A core viral protein binds host nucleosomes to sequester immune danger signals

Cells

Primary small airway epithelial cells (SAECs), U2OS, HeLa, 293, THP-1 and A549 cells were obtained from the American Tissue Culture Collection (ATCC) and grown according to the provider’s instructions. Cell lines were not authenticated or tested for mycoplasma. Acceptor cells for generation of inducible cell lines were kindly provided by E. Makeyev and used as previously reported³¹. Protein VII, preVII and V were cloned from genomic DNA isolated from HeLa cells infected with adenovirus type 5 and inserted into the inducible plasmid cassette with a C-terminal HA tag using restriction enzymes BsrGI and AgeI (primer sequences available upon request). Positive clones were selected in DH5α cells, sequenced, and transfected into A549, U2OS or HeLa acceptor cells along with plasmid expressing the Cre recombinase. Recombined clones were selected by puromycin resistance (1 µg/mL) and induced with doxycycline (0.2 µg/mL) to express the desired protein. Protein expression was verified by immunofluorescence and western blot. All figures shown are after 4 days of induction unless otherwise stated. Protein VII and preVII were also verified by HPLC purification and mass spectrometry analysis. Point mutations were generated by gene synthesis from Genewiz. 293-Cre cells were provided by from P. Hearing.

Viruses and infections

Wild-type adenovirus type 5 (Ad5), adenovirus type 9 (Ad9), adenovirus type 12 (Ad12), and recombinant adenovirus vectors expressing only GFP were propagated in 293 cells as previously described³². Recombinant adenovirus vector with VII-GFP replaced in the E1 region was a kind gift from D. Curiel³³. Infections were carried out as described previously³⁴ using a multiplicity of infection of 10 for primary cells and cell lines for Ad5 infections. Ad9 and Ad12 infections were carried out with a multiplicity of infection of 50 and 20, respectively. Ad5-flox-VII was generated by P. Hearing and also prepared using standard methods in 293 cells. LoxP sites were added flanking protein VII in the Ad5 genome resulting in protein VII deletion during infection of 293 cells expressing Cre recombinase.

Antibodies

Primary antibodies were purchased from Covance (HA MMS-101R), Abcam (H1 ab4269, H3 ab1791, HMGB1 ab18256, HMGB2 ab67282), Millipore (H2A 07-146, prosurfactin-C AB3786), and Santa Cruz (Ku86 sc5280, tubulin sc69969). The antibodies to DBP, adenoviral late proteins, terminal protein and protein VII were kind gifts from A. Levine³⁵, J. Wilson³², R. Hay and L. Gerace, respectively. Secondary antibodies for immunoblotting were obtained from Jackson ImmunoResearch and secondary antibodies for immunofluorescence were obtained from Life Technologies.

Immunofluorescence

Cells were grown on glass coverslips in 24-well plates and either infected or induced with doxycycline (0.2 µg/mL). Cells were harvested for immunofluorescence at the indicated time points, washed in phosphate-buffered saline (PBS), fixed in 4% paraformaldehyde for 15 minutes and post-fixed with 100% ice-cold methanol for 5 minutes. Coverslips were then blocked and stained as previously described³⁶ and mounted using ProLong Gold Antifade Reagent (Life Technologies). Immunofluorescence was visualized using a Zeiss LSM 710 Confocal microscope (Cell and Developmental Microscopy Core at UPenn) and ZEN 2011 software. Images were processed using ImageJ and assembled with Adobe CS6. All scale bars show in the figures are 10µm unless otherwise stated.

Immunoblotting

Western blot analysis was carried out using standard methods. Briefly, equal amounts of total protein lysates were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a nitrocellulose membrane (Millipore) for at least 30 minutes at 30V. Membranes were stained with ponceau to confirm protein loading and blocked in 5% milk in TBST containing 0.1% azide. Membranes were incubated with primary antibodies overnight, washed for 30 minutes in TBST and incubated with secondary antibodies conjugated to horseradish peroxidase (Jackson Laboratories) for 1 hour. Membranes were washed again and proteins were visualized with Pierce ECL Western Blotting Substrate (Thermo Scientific) and detected using a Syngene G-Box.

