Syntaxin 16 and Syntaxin 5 are Required for Efficient Retrograde Transport of Several Exogenous and Endogenous Cargo Proteins

Specific inhibition of retrograde transport of STxB in Syn16 RNAi conditions

Our previous studies have implicated Syn16 in retrograde transport to the TGN as part of a SNARE complex composed of Syn16, syntaxin 6, Vti1a, and the vSNAREs VAMP4 or VAMP3 (Mallard et al., 2002). However in this earlier report, a functional requirement for Syn16 in retrograde transport was not addressed. Using RNAi, we show here that in agreement with some recent studies (Smith et al., 2006b; Wang et al., 2005), Syn16 is indeed required. Three different small interfering RNA (siRNA) duplexes down-modulated Syn16 expression (Fig. 1A, inset). We then used sulfation analysis to quantify arrival of STxB in TGN/Golgi membranes under these conditions. This assay exploits TGN-localized sulfotransferase activity ((Johannes et al., 1997; Mallard et al., 1998); detailed in (Mallard and Johannes, 2003)). Upon retrograde transport to the TGN of the sulfation site-tagged STxB variant STxB-Sulf2, tyrosyl sulfotransferase catalyzes addition of radioactive sulfate, and following immunoprecipitation, sulfated STxB-Sulf2 is detected and quantified by electrophoresis and autoradiography. Transfection of the three anti-Syn16 siRNAs led in all cases to an inhibition of retrograde transport, when compared to mock (set to 100%) or scrambled siRNA transfected control cells (Fig. 1A). The specificity of the RNAi effect was further demonstrated by showing a dose-dependency of retrograde transport inhibition, using siRNA sequence 3 (Fig. 1B).

Immunofluorescence analysis was used to analyze the site of STxB accumulation in Syn16 RNAi cells. In control cells (Fig. 1C), STxB (green) was efficiently transported to TGN/Golgi membranes and colocalized with the Golgi cisternal marker CTR433 (red). In the same cells, immunolabeled Syn16 (blue) was readily detected in co-distribution with CTR433. By contrast, in siRNA transfected cells (Fig. 1D-E), the Syn16 signal (blue) was clearly decreased. STxB (green) was detectable in peripheral structures that were also positive for the transferrin receptor (TfR; red, Fig. 1E), a marker of EE/RE. It was noticeable that in Syn16 RNAi cells, STxB (green) also remained concentrated in a perinuclear localization close to the Golgi apparatus (CTR433; red, Fig. 1D). Whether STxB was actually in Golgi cisternae, due to incomplete inhibition of retrograde transport, or whether it accumulated close to Golgi cisternae could not be distinguised at this level of resolution. Of note in Syn16 RNAi cells, was the perinuclear localization of TfR, something normally not evident in HeLa cells (Lin et al., 2002). In addition, in some cells, TfR-positive tubules emanated from the perinuclear site, which also contained STxB (Fig. 1E).

We tested the specificity of the Syn16 RNAi effect on retrograde transport using three markers that traffic through organelles that constitute the EE/RE-TGN interface. In interaction with its receptor, epidermal growth factor (EGF) is internalized by clathrin-dependent endocytosis into EE and targeted to late endosomes/lysosomes for degradation (Wiley and Burke, 2001). We found here that degradation of this protein, as measured by the appearance of acid soluble counts in the cell culture medium (Mallard et al., 1998), was largely unaffected in Syn16 RNAi cells (Fig. 1F). This suggested that trafficking through the endocytic pathway was functionally unperturbed. Next, we observed that transferrin (Tf) recycling from EE/RE back to the plasma membrane was similar in control and Syn16 RNAi cells (Fig. 1G). Finally, a model cargo, vesicular stomatitis virus glycoprotein (VSVG), was used to assess the effect of Syn16 RNAi on anterograde trafficking along the biosynthetic and/or secretory pathway to the plasma membrane, via the TGN (Fig. 1H). Again, no difference in trafficking was observed. The validity of the assay was confirmed by showing that BFA could totally inhibit the transport of VSVG (Fig. 1H, right column). We also demonstrated that cell surface binding sites and apparent affinity of STxB for cells were not altered in Syn16 RNAi cells, when compared to mock-transfected control cells (Table 1). Taken together, these data demonstrate that Syn16 is specifically required for efficient retrograde STxB transport from EE/RE to the TGN.

