Self-Assembled Antibody Multimers through Peptide Nucleic Acid Conjugation

PNA synthesis

NovaPEG Rink Amide resin, Boc-protected aminooxy acetic acid and all peptide related reagents were purchased from Novabiochem®, and were swollen in CH₂Cl₂ before each reaction. PEG spacer (Fmoc-8-amino-3,6-dioxaoctanoic acid) was purchased from ASM (http://www.asm-research-chemicals.com/). PNA monomers were prepared as previously reported (Mtt-protected monomers¹⁸; Fmoc protected monomers¹⁹). Arginine-modified bases (indicated in bold) were added to increase solubility and reduce aggregation of the PNAs. Automated solid phase synthesis was carried out on an Intavis Multipep RS instrument. LC-MS analyses were carried out using an HP 1100 series or Thermo Electron Corporation HPLC with a Thermo Finnigan Surveyor MSQ Mass Spectrometer System. A Thermo Scientific column (50 × 2.1 mm) was used. MALDI spectra (2,5-dihydroxybenzoic acid matrix) were obtained using a Bruker Daltonics Autoflex II TOF/TOF spectrometer. Reverse phase chromatography was performed on a Biotage Isolera One Instrument using a H₂O-MeCN (with 0.01% TFA) gradient from 100-0% to 0-100%. See Supplemental methods for detailed synthesis.

Synthesis of Fab Multimers

200 μM Fab and 100 mM methoxy aniline catalyst (final concentration) were added to a reaction containing 15-30x excess of aminooxy-modified PNA (N’-H₂NO-(EG)_n-ACGCAACGCGGC-C’), 20% DMSO (final concentration) and 100 mM acetate buffer (pH 4.5). After 48 hours at 37 °C, the excess PNA was removed by either Amicon filtration (30 kD MWCO) or size exclusion chromatography (GE Healthcare, Superdex 75). The reaction was buffer exchanged into PBS (pH 7.4) and analyzed by SDS-PAGE and mass spectrometry. Oligonucleotide conjugation to αHer2 Fab was carried out as previously described²⁰. The complementary PNA strand (N’-H₂NO-(EG)_n-GCCGCGTTGCGT-C’) was coupled using the same procedure. The conjugates were hybridized 1:1 (~10 μM, PBS pH 7.5, 30 min at 37 °C) and the dimer was purified using size exclusion chromatography (GE Healthcare, Superdex 200). To create the Fab tetramer, four orthogonal PNA sequences were conjugated separately to either αHer2 S202 pAcF Fab or αCD20 S202 pAcF Fab. The PNA sequences are as follows: A) N’-H₂NO-(EG)₂-ATCCTGGAGC-(EG)-TAAGTCCGTA-C’, B) N’-H₂NO-(EG)₂-TACGGACTTA-(EG)-TCAATGAGGC-C’, C) N’-H₂NO-(EG)₂-GCCTCATTGA-(EG)-ATCATGCCTA-C’, and D) N’-H₂NO-(EG)₂-TAGGCATGAT-(EG)-GCTCCAGGAT-C’. After removal of excess PNA, the Fab-PNA conjugates were further purified on a hydrophobic interaction column (GE Healthcare, Buffer A: 50 mM phosphate, 10 mM (NH₄)₂SO₄, pH 7.5, Buffer B: 50 mM phosphate, 750 mM (NH₄)₂SO₄). The Fab-PNA conjugates were then hybridized 1:1:1:1 (~10 μM, PBS pH 7.5, 30 min at 37 °C) and the tetramer was purified using size exclusion chromatography (Superdex 200).