Mice

All mice were housed in SPF conditions in an animal facility at the Children’s Hospital of Philadelphia. All studies in mice were carried out in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health and approved by the Institutional Animal Care and Use Committee, Children's Hospital of Philadelphia Animal Welfare Assurance Number A3442-01. C57BL/6J male mice aged 8–10 weeks were used for experiments. Mice were sedated with ketamine and xylazine. Once sedated, mice underwent orotrachial intubation, as previously described³⁷, with a 20G angiocatheter from BD (Franklin Lakes, NJ). Mice subsequently received 5e10 GC of recombinant adenovirus expressing VII-GFP or GFP purified by the Penn Vector Core as described above. Four days after infection, mice were exposed to aerosolized LPS, 3 mg/mL for 30 minutes as previously described³⁸. One day after LPS exposure, BAL, and lung tissue were harvested as previously detailed³⁹ and examined for HMGB1 content (ELISA, Chondrex 6010) and neutrophil count (hematoxylin and eosin stain kit EMD 65044/93). Immunostaining was carried out by the CHOP Pathology Core using standard methods. A minimum of four biological replicates were used for each condition studied. Mice were assigned a random number and color at the start of the experiment and were randomized. Technicians carrying out the experiments were blinded to the identity of the samples. Tissue samples were assigned a random study number such that the technician performing the analysis was blinded. Unblinding for the purpose of data analysis occurred only after all data had been collected.

Salt fractionation of nuclei

Salt fractionation of nuclei was adapted from established protocols^16,40. Briefly, 2–4 × 10⁷ cells were collected and resuspended in 2 mL of ice-cold buffer I (0.32 M sucrose, 60 mM KCl, 15 mM NaCl, 5 mM MgCl₂, 0.1 mM EGTA, 15 mM Tris, pH 7.5, 0.5 mM DTT, 0.1 mM PMSF and protease inhibitor cocktail from Roche). To dissolve the plasma membrane, 2 mL ice-cold buffer I supplemented with 0.1% IGEPAL were added and samples were incubated on ice for 10 minutes. The 4 mL of nuclei was layered on 8 mL of ice-cold buffer II (1.2 M sucrose, 60 mM KCl, 15 mM NaCl, 5 mM MgCl₂, 0.1 mM EGTA, 15 mM Tris, pH 7.5, 0.5 mM DTT, 0.1 mM PMSF and protease inhibitor cocktail from Roche) and centrifuged for 20 minutes at 10,000 × g and 4°C. The pelleted nuclei were resuspended in 400 µL buffer III (10 mM Tris pH 7.4, 2 mM MgCl₂, 0.1 mM PMSF) supplemented with 5mM CaCl₂ and the DNA was digested to mononucleosomes by addition of 1 unit of MNase (Sigma-Aldrich, N3755). The reaction was incubated at 37°C for 30 minutes and then stopped by addition of 25 µL of 0.1M EGTA. The samples were centrifuged for 10 minutes, 350 × g, at 4°C, and supernatants were set aside for western blot analysis. The pellet was resuspended in 400 µL of buffer IV (70 mM NaCl, 10 mM Tris pH 7.4, 2 mM MgCl₂, 2 mM EGTA, 0.1% Triton X-100, 0.1 mM PMSF) with 80mM salt and rotated for 30 minutes at 4°C. The sample was centrifuged for 10 minutes at 350 × g, 4°C, and the supernatant collected for western blot analysis. This step was repeated for salt concentrations in buffer IV of 150 mM, 300 mM and 600 mM. The final pellet was resuspended in 400 µL ddH₂O and all samples were analyzed together by western blot. An aliquot of each supernatant was set aside for DNA purification using a PCR purification kit (Qiagen) and analyzed by agarose gel electrophoresis. Alternatively, 4 × 10⁷ cells were resuspended in 400 µL hypotonic buffer (10 mM HEPES pH = 7.9, 1.5 mM MgCl₂, 10 mM KCl, 1:1000 PMSF, 0.5 mM DTT) and incubated on ice for 30 min. The cells were transferred to a 1 ml dounce tissue grinder and the cell membranes were gently disrupted with 40 strokes of a tight-fitting pestle. The samples were centrifuged for 5 min at 1,500g and 4°C. The pelleted nuclei were resuspended in 400 µL buffer III and the fractionation was continued as described above.

