5 × 10⁵ cells/well) were seeded in 6-well plates and left to adhere on an incubator at 37 °C, 5% CO₂, overnight, followed by a period of 24 h of starvation at serum-free medium. Cells were treated with 1 ml of DMEM supplemented with 10% FBS and either DisBa-01 (1000 nM), VEGF (10 ng/ml; PeproTech) or a co-treatment and incubated for 1 and 24 h at 37 °C, 5% CO₂. Cell lysis was performed using 100 μl of lysis buffer (50 mM Tris-HCl pH 7.4, 150 nM NaCl, 1 mM EDTA, 1 mM sodium orthovanadate, 1 mM sodium fluoride, 1% Tween 20, 0.25% sodium deoxycholate, 0.1 mM phenylmethylsulfonyl fluoride, 1 μg/ml aprotinin and 1 μg/ml leupeptin) and the cell lysates were centrifuged at 14000 g, 4 °C for 20 min. Protein content of the supernatant was determined by a BCA Protein Assay Kit (Thermo Fisher Scientific). Cellular proteins (20 μg) were separated on a 20% SDS-PAGE, transferred to nitrocellulose membranes (0.45 μm; Bio-Rad) and blocked with Tween-TBS buffer (140 mM NaCl, 2.6 mM KCl, 25 mM Tris, pH 7.4, 0.05% Tween 20) plus 5% powdered milk. Western Blot was performed using the antibodies anti-phospho-ERK1 + ERK2^Y187 (1:500; Abcam ab47339), anti-phospho-PI3K^Y607 (1:1000; Abcam ab182651), anti-VEGFR2 (1,5 μg/ml; Abcam ab39256), anti-phospho-VEGFR2^{Y1054 + Y1059} (0.5 μg/ml; Abcam ab5473), anti-phospho-Src^Tyr418 (1:1000; Abcam), anti-phospho-paxillin (1:1000; Abcam), anti-phospho-β₃^Y773 (1:1000; Abcam ab38460) and anti-phospho-FAK^Y397 (1:1000; Abcam ab40794) and revealed with a Chemiluminescent Reagent (Sigma Aldrich). After that, membranes passed through stripping and GAPDH (1:1000; Abcam) was used as housekeeping antibody. Bands were visualized on a molecular imager (ChemiDoc™ XRS; Bio-Rad). At least three experiments in triplicate were performed for each protein and the bands were quantified by densitometric analysis using ImageJ FIJI program.

Morphological analysis

HUVECs (3 × 10⁴ cells/well) were plated in a 96-well Microplate μClear® Black CellStar® (Greiner bio-one), previously coated with fibronectin (1 μg/ml), in serum-free DMEM and incubated overnight at 37 °C, 5% CO₂. Cells were exposed to VEGF (10 ng/ml), DisBa-01 (1000 nM) and VEGF plus DisBa-01 for 30 min in DMEM 10% FBS. Afterwards, cells were fixed in 4% paraformaldehyde for 20 min, blocked for 1 h with 1% BSA and incubated with 0.7 μg/ml DAPI (Thermo Fisher Scientific) and Alexa Fluor™ 488 phalloidin (Life Technologies) for 10 min. Fluorescent samples were observed using ImageXpress (Molecular Devices) equipment with 60x magnification.

Co-localization assay

HUVECs (5 × 10⁴ cells/well) were plated in glass coverslips, previously coated with fibronectin (1 μg/cm²), in serum-supplemented DMEM and left overnight in an incubator at 37 °C, 5% CO₂. DisBa-01 (1000 nM), previously labelled using Alexa Fluor® 546 dye (Invitrogen, Thermo Scientific), was added to the cells for 2 min. Samples were fixed in 4% paraformaldehyde for 10 min and permeabilized using 0.5% Triton X-100 for 10 min. Samples were washed with PBS, followed by a 1-h incubation in 5% PBS-BSA to block unspecific sites. Cells were incubated overnight with targeted primary antibodies (1:100 Rabbit pAb to VEGF Receptor 2; 1:100 Mouse Monoclonal to the integrin α_vβ₃, Abcam). Then, secondary antibodies (1:1000 Alexa Fluor 633 goat anti-rabbit, ThermoFisher; 1:1000 Goat polyclonal anti-mouse Alexa Fluor 488, ThermoFisher Scientific) were mixed in 5% PBS-BSA and applied on the wells. After incubation, slides were cleaned and samples were stained with DAPI (Thermo Fisher Scientific) for 10 min. Slides were assembled using ProLong™ Antifade Reagents for Fixed Cells (Thermo Fisher Scientific) and observed on confocal microscope Axio Observer LSM 780 (Zeiss) aided by ZEN BLACK software. Analysis occurred under the same laser intensity for different fluorescences at 63x magnification. Colocalization coefficients were determined using ImageJ FIJI program.