Specific function of Syn5 in the EE/RE-to-TGN transport step of the retrograde pathway

In addition to the Syn16 containing SNARE complexes (Mallard et al., 2002), Syn5 and GS15 have recently been identified as further molecular players at the EE/RE-TGN interface (Tai et al., 2004). We used siRNAs as described by Hong and colleagues (Tai et al., 2004) and developed new ones that allowed robust knock down of Syn5 and GS15 (Fig. 2A). We also showed that down-modulating Syn16 expression had no effect on Syn5, and vice versa (Fig. 2A, lower panels), suggesting that loss of one complex is not compensated by the upregulation of the other one. Monitoring sulfation, we found that Syn5 and GS15 RNAi induced a strong inhibition of retrograde transport of STxB, when compared to mock-transfected control cells (set to 100%) or scrambled siRNA transfected cells (Fig. 2B). The levels of inhibition were similar to those observed with Syn16 RNAi (Fig. 2B). To control for specificity, we showed that RNAi against the late endosomal tSNARE Syn7 did not affect retrograde transport of STxB (Fig. 2B), despite efficient down-modulation of the Syn7 target protein (Fig. 2A). Similarly, interfering with the function of the TGN-localized tSNARE Syn10 did not prevent STxB from reaching TGN membranes (Wang et al., 2005). The analysis of sulfation signals on endogenous proteins revealed that these were partially affected in the Syn5 RNAi condition (Fig. 2C), suggesting that Golgi/TGN integrity was altered under these conditions. Note that the inhibition data shown in Figure 2B were normalized to take account of the overall decrease in the endogenous sulfation capacity (see Materials and Methods).

Immunofluorescence was used to study compartment integrity and STxB accumulation sites under Syn5 RNAi conditions. In mock-transfected control cells, STxB (green) colocalized with Syn5 (blue) on CTR433 (red) positive Golgi membranes after 45 min of internalization into HeLa cells at 37°C (Fig. 2D). In Syn5 RNAi cells (Fig. 2E-F; low Syn5 signal, blue), STxB (green) accumulated in peripheral structures that were distinct from Golgi cisternae (Fig. 2E, red) and co-distributed with TfR (Fig. 2F, red; see inset). In these cells, we observed a variable degree of Golgi disruption (Fig. 2E, CTR433, red), as reported in another recent study (Suga et al., 2005), that probably reflects a complex role of Syn5 in membrane trafficking from and to the Golgi cisternae (Dascher et al., 1994; Hay et al., 1997; Tai et al., 2004). However, Syn5 RNAi did not appear to influence the presence of Gb3 molecules at the cell surface, as judged from Scatchard analysis that revealed equal numbers of STxB cell surface binding sites on mock-transfected control cells and Syn5 RNAi cells (Table 1).

In the light of the endogenous sulfation phenotype (Fig. 2C) and the effect on Golgi morphology (Fig. 2E), we sought to have an independent confirmation of the inhibitory effect of Syn5 RNAi on retrograde STxB trafficking. For this, we used a previously developed N-glycosylation site-tagged STxB variant, which becomes modified by oligosaccharyl transferase upon arrival in the ER (Johannes et al., 1997; Mallard and Johannes, 2003). When compared to mock-transfected control cells, glycosylation was inhibited in Syn5, GS15, and Syn16 RNAi conditions (Fig. 3A), strongly suggesting that retrograde arrival in the ER was delayed in all cases. Strikingly, the level of inhibition was similar in all conditions (Fig. 3A), as seen for arrival in TGN/Golgi membranes (Fig. 2B). This suggested that of all possible retrograde transport steps, only EE/RE-to-TGN trafficking was inhibited, despite the effect on Golgi morphology that was specific for Syn5 RNAi cells. This prediction was tested directly, as shown below.

The first step of retrograde transport to the ER is endocytosis. We showed that neither the uptake of STxB (Fig. 3B) nor that of Tf (Fig. 3C) were affected in Syn5 RNAi cells. After leaving the endosome via the EE/RE-TGN interface, STxB is then transported from TGN/Golgi membranes to the ER. We used another variant of STxB, termed STxB-Sulf-Glyc-KDEL, to analyze this transport process. Treating HeLa cells with this protein in the presence of radioactive sulfate leads to its metabolic labeling in the TGN. Thereafter, glycosylation of the sulfated STxB-Sulf-Glyc-KDEL can be measured to signify arrival in the ER. Since glycosylation analysis is a relative measure — i.e. it determines the fraction of sulfated STxB-Sulf-Glyc-KDEL that is also glycosylated — it is independent of differences in sulfation efficiency between experimental conditions and can thus report on events at the TGN/Golgi-ER interface even if the preceding EE/RE-TGN interface is affected.