Her2 Phosphorylation Assay

SK-BR-3 cells (ATCC) were grown to 80% confluency in DMEM, 10% FBS and detached with 1 mL Trypsin-EDTA (Invitrogen). Cells were diluted 1:10 in media, and 100uL (~10⁴ cells) were plated in white 96-well tissue culture plates (Corning). After overnight adherence, αHer2 Fab conjugates were added to the cells (2.5 μg/mL for DNA conjugates or 0.09-6 μg/mL for PNA conjugates) and incubated at 37 °C for 45 minutes. Media was aspirated and 100 μL lysis buffer was added to each well (IC Diluent#12, R&D Systems, 10 μg/mL Aprotinin, 10 μg/mL Leupeptin) and incubated at 4°C for 30 minutes. We prepared the ELISA plate (Nunc, maxisorp) by adsorbing 4 μg/mL phospho-ErbB2 capture antibody (DuoSet IC Human Phospho-Erbb2 ELISA, R&D Systems) in 100 μL per well overnight at room temperature. Wells were washed with PBST (PBS pH 7.4, 0.05% Tween 20) five times and blocked with 300 μL blocking buffer (1% BSA, 0.05% NaN₃, PBS pH 7.4) for 1 hour. Wells were washed immediately prior to addition of the cell lysate, which was incubated at room temperature for 2 hours. The anti-phospho-tyrosine-HRP detection antibody was diluted to the working concentration specified on the vial in IC Diluent #14 (20mM Tris, 140mM NaCl, 0.05% Tween 20, 0.1% BSA, pH 7.4). The plate was washed five times and 100 uL of diluted detection antibody was added and incubated at room temperature for 2 hours. The plate was again washed five times with wash buffer prior to addition of the detection reagent, QuantaBlue (Pierce). After 10 minutes, the relative fluorescence was measured (ex. 325, em. 420) using a SpectraMax 250 plate reader (Molecular Devices Corp.). Each experimental test was performed in triplicate. Error bars represent the standard deviation.

Cytotoxicity Assays

Peripheral blood mononuclear cells (PBMCs) were purified from fresh healthy human donor blood by conventional Ficoll-Hypaque gradient centrifugation. Purified PBMCs were washed and incubated in flasks in RPMI media with 10 % FBS for 2 hours to remove adherent cells, and then transferred to αCD3 (eBioScience) and αCD28 (eBioScience) antibody coated ELISA plates at 37 °C. After 3 days, the activated PBMCs were washed once with media and transferred into a flask and incubated with 20 units/mL IL2 (R&D Systems) for T cell proliferation. HER2-transformed MDA-MB-435 or non-transformed MDA-MB-435 cells (target cells) were dissociated with 0.05 % tryspin/EDTA solution (HyClone) and washed with RPMI with 10 % FBS. 1×10⁴ target cells were mixed with PBMCs at 1:10 ratio in 100 μL, and incubated with different concentrations (0.1 pM-10 nM) of αHER2-αCD3 PNA heterodimer or unconjugated Fabs (10 μL in media) for 16 hours at 37 °C. Cytotoxicity was measured based on LDH (lactate dehydrogenase) levels in supernatant using a Cytotox-96 non-radioactive cytotoxicity assay kit (Promega). The absorbance at 490 nm was recorded using SpectraMax 250 plate reader (Molecular Devices Corp.). Percent cytotoxicity was determined with maximum killing controls and the formula: % cytotoxicity = (Absorbance_expt − Absorbance_{spontaneous average})/ (Absorbance_max − Absorbance_{spontaneous average}). The same procedure was used for the αCD20-αCD3 PNA heterodimer cytotoxicity assay, except 5 × 10⁴ target cells (Ramos) were mixed with PBMCs (1:10). The αCD20 tetramer assay used 1 × 10⁵ Ramos cells per well (no PBMCs) with concentrations ranging from 0.6-150 nM. LDH levels in the supernatant (after 48 hours) were measured. Each experimental test was performed in duplicate or triplicate. Error bars represent the standard deviation.