Statistical analysis

Data were obtained from at least three independent series of experiments and analyses were performed using the statistical program GraphPad Prism (version 5.0). Data were expressed as mean ± standard error of the mean (SEM) and intergroup comparisons were made using One-way ANOVA with Bonferroni as post hoc and t test (parametric). Values of p < 0.05 were considered statistically significant.

DisBa-01 blocks several critical steps in angiogenesis

Four different experiments were designed to explore how DisBa-01 could inhibit angiogenesis. Therefore, we stimulated HUVECs with VEGF, treated with DisBa-01 and analysed the changes on proliferation/viability, migration, invasion and adhesion of HUVEC to ECM components. The number of viable endothelial cells was increased by VEGF (34.5%) after a 24-h incubation period as expected, and DisBa-01 alone had no effect on cell viability (Fig.1a). However, DisBa-01 significantly inhibited VEGF-induced proliferation by 61%. HUVEC matrigel invasion was significantly inhibited (58%) by DisBa-01 after 18 h (Fig. 1b) even in the presence of VEGF, which had no effect in this assay. Cells exposed to DisBa-01 (100 and 1000 nM), but not to VEGF, exhibited a significant decrease in cell migration (43 and 49%, respectively) (Fig. 1c). VEGF treatment did not affect cell migration; however, the inhibitory effect of DisBa-01 was higher (69%) in the presence of VEGF (Fig. 1d).

Integrin α_vβ₃ is a multifunctional receptor that binds to at least four RGD-containing adhesive proteins, including FN and VN. We sought to determine how DisBa-01 interferes with HUVEC adhesion to FN and VN. Neither the disintegrin or the growth factor affected cell adhesion to FN (Fig. 1e). However, both DisBa-01 and VEGF increased HUVEC adhesion to VN (Fig. 1f). Interestingly, HUVEC adhesion was lower (41%) when HUVECs were simultaneously treated with the two proteins (Fig. 1f). These results support the hypothesis that the interaction of DisBa-01 with endothelial cell surface receptors prevents VEGF-induced cell proliferation and adhesion to VN.

DisBa-01 inhibits HUVEC tubulogenesis

The formation of tubes is a critical step in angiogenesis and therefore, we tested whether DisBa-01 would interfere in HUVEC tubulogenesis induced by VEGF. HUVEC growth on Matrigel generated a stabilized network of capillary-like structures, as demonstrated by the complexity of the tubular network per field in untreated and VEGF-stimulated cells (Fig. 2). VEGF treatment increased the tube total length (17%), the number of meshes (67%), nodes (47%), master junctions (60%) and the angiogenesis score as expected (Fig. 2a-f).

Next, we tested the effects of DisBa-01 on VEGF angiogenic action. DisBa-01-treated cells produced tubes morphologically distinct from both untreated and VEGF-treated cells (Fig. 2a). The disintegrin also decreased the total tube length (23% at 1 nM; 38% at 100 nM and 26% at 1000 nM) and at the highest concentration (1000 nM) DisBa-01 abolished the stimulatory effect of VEGF, resulting in equal values of control cells (Fig. 2b). Similar results were observed for the number of capillary-like mesh structures, number of nodes and master junctions (Fig. 2c-e). Furthermore, we calculated the angiogenesis score (analysed area x tube length x total of branches) which indicated that DisBa-01, in most tested concentrations, inhibited tube formation (56%, Fig. 2f) and the VEGF effect (40%, Fig. 2f). These results demonstrate that DisBa-01, at least at 1000 nM, negatively modulated VEGF angiogenic effects. We did not test the effect of lower concentrations of DisBa-01 plus VEGF.

DisBa-01 inhibits VEGFR2 but not β₃ expression

Attempts to elucidate the mechanisms of inhibition of angiogenesis by DisBa-01 included the analysis of VEGF receptors and β₃ integrin subunit expression in vascular endothelial human cells under VEGF and DisBa-01 treatments. DisBa-01 does not affect β₃ protein expression as determined by flow cytometry (Additional file 1: Figure S1A). In addition, DisBa-01 treatment did not affect mRNA levels of β₃ integrin subunit in either VEGF-treated and untreated groups (Additional file 1: Figure S1B).

DisBa-01 down-regulated VEGFR2 protein expression in cell lysates after 1 h of exposure when compared to the VEGF-stimulated and unstimulated groups (Fig. 3a). VEGFR2 levels were back to normal after 24 h. VEGF treatment alone did not affect VEGFR2 protein expression. Furthermore, DisBa-01 treatment did not affect mRNA levels of VEGFR2 (Fig. 3b) in both VEGF-treated and untreated groups.