Under control conditions, i.e. after two hours incubation of STxB-Sulf-Glyc-KDEL with mock-transfected cells in the presence of radioactive sulfate (pulse) followed by a 4-hour chase, a complex banding pattern was observed by glycosylation analysis (Fig. 3D). The uppermost band (n°1) represents the glycosylation product, as judged from its electrophoretic mobility and the fact that it selectively disappeared upon tunicamycin treatment. The second band (n°2) corresponds to a TGN-sulfated but non-glycosylated STxB-Sulf-Glyc-KDEL. The third band (n°3) represents a proteolytic cleavage product of the TGN-sulfated STxB-SulfGlyc-KDEL still containing the glycosylation sequence. Indeed, this band became selectively intensified upon tunicamycin treatment. Bands 4-6 represent further proteolytic cleavage products on which the glycosylation sequence was removed. STxB-Sulf2 is shown on the right of Figure 3D for comparison. We observed that the banding pattern remained unchanged when Syn5 or GS15 expression was down-modulated by RNAi, even though all bands were weaker in Syn5 or GS15 RNAi conditions (Fig. 3D), reflecting the inhibition of EE/RE-to-TGN transport described above. Importantly, the quantitative analysis revealed that in all conditions, the same fraction of sulfated STxB-Sulf-Glyc-KDEL became glycosylated (Fig. 3E), strongly suggesting that ER entry following retrograde transport from TGN/Golgi membranes was not affected in all cases.

In summary, despite a profound effect on Golgi morphology, Syn5 RNAi only led to an inhibition of EE/RE-to-TGN transport of STxB, without affecting its internalization or trafficking from TGN/Golgi membranes to the ER.

A common fusion machinery in the retrograde route of several cargo proteins

We then used the RNAi tools that we developed to address the question as to whether the same protein machinery is used for the efficient targeting of different exogenous and endogenous cargo proteins from endosomes to TGN/Golgi membranes. To address this question, we have extended the STxB-based sulfation assay to other cargo proteins, similar to what has been described for ricin (Rapak et al., 1997). Three types of sulfation site modifications were used (Fig. 4A). In the original configuration, a dimer of sulfation sites was genetically fused to STxB, yielding STxB-Sulf2 (Mallard et al., 1998). We have now developed a chemical coupling protocol of a sulfation site peptide coupling to CTxB or to an antibody directed against green fluorescent protein (GFP) (reviewed in (Amessou et al., in press)). In the latter case, sulfation analysis is performed on HeLa cells that stably express MPR300 fused to luminal oriented GFP (Waguri et al., 2003). The anti-GFP is taken up in association with GFP-MPR and undergoes retrograde transport from the plasma membrane to the TGN.

Mass spectroscopy analysis permitted estimation of the CTxB modification to approximately 2 sulfation peptides per CTxB pentamer (not shown). Because of its size, this analysis was not performed on anti-GFP antibody. Sulfation analysis revealed that CTxB and MPR constructs were indeed sulfated in HeLa cells (Fig. 4B). Due to the reduced labeling efficiency of CTxB-Sulf2 and the sulfation site peptide modified anti-GFP-MPR antibody, retrograde transport was sampled for 40 min, and not for 20 min, as above. This sulfation was inhibited by brefeldin A (BFA) (Fig. 4B), confirming that it depended on retrograde transport (Mallard et al., 1998). These experiments, like those reported below were performed on a HeLa cell clone in which the STxB receptor Gb3 is uniformly expressed throughout the cell population and which has high levels of the CTxB receptor GM1.

In experiments in which the different markers were tested in a pair-wise manner on the same cells, it was found that retrograde transport to the TGN of CTxB and MPR was inhibited to a similar extent to that of STxB in Syn16 (Fig. 4C) or Syn5 (Fig. 4D) RNAi cells. These data reveal that these different exogenous and endogenous cargo proteins share a Syn5 and Syn16-based machinery for efficient retrograde transport.

Immunofluorescence analysis showed that in Syn16 (Fig. 5A) or Syn5 (Fig. 5B) RNAi cells, STxB (red) and CTxB (green) both were blocked in perfect overlap in peripheral endosomes. These observations further support the contention that STxB and CTxB use the same route to traffic between endosomes and the TGN. Their binding to cells appears to be independent, though, as it could be shown that CTxB does not compete with radiolabeled STxB for binding to cells (Fig. 5C). As a control, the efficient competition of unlabeled STxB was demonstrated. Furthermore, the quantification of STxB and CTxB positive cells in our HeLa culture system revealed that Gb3 and GM1 expression appear to be largely independent (Fig. 5D).