Preparation of salt fractions for mass spectrometry analysis

All chemicals used for preparation of mass spectrometry samples were of at least sequencing grade and purchased from Sigma-Aldrich (St Louis, MO), unless otherwise stated. Only the 600 mM salt fraction was used for LC-MS/MS analysis. The 0.1% TritonX-100 detergent was removed from samples prior MS analysis by precipitation using chloroform (CHCl₃)-methanol (MeOH) precipitation⁴¹. The protein pellet from CHCl₃-MeOH precipitation was resuspended in 6 M urea and 2 M thiourea in 50 mM ammonium bicarbonate. Samples were reduced with 10mM DTT for 1 hour at room temperature and the carbamidomethylated with 20 mM iodoacetamide for 30 minutes at room temperature in the dark. After alkylation proteins were digested first with endopeptidase Lys-C (Wako, mass spectrometry grade) for 3 hours, after which the solution was diluted 10 times with 20 mM ammonium bicarbonate. Subsequently, samples were digested with trypsin (Promega) at an enzyme to substrate ratio of approximately 1:50 for 12 hours at room temperature. The samples were acidified with 5% formic acid (FA) to a pH ≤ 3 and desalted using Poros Oligo R3 RP columns (PerSeptive Biosystems) packed in a P200 stage tip with C₁₈ 3M plug (3M Bioanalytical Technologies). Purified peptide samples were dried by lyophilization and stored at −20°C until further analysis. This procedure was carried out for three biological replicas.

Nano LC-MS/MS and analysis of salt fractions

Samples were loaded onto a 16 cm C₁₈–AQ column (inner diameter 75 µm, 3 µm beads, Dr, Maisch GmbH, Germany) using an Easy nano-flow HPLC system (Thermo Fisher Scientific, Odense, Denmark). The nanoLC was coupled to an Orbitrap Fusion Tribrid Mass Spectrometer (Thermo Fisher Scientific, San Jose, CA) via a nanoelectrospray ion source (Thermo Fisher Scientific, San Jose, CA). Peptides were loaded in buffer A (0.1% formic acid) and eluted with a 120 minute linear gradient from 2–30% buffer B (95% acetonitrile, 0.1% formic acid). After the gradient, the column was washed with 90% buffer B. Mass spectra were acquired using a data-dependent acquisition method with the TopSpeed set with 3-second cycle. Spectra were acquired in the Orbitrap analyzer with mass range of 350–1200 m/z and 120,000 resolution (200 m/z), with a maximum injection time of 50 msec and an AGC target of 5×10e5. Signals with 2–5 charges were selected for HCD fragmentation using a normalized collision energy of 27, a maximum injection time of 120 msec and an AGC target of 10,000. Fragments were analyzed in the ion trap. Raw MS files were analyzed by MaxQuant (v1.5.2.8)⁴² (http://www.maxquant.org). MS/MS spectra were searched against the UniProt-human database (Version June 2014, 59,345 entries). All used search parameters were default, with the exception of including the match between runs (1 minute window) and the iBAQ label-free quantification⁴³. The search included variable modifications of methionine oxidation and N-terminal acetylation, and fixed modification of carbamidomethyl cysteine. Each iBAQ value was log₂ transformed and subsequently normalized by the average protein abundance within each run. Biological process association analysis and process network enrichment were performed using the GeneGo's MetaCore pathways analysis package with false discovery rate (FDR) <5%; each GO term was ranked using p-value enrichment.

Purification of recombinant protein VII-His

Protein VII was cloned from genomic DNA isolated from adenovirus infected HeLa cells into a pET21a backbone to generate a C-terminal hexahistidine tag. Positive clones were selected in DH5α cells, sequenced, and transformed into BL21 (DE3) cells (NEB C2527I). The purification of insoluble protein VII-His was adapted from existing protocols to purify histone proteins from E. coli^44,45. Briefly, BL21 cells were inoculated from overnight cultures and grown to an optical density of 0.5–0.6 OD₂₆₀, induced with 0.1 mM IPTG (Sigma) and harvested after 4 hours at 37°C. Cells pellets were resuspended in a mild buffer (50 mM Tris-HCl pH 8.0, 500 mM NaCl, 1 mM PMSF, 5% glycerol, 2.5 µg/mL aprotinin, leupeptin and pepstatin) and disrupted by sonication using a Branson 250 sonifier. The lysate was then centrifuged at 27,000 × g for 20 minutes at 4°C. The supernatants were discarded and pellets were resuspended in a denaturing buffer (50 mM Tris-HCl, pH 8.0, 500 mM NaCl, 5% glycerol, 8 M urea). The suspension was centrifuged again to eliminate insoluble cell debris and the his-tagged protein was isolated using a cobalt resin (ThermoScientific 89964) according to the manufacturer’s instructions for denaturing conditions. The purified protein was then dialyzed against water and lyophilized. Purified protein was verified by western blot and mass spectrometry.