DNA-templated αHer2 Fab Dimers

As a model system, we used the Fab fragment of the monoclonal antibody trastuzumab (Herceptin; Genentech/Roche), which binds the antigen Her2 (ErbB2). Her2 is a receptor tyrosine kinase that is overexpressed in 25-30% of breast cancers and acts as a constitutively active dimerization partner with itself and other members of the ErbB family²¹. On the basis of the crystal structure of trastuzumab (Herceptin, PDB: 1N8Z), we separately mutated three positions (K169, S202 and S156, Figure 1A, left) on the surface-exposed constant region of the light chain (C_κ), distant from the antigen binding site, to the keto amino acid, p-acetylphenylalanine (pAcF) (Supplementary Figure 1)¹⁷. This amino acid can be efficiently and selectively modified with alkoxyamines to form stable oxime conjugates²². pAcF was site-specifically introduced into the αHer2 Fab using an orthogonal amber suppressor amino-acyl-tRNA synthetase/tRNA pair derived from M. jannaschii²³. Mutants were either expressed in shake flasks (2 mg/L) or high density fermentation (>200 mg/L) in E. coli with similar yields to wild-type Fab, and purified by Protein G chromatography. We first used single-stranded DNA (ssDNA) as a template to self-assemble the αHer2 Fab to form a homodimer (Figure 1A, right). A 30 nucleotide (nt) ssDNA (TACGAGTTGAGACAGCTGATCCTGAATGCG) was designed that does not contain any significant secondary structure²⁴, has a suitable T_m for dimerization (T_m=65 °C), and an engineered PvuII restriction site (underlined) to allow cleavage of the double stranded linker. An aminooxy functionality was coupled to a 5’-thiol ssDNA sequence using a C₆ linker with a terminal maleimide group²⁰. We then conjugated the ssDNA to αHer2 K169pAcF Fab (100 μM Fab, 3 mM ssDNA, 100 mM methoxy aniline, pH 4.5, 37 °C, 16 hours), and purified the resulting conjugate by anion exchange chromatography. The Fab-oligonucleotide conjugate migrated in SDS-PAGE at ~70 kDa, which is slightly larger than the mobility based only on molecular weight (Figure 1B, compare lanes 1 and 2). Over 90% of the αHer2 mutant Fab coupled to the aminooxy oligonucleotide as determined by gel densitometry (Supplementary Figure 1). To generate the αHer2 Fab homodimer, we also coupled the complementary oligonucleotide to the αHer2 K169pAcPhe Fab (10 μM Fab), and then exchanged the two Fab-oligonucleotide conjugates into annealing buffer (10 mM Tris, 1 mM EDTA, 100 mM NaCl, pH 7.4). The two Fab-oligo molecules were mixed at a 1:1 molar ratio for 30 minutes at 37 °C. A single homodimer formed at the expected molecular weight (~120 kDa) in >95% yield (Figure 1B, lane 3). Upon treatment with the restriction enzyme PvuII, the homodimer was fully cleaved to generate one 60 kDa band (lane 4), confirming that the duplex DNA formed correctly.

We recently showed that the site of conjugation of an oligonucleotide to an antibody can significantly affect antibody specificity^17,20. The three residues mutated to pAcF (S156, K169, and S202, Figure 1A) in the aHer2 Fabs are located in different positions on the surface of the Fab constant region, and would be expected to form different orientations of the antigen binding site relative to the coupled linker. We constructed the remaining five different αHer2 dimers using the three UAA mutant positions in order to evaluate the effect of conjugation site on biological activity (Figure 1C and Supplementary Figure 2). Interestingly, these dimers migrate slightly differently on SDS-PAGE, perhaps due to differences in their tertiary structures. We only had to create three αHer2-ssDNA constructs to generate all possible combinations of αHer2 heterodimers; these dimers were constructed by simply mixing the relevant Fab-DNA monomers, then purifying by size exclusion chromatography.