Intoxication analysis under Syn5 and Syn16 RNAi conditions

In the next experimental series, we analyzed how intoxication of cells with STx, CTx, and ricin was affected by the presence of reduced levels of Syn5 or Syn16. Under conditions of Syn16 down-modulation, HeLa cells were partly protected against intoxication by STx (Fig. 6A). In these experiments, the effect on protein synthesis of adding increasing concentrations of STx to cells was measured. It was observed that in Syn16 RNAi cells, higher doses of STx were needed to obtain the same level of protein synthesis inhibition as in mock-transfected control cells. Indeed, the IC₅₀ was shifted from 0.12 ng/ml in mock-transfected cells to 0.37 ng/ml in Syn16 RNAi cells (3.1-fold protection). These data clearly indicate that efficient retrograde transport is required for efficient toxin arrival in the cytosol. The specificity of the effect was documented by the finding that diphtheria toxin, which translocates the membrane of early endosomes (Lemichez et al., 1997) and does not depend on the retrograde pathway to intoxicate cells (Yoshida et al., 1991), could intoxicate cells efficiently under Syn16 RNAi conditions (not shown).

Unexpectedly, we observed that Syn5 RNAi protected cells more against STx than did Syn16 RNAi (Fig. 6A), shifting the IC₅₀ to 37.6 ng/ml for Syn5 RNAi cells (313-fold protection). This effect was specific for Syn5, since reducing the levels of GS15 resulted in an IC₅₀ of 0.53 ng/ml (Fig. 6B; 4.4-fold protection), analogous to the outcome of lowering endogenous Syn16. When used in combination, the effect of Syn5+Syn16 RNAi (IC₅₀ of 38.4 ng/ml, 320-fold protection; Fig. 6B) was no different to that of Syn5 RNAi alone. These observations showed that despite their similar effects on retrograde transport to TGN/Golgi membranes, as measured by the analysis of sulfation (Fig. 2B) and glycosylation (Fig. 3A), reduced levels of Syn5 and Syn16 had very different effects on cell intoxication by STx.

To further characterize the effect of Syn5 and Syn16 RNAi on the action of toxins routed via the TGN/Golgi and ER, we tested both CTx and ricin. The A1 subunit of CTx acts as an ADP-ribosyltransferase and catalyzes the transfer of an ADP-ribose to the alpha-chain of the regulatory protein Gs (De Haan and Hirst, 2004). This stabilizes the GTP bound form of Gαs, lowering its GTPase activity and thereby creating a constitutive signal for the activation of adenylyl cyclase, leading to an elevation of cellular cAMP levels. We found here that the capacity of CTx to increase cellular cAMP was reduced in Syn5 and Syn16 RNAi conditions (Fig. 6C), consistent with the need for a step mediated by these syntaxins to gain cytosolic entry. The combined use of Syn5+Syn16 RNAi had only a slight additive effect.

Ricin is another toxin known to follow the retrograde route to ER (Sandvig and van Deurs, 1999). Like STx, ricin is a ribosome inactivating protein catalyzing the same depurination of 28S rRNA (Endo et al., 1987; Endo et al., 1988). The IC₅₀ was shifted from 0.2 ng/ml in control cells to 1.5 ng/ml in Syn16 RNAi cells (Fig. 6D), resulting in a 7.5-fold protection against the toxin. The consequence of Syn5 and GS15 knock down were very similar and close to that observed with Syn16. Indeed, the protection against this toxin was 4.5-fold and 3-fold with Syn5 and GS15 RNAi, respectively (Fig. 7D). We therefore conclude that Syn5 and Syn16 RNAi inhibited the action of all three toxins by interfering with their productive trafficking to the ER. Surprisingly, the protective effect was particularly striking in the combination of Syn5 RNAi and STx.

One possible explanation for this difference would be the displacement under Syn5 RNAi conditions of a factor specifically required for the processing of the A-subunit of STx to A1 and A2 fragments, thus explaining the selective effect on only this toxin. To test this hypothesis, inhibition of protein biosynthesis in mock-transfected and Syn5 RNAi treated cells was compared for untreated STx and a pre-nicked version thereof (Fig. 6E). However, because no difference between the toxin preparations could be detected, we exclude this possibility.