In vitro binding assays

HMGB1-GST (Abnova) or GST (Sigma) were combined with recombinant protein VII-His at equimolar ratios and incubated at 4°C for 1 hour. Complexes were then mixed with a cobalt resin (ThermoScientific 89964) to bind protein VII-His and any associated protein and washed three times in the binding buffer (50 mM Tris pH 8, 300 mM NaCl, 0.1% IGEPAL). The beads were then boiled in sample buffer, separated on a 4–12% NuPage gel and visualized by coomassie staining.

Nucleosome in vitro binding and MNase digestion assays

Gel shift and MNase digestion assays were carried out as previously described^17,46,47. Briefly, nucleosomes were reconstituted by incubating purified recombinant histones with ‘601’ DNA of either 195 or 147bp over a series of dialysis. Recombinant protein VII-His was then combined with nucleosomes at various molar ratios, incubated at room temperature for 15 minutes, and analyzed by native gel electrophoresis. Complexes were also digested with MNase (Affymetrix) by addition of 1 unit per µg of DNA for 147bp nucleosome experiments and 0.1 unit per µg of DNA for 195bp nucleosome experiments, incubated at 22°C for varying amounts of time followed by the addition of EGTA and guanidine thiocyanate to stop the reaction. The DNA fragments were then purified using a MinElute PCR purification kit (Qiagen) and analyzed on an Agilent 2100 Bioanalyzer as previously described¹⁷.

Release assay of HMGB1 in THP-1 cells

THP-1 cells were seeded at a density of 2 × 10⁵ cells per well in a 24-well plate, and stimulated into macrophage-like cells by addition of 10 ng/mL PMA for 48 hours. Cells were washed in PBS and transduced with recombinant adenovirus vectors expressing only GFP or protein VII-GFP such that > 90% of cells were GFP positive. At 48 hours post transduction, cells were washed and 200 µL of serum free RPMI was added. To stimulate the inflammasome, LPS (Sigma-Aldrich L2880) with a final concentration of 0.5 µg/mL was added to wells and incubated for 2 hours, then nigericin (Sigma-Aldrich N7143) was added with a final concentration of 10 µM for 1 hour. Supernatants were collected and proteins precipitated overnight at 4°C with a final concentration of 20% trichloroacetic acid (Sigma), washed with acetone, dried, and resuspended in 1× sample buffer with reducing agent (Invitrogen). For ELISA analysis, supernatants were harvested directly and HMGB1 content was detected by the manufacturer’s instructions (Chondrex 6010). Cells were also harvested by the addition of 1× sample buffer with reducing agent (Invitrogen) and boiled. Supernatants and lysates were analyzed together by western blot.

Acid extraction and Reverse Phase-HPLC for purification of protein VII and analysis of total histone PTMs

Histones were prepared for mass spectrometry analysis as detailed previously⁴⁸. Nuclei were isolated and histones from infected cells were extracted by acid as previously described¹⁴. The pre-protein VII and protein VII variants were fractionated using an offline RP-HPLC. Briefly, ~100 µg proteins were resuspended in buffer A (0.1% trifluoroacetic acid (TFA) in HPLC grade water) and loaded onto a C₁₈ 5µm column (4.6 mm internal diameter × 250 mm, Vydac) using a Beckman Coulter (System Gold, Brea, CA) HPLC (Buffer A: 0.1% TFA, Buffer B: 95% acetonitrile, 0.08% TFA). The proteins were separated using a gradient from 30–45% buffer B in 100 minutes at a flow-rate of 0.2 mL/min. The fractions containing the proteins of interest were collected using an automatic fraction collector and individual peaks combined based on their UV signal. The fractions were subsequently dried by vacuum centrifugation and prepared for mass spectrometry (see below). Protein VII was purified from three biological replicates and analyzed as follows for MS.

Mass spectrometry analysis of protein VII PTMs

Co-immunoprecipitation of protein VII-HA

A549 cells were induced to express protein VII with doxycycline for four days as described above. Approximately 4 × 10⁷ cells were harvested and pelleted for each immunoprecipitation reaction. Cell pellets were resuspended in 500 µl of IC wash buffer with protease inhibitors (20 mM HEPES pH 7.9, 110 mM KOAc, 2 mM MgCl₂, 150 mM NaCl, 0.1% Tween-20, 0.1% Triton X) and incubated on ice for 10 minutes with intermittent vortexing to disrupt cells. Samples were then incubated on ice for 1 hour with 5 µl of benzonase (Millipore) added to each sample to digest DNA to ~150bp, which was confirmed by DNA isolation and agarose gel analysis. Samples were then sonicated in a Diagenode Bioruptre for 30s on and 30s off for five rounds at 4°C and centrifuged at 14,000 g for 15 minutes at 4°C. Supernatants were then incubated rotating for 1 hour at 4°C with 30 µl of HA-conjugated magnetic beads (Thermo Scientific) and washed three times for five minutes in IC buffer. Isolated proteins were eluted with 100 µl of 2mg/ml HA peptide (Thermo Scientific) for 20 minutes rotating at 37°C and separated on and SDS-PAGE gel. For protein separation by SDS–PAGE the NuPAGE 1DE System was used (NuPAGE Novex 4–12% bis–tris 1.0 mm gels, Invitrogen, USA). Uninduced cells were used as a negative control. The immunopreciptation was carried out in biological triplicate and pull-down of protein VII-HA and HMGB1 was confirmed by western blotting standard techniques as described above.