To assess the ability of the αHer2 Fab homodimers to block Her2 signaling²⁵, SK-BR-3 (Her2^hi) cells were treated with each homodimer (2.5 μg/mL) and phospho-Her2 levels were determined (See Methods). Although αHer2 wild-type Fab and αHer2 K169pAcF Fab inhibited Her2 signaling in a cell-based phosphorylation assay, the DNA linked dimers were significantly less effective than the monomeric Fabs (Figure 1D). In fact, full-length trastuzumab (αHer2 IgG) had at least a 4-fold better activity than the DNA linked dimers. However, the alternate linkage positions did have significantly different activities in inhibiting phosphorylation. For example, the homodimer generated with mutant K169pAcF (169-169) was almost 2-fold better at inhibiting phosphorylation than the homodimer created with mutant S156pAcF (156-156). Of note, even the Fab linked to ssDNA (Figure 1D, αHer2 Fab-ssDNA) had lower activity than the uncoupled Fab (aHer2 K169pAcF Fab). Thus, although there were differential activities based on specific orientations of the subunits, there was also a general decrease in activity caused by conjugation of ssDNA to the Fabs, which may be due to interfering interactions of the sugar phosphate backbone and the cell membrane.

PNA-templated Self-assembly of Fab Fragments

Peptide nucleic acids (PNAs), like DNA, can form highly stable duplexes based on Watson-Crick base pairing and should also allow creation of bi- and multispecific constructs (Figure 2A and B). Unlike DNA, however, the peptide backbones of PNAs are uncharged (or positively charged) and are also resistant to serum nucleases and proteases^26-28. Furthermore, PNA tagging has already been reported to combinatorially pair small molecules, glycans and peptides^29-32. Because PNAs have a significantly higher T_m than their DNA counterpart, we designed a 12 base PNA sequence³³ (N’-ACGCAACGCGGC-C’) with a predicted T_m exceeding 70 °C³⁴ (Supplementary Figure 3 and Table S1). Arginine-modified bases (indicated in bold) were added to increase solubility and reduce aggregation of the PNAs³⁵. The PNAs were synthesized through automated solid phase synthesis (See Methods and Supplementary Methods) and cleaved by 95% TFA (trifluoroacetic acid). The aminooxy functionality was introduced at the N-terminus by standard peptide coupling of Boc-protected aminooxy acetic acid, and one ethylene glycol (EG) spacer was also added for flexibility (Figure 2A). All PNAs were characterized by MALDI-TOF mass spectrometry (Supplementary Figure 3). The PNA was reacted with αHer2 S202pAcF Fab as described above, but with 20% DMSO as the solvent. After 48 hours, the reaction was analyzed by SDS-PAGE in the presence and absence of reducing agent β-mercaptoethanol (BME). A ~4 kD shift of the Fab band corresponds to the PNA conjugate in over 85% yield (Figure 2C, lanes 2 and 4). Formation of the αHer2 PNA conjugate was confirmed by electrospray ionization mass spectrometry (ESI-MS) (Expected MW: 51,649 Da; Observed MW: 51,649 Da; Supplementary Figure 4). To form a dimer we conjugated the complementary PNA to αHer2 S202pAcF Fab and hybridized the two conjugates (1:1 ratio, 10 μM) in PBS (30 min, 37 °C) to form the homodimer (Figure 2B, left). SDS-PAGE revealed a new lower mobility band that migrated at a slightly higher molecular weight than the expected molecular weight of the αHer2 PNA homodimer (~110 kDa) (Figure 2D, lane 3). Formation of the dimer was again confirmed by MALDI-TOF mass spectrometry (Expected MW: 103,298 Da; Observed MW: 103,218 Da; Supplementary Figure 5). We also asked whether we could further enhance the in vitro activity of the αHer2 Fab by creating a higher order multimer. Orthogonal PNAs³⁶ 20 bases in length with short ethylene glycol (EG) linkers were designed to form a unique cruciform structure, which when coupled to the αHer2 Fab form a Fab tetramer (Figure 2B, right and Supplementary Figure 6). Each PNA was conjugated to αHer2 Fab separately (as described above) and purified using size exclusion chromatography. In order to ensure tetramer formation, the conjugates were further purified by a hydrophobic interaction column (HIC, GE Healthcare) to remove any uncoupled Fab (Supplementary Figure 7). All 4 Fab-PNAs were simply mixed together (1:1:1:1 molar ratio; 10 μM) and incubated at 37 °C for 30 minutes. SDS-PAGE revealed the formation of the tetramer at >90% yield (Supplementary Figure 8). The tetramer was then purified by size exclusion chromatography (Supplementary Figure 8) and analyzed by SDS-PAGE (Figure 2D, lane 4)