DisBa-01 impaired VEGFR2 and β₃ cross-talk

The interaction between β₃ and VEGFR2 occurs in synergism. The signalling for VEGFR2 phosphorylation is originated on β₃ phosphorylation, a process initiated by VEGFR2 activation after its ligation to VEGF [20]. We evaluated whether DisBa-01 could interfere in this cross-talk. VEGFR2 phosphorylation was significantly increased under VEGF stimulation; however, this effect was inhibited by 1000 nM DisBa-01 (Fig. 4a). Likewise, as shown in Fig. 4b, VEGF also induced β₃ phosphorylation, which was also reversed by DisBa-01. These data suggest that DisBa-01 impaired the cross-talk between α_vβ₃ and VEGFR2, which is crucial for angiogenesis regulation. β₃ phosphorylation induced by VEGF was observed only at 1 h after the treatments, and was normalized after 24 h.

The anti-angiogenic effect of DisBa-01 is sustained by ERK1/2 inhibition

Activation of VEGF-A/VEGFR2 signalling cascade induces angiogenesis by promoting EC proliferation, survival, migration and morphogenesis. This occurs partially through the activation of the mitogen-activated protein kinase/extracellular-signal-regulated kinase-1/2 (ERK1/2) and partially through phosphatidylinositol-3-kinase (PI3K)/Akt signal transduction pathways [41]. We determined how DisBa-01 affects crucial VEGFR2 signalling pathways on VEGF-induced cells. VEGF increased ERK1/2 phosphorylation 1 h (33%) and 24 h (62%) after incubation compared with the unstimulated group (Fig. 5a). However, DisBa-01 decreased VEGF-induced ERK1/2 phosphorylation at 1 h (63.6%) and 24 h (87%). The phosphorylation status of PI3K was only altered by DisBa-01 on VEGF-induced cells after a 1-h treatment (36.6% of inhibition) (Fig. 5b). These results clearly illustrate that DisBa-01 sustained the angiogenesis inhibition at least by 24 h by blocking VEGFR2-mediated ERK1/2 signalling pathways.

DisBa-01 changes F-actin organization in HUVECs

Endothelial cell adhesion to the ECM is mostly mediated by integrins, whose activation changes cytoskeleton proteins through the binding of signalling molecules such as FAK. FAK is a 125-kDa cytoplasmic tyrosine kinase protein found at adhesion sites responsible for activation of cell adhesion, motility and survival responses. Most importantly, FAK is the main transducer of the integrin-mediated signalling pathway required to stabilize the actin cytoskeleton, by creating a kinase complex with SrC which uses paxillin as a major substrate [42, 43]. DisBa-01 inhibited migration and changed the morphology of tubes, leading to the questioning of whether DisBa-01 could interfere with VEGF-mediated response in FAK/SrC/paxillin signalling. VEGF increased FAK and SrC phosphorylation after 1 h but DisBa-01 did not affect this response (Fig. 6a-b). Although SrC and paxillin phosphorylation remained unaffected by VEGF in 24 h, the phosphorylation of both proteins was increased by DisBa-01 in VEGF-induced cells at this time (Fig. 6b-c).

In order to evaluate the morphological changes in HUVECs treated with DisBa-01 and/or VEGF, cells were stained using a fluorescent green probe to F-actin (phalloidin). VEGF treatment did not change cell morphology but DisBa-01 induced evident structural changes in the cell appearance (Fig. 7). Cells lose protrusions and acquire a circular format, as an indirect consequence of integrin blocking by DisBa-01, resulting in loose adhesions that in turn affect FAK/SrC/paxillin downstream signalling and actin re-organization. These events will contribute to impaired cell migration.

DisBa-01 co-localizes with α_vβ₃ and VEGFR2

We next tested if DisBa-01 co-localizes with α_vβ₃ integrin and VEGFR2 during cell spreading in FN. The fluorescence signal for Alexa Fluor-546 labelled DisBa-01 (red color) was detectable on the cell surface 5 min after treatment (Fig. 8a-b and Additional file 2: Figure S2) and co-localizes with α_vβ₃ (green color, Fig. 8a-b) and VEGFR2 (blue color, Fig. 8a-b and Additional file 3: Video S1). Mander’s and Pearson’s Colocalization Coefficients are represented in Fig. 8c.

Author’s information

All authors are from the Laboratory of Biochemistry and Molecular Biology, Department of Physiological Sciences, Federal University of São Carlos at São Carlos, São Paulo State, Brazil.

Ethics approval and consent to participate

Not applicable.

Consent for publication

All authors have read this manuscript and approved for the submission.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.