Quantitative PCR

Genomic DNA was isolated using the PureLink Genomic DNA kit (Thermo Scientific). Quantitative PCR was performed using primers specific for viral DBP (5’ gccattgcgcccaagaagaa and 5’ ctgtccacgattacctctggtgat), protein VII (5’ gcgggtattgtcactgtgc and 5’ cacccaatacacgttgccc), and cellular tubulin (5’ ccagatgccaagtgacaagac and 5’ gagtgagtgacaagagaagcc). Values for DBP and VII were normalized internally to tubulin and to the 4 hour time point to control for any variation in virus input. RNA was isolated using the RNeasy Mini Kit (Qiagen) and reverse transcribed using the High Capacity RNA to cDNA Kit (Applied Biosystems). Quantitative PCR was performed using primers specific for HMGB1 (5’ taactaaacatgggcaaaggag and 5’ tagcagacatggtcttccac) and beta actin (5’ gcaccacaccttctacaatgag and 5’ ggtctcaaacatgatctgggtc). Quantitative PCR was performed using the standard protocol for Sybr Green (Thermo Scientific) and analyzed using the ViiA 7 Real-Time PCR System (Thermo Scientific).

Precision cut lung slice (PCLS) immunofluorescence

PCLS were obtained and prepared as previously described^27,49. De-identified human lung tissue from donors was obtained from the National Disease Research Interchange (NDRI), Philadelphia, PA. Analysis of human samples was approved by the University of Pennsylvania Internal Review Board. Samples were infected with 10⁸ pfu of Ad5 per slice or 10⁹ GC of rAd VII-GFP for 24 hours. Samples were fixed in 4% PFA at room temperature for 15 minutes and washed three times in PBS. Samples were permiabilized with 0.5% Triton X and washed twice more in PBS. Samples were then incubated with 3% BSA and 0.03% Triton X in PBS for 1 hr to block. Primary antibodies (DBP or HMGB1) were incubated in the same buffer for 1 hr and then samples were washed three times in PBS with 3% BSA, incubated with secondary antibodies and DAPI for 1 hr, and washed three more times. Whole slices were mounted on slides with mounting solution and imaged by confocal microscopy.

Fluorescence recovery after photobleaching (FRAP)

Full-length HMGB1 was cloned from pcDNA3.1 Flag-hHMGB1 (Addgene 31609) into pEGFP-N1 containing a L221K mutation to prevent dimerization of GFP molecules⁵⁰. A549 cells were induced to express protein VII for four days with doxycycline in glass-bottom dishes. Cells were then transfected with the construct that constitutively expresses HMGB1 with a monomeric GFP C-terminal tag. FRAP was carried out using standard methods on a Zeiss LSM 710 confocal microscope. Diffusion coefficients were calculated using the “simFRAP” algorithm (http://imagej.nih.gov/ij/plugins/sim-frap/index.html), a simulation based approach to FRAP analysis⁵¹.

Statistical analyses

Statistical details are reported in each figure legend. Statistical analyses were performed on at least three different biological replicates, unless otherwise stated in the figure legend. The sample size was chosen to provide enough statistical power to apply parametric tests (one- or two-tailed homoscedastic t-test). The t-test was considered as valuable statistical test since binary comparisons were performed and the number of replicates was limited. Furthermore, we applied the homoscedastic t-test assuming that the variance between the two datasets would remain homogeneous due to the use of the same cell lines in culture with and without protein VII expression. No samples were excluded as outliers (this applies to all proteomics analyses described in this manuscript). Proteins with p-value smaller than 0.05 were considered as significantly altered between the two tested conditions for two-tailed and one-tailed t-test. Data distribution was assumed to be normal but this was not formally tested. The nanoLC-MS analysis was performed in triplicate for each sample to determine technical variation.