In Vitro Activity of PNA Multimers

We then tested the ability of the αHer2 PNA multimers to inhibit phosphorylation in SK-BR-3 cancer cells. As shown in Figure 2E, the αHer2 PNA homodimer inhibits phosphorylation with a similar EC₅₀ as the full-length trastuzumab IgG (17±7 nM vs 29±12 nM, respectively) and a 2.5-fold better EC₅₀ than monovalent αHer2 Fab (47±15 nM). The αHer2 tetramer has an EC₅₀ of 4.6±1.5 nM which is 6-fold lower than the αHer2 IgG, consistent with an increased avidity in binding Her2 (Figure 2E). Thus, by replacing DNA with PNA, bivalent and tetravalent Fabs were generated with equivalent or enhanced in vitro activity compared to trastuzumab (αHer2 IgG).

Synthesis and Activity of αCD3 Bispecific Antibody Fragments

To demonstrate the versatility of this self-assembly approach, we next generated a heterodimer consisting of the αHer2 Fab linked to the Fab of UCHT1, a monoclonal antibody that binds human CD3 on T lymphocytes³⁷. This bispecific construct should recruit activated CD8⁺ T lymphocytes to kill tumor cells^38-40. pAcF was incorporated at position K138HC (heavy chain) of the αCD3 Fab. This site is distant from the combining site, and when conjugated to the αHer2 mutant Fab should allow productive formation of a pseudo immunological synapse. The requisite aminooxy-PNA strand (N’-H₂NO-(EG)₃-GCCGCGTTGCGT-C’) (Supplementary Figure 9) was coupled to αCD3 K138HCpAcF, purified by filtration (Amicon concentrator 30kDa MWCO), and characterized by SDS-PAGE and mass spectrometry (Expected MW: 52,207 Da; Observed MW: 52,211 Da; Supplementary Figure 10). This Fab was then hybridized with αHer2 Fab S202pAcF-PNA (coupled to the complementary PNA strand) in a 1:1 molar ratio (10 μM, 30 min at 37 °C) and purified by size exclusion chromatography. The αHer2-αCD3 heterodimer migrates as one band on SDS-PAGE (Figure 3A, lane 3), indicating a homogeneous product, and has the expected mass by MALDI-TOF mass spectrometry (Expected MW: 104,146 Da; Observed MW: 104,076 Da; Supplementary Figure 11). We analyzed the binding properties of the αHer2–αCD3 heterodimer by flow cytometry. The heterodimer binds to both Her2⁺ cells (SK-BR-3) and CD3⁺ cells (Jurkat, ATCC), and does not have any affinity for Her2^- cells (MDA-MB-435) (Supplementary Figure 12). We next assessed whether the heterodimer induces lysis in Her2⁺ cells in the presence of T lymphocytes. Human PBMCs (peripheral blood mononuclear cells) were combined with Her2 transformed target cells (MDA-MB-435/Her2) at a ratio of 10:1⁴¹, and non-transformed MDA-MB-435 cells were used as an iso-genic Her2^- negative control⁴². Unconjugated αHer2 Fab and αUCHT1 Fab, mixed 1:1, were used as additional negative controls. Both the unconjugated Fabs and heterodimer were added to the PBMC/target cell mixture (0.1 pM-10 nM) and incubated for 16 hours at 37 °C, and LDH (lactate dehyrogenase) released from lysed cells was measured as an indicator of cytotoxicity⁴³. Dose dependent lysis of Her2 positive cells was observed only in the presence of the αHer2-αCD3 heterodimer (Figure 3B). In addition, the bispecific construct had no significant effect on the Her2 negative cell line, indicating specificity toward Her2⁺ cells. The unconjugated mixture also did not affect either cell line. The observed EC₅₀ of the αHer2-αCD3 heterodimer is 104±22 pM, which is similar to that recently reported for a polyethylene glycol linked heterodimer⁴¹. This result further shows that PNA base pairing affords an effective conjugation strategy to generate biologically active and potent heterodimers. As discussed previously, length and/or flexibility between the two partners can have an effect on the efficiency of effector cell mediated killing⁴⁴. To demonstrate this point, we compared PNA strands with either one or three EG units between the N-terminus and ami-nooxy moiety. The 3 EG construct is 3-fold better than the 1 EG construct (104±22 vs. 313±27 pM, respectively, Figure 3G, compare ■ and ●).

To evaluate the generality of this self-assembly approach, we next applied it to rituximab (Rituxan, Genentech/Roche), a monoclonal antibody against CD20, which is used to treat non-Hodgkin’s lymphoma^45,46. We incorporated pAcF into the αCD20 Fab (S202pAcF) and coupled it to an aminooxy-modified PNA (N’-H₂NO-(EG)₃-ACGCAACGCGGC-C’), with a predicted T_m exceeding 70 °C, as described above (Expected MW: 51,522 Da; Observed MW: 51,492 Da; Supplementary Figure 13). The αCD20-αCD3 heterodimer was then synthesized by hybridizing each component (1:1 molar ratio, 10μM) and purifying the construct by size-exclusion chromatography (Figure 4A, lane 2); its composition was also confirmed by mass spectrometry (Expected MW: 103,430 Da; Observed MW: 103,527 Da; Supplementary Figure 14). We analyzed the cell binding properties of the heterodimer by flow cytometry and found that it binds to both CD20⁺ B-cells (Ramos) and CD3⁺ T-cells (Jurkat), but does not have any affinity for CD20^- cells (K562) (Supplementary Figure 15). The activity of the bispecific molecule was then assessed with PBMCs and Ramos cells (10:1 ratio, respectively). The αCD20-αCD3 PNA dimer efficiently induces cell death (EC₅₀ = 74±9 pM), while the mixture of unconjugated Fabs does not have any effect on the target cells (Figure 4B).

Synthesis and Activity of αCD20 Tetramer

Rituximab acts primarily through ADCC, and does not directly induce lymphoma cell apoptosis^45-47. Recently, however, αCD20 tetramers have been shown to induce apoptosis in lymphoma cells as either an Fab′2 homodimer^48,49, or through more complex genetic fusion proteins⁵⁰. Based on these observations, we assembled an αCD20 tetramer using our site-specific PNA technology. Four aminooxy-PNA sequences were conjugated to αCD20 S202pAcF Fab in an identical fashion to the construction of the αHer2 Fab tetramer (See Figure 2B, right). All four sequences couple efficiently to the αCD20 Fab, and when combined in a 1:1:1:1 molar ratio (10 μM), the αCD20 tetramer forms in over >85% yield (Figure 4C, lanes 1-5). The tetramer was then purified using size exclusion chromatography and showed a clearly defined product by SDS-PAGE (Figure 3C, lane 6). The αCD20 tetramer was tested for its ability to directly kill Ramos cells compared to the αCD20 Fab and αCD20 IgG (rituximab) controls (concentrations ranging from 0.6-150 nM). Neither the Fab nor the IgG have any effect on CD20⁺ cells; however, there is a clear dose dependent killing of the αCD20 tetramer (Figure 4D) which induces apoptotic activity comparable to other tetrameric constructs⁴⁹.