Cargo proteins in the retrograde route

Based on the experiments described in this study, we conclude that several exogenous and endogenous cargo proteins share with STxB elements of the retrograde transport machinery for their efficient trafficking between endosomes and the TGN/Golgi. Very few studies have until now been designed to address this question directly. To a large extent, this was due to the fact that molecular inhibitors of the retrograde route and quantitative tools for its analysis have only become available relatively recently. The first quantitative tools to assess membrane traffic between endosomes and TGN/Golgi membranes were based on one endogenous protein, MPR (Goda and Pfeffer, 1988), and on exogenous STxB and ricin (Johannes et al., 1997; Rapak et al., 1997). It is therefore not surprising that most of the available comparative data were obtained with these proteins.

MPR trafficking studies allowed identification of Rab9 (Lombardi et al., 1993) and TIP47 (Diaz and Pfeffer, 1998) as molecular players at the interface between late endosomes and the TGN. More recently, it was found that MPR can also use the Syn16/Rab6a' regulated EE/RE-to-TGN pathway (Saint-Pol et al., 2004). Other studies showed that the capacity of the ER-routed Pseudomonas exotoxin A to intoxicate cells was sensitive to Rab9 RNAi (Smith et al., 2006b), while Rab9 did not appear to function in the cell entry of ricin (Iversen et al., 2001; Simpson et al., 1995). The exact interplay between the pathways of Syn16/Rab6a' and the TIP47/Rab9 still remains to be established.

A comparison of ricin and STxB reveals both differences and similarities in their trafficking between endosomes and TGN/Golgi membranes. The most notable difference was the observation that clathrin was required for retrograde transport of STxB (Lauvrak et al., 2004; Saint-Pol et al., 2004), but not for that of ricin (Iversen et al., 2001). Similarly, changes in calcium homeostasis affected ricin, but not STx (Lauvrak et al., 2002). However, for both toxins, interfering with the integrity of membrane domains of the raft type prevented retrograde transport (Falguières et al., 2001; Grimmer et al., 2000). It was also found that for both ricin and STx, overexpression of wild-type Rab11 or expression of a dominant negative Rab11 mutant moderately inhibited retrograde transport (Iversen et al., 2001; Wilcke et al., 2000). Taken together with our results that show partial protection of cells against ricin and STx intoxication under conditions of Syn5 and Syn16 knock down, it might be suggested that both toxins share a common mechanism for targeting to TGN/Golgi membranes. However, clathrin-dependent or not, they may rely on different retrograde sorting machinery on EE/RE.

For CTxB, quantitative biochemical tools to study retrograde transport have only recently become available ((Fujinaga et al., 2003) and this study). Before this, it was noted that CTxB and STxB have very similar structures, but their binding to their glycosphingolipid receptors – GM1 for CTxB and Gb3 for STxB – appears to follow different rules. Indeed, while for STxB, the affinity for one globotriose carbohydrate molecule is extremely weak (Kd values in the mM range), CTxB has μM affinity for its carbohydrate receptor in solution (see (Pina and Johannes, 2005) for a review). Cell surface binding studies have shown that stimulating the uptake of one toxin receptor, i.e. GM1 or Gb3, does not affect the presence at the cell surface of the reciprocal receptor (Schapiro et al., 1998). Despite this, both toxins share the characteristic of interacting with membrane microdomains of the raft type (Falguières et al., 2001; Katagiri et al., 1999; Kovbasnjuk et al., 2001), and fluorescence resonance energy transfer studies have indicated that both toxins can be very close together after binding to the plasma membrane (Kovbasnjuk et al., 2001). Once inside the cell, whether by clathrin-dependent or -independent endocytosis (Kirkham et al., 2005; Lauvrak et al., 2004; Saint-Pol et al., 2004; Sandvig et al., 1989), CTxB and STxB both depend on golgin-97 (Lu et al., 2004) and Syn5 and/or Syn16 (this study) functions to reach TGN/Golgi membranes.

Later steps of retrograde transport

Considering the established involvement of the Syn5 SNARE in membrane exchange between the ER and Golgi apparatus (Dascher et al., 1994; Hay et al., 1997), the description of Syn5 function at the EE/RE-TGN interface (Tai et al., 2004) came as a surprise. One possibility was that Syn5 may function in retrograde transport at several levels of the retrograde route, e.g. at the EE/RE-TGN interface and at the Golgi-ER interface. However, the observations reported in our current study clearly demonstrate that once STxB has reached TGN/Golgi membranes, Syn5 RNAi does not have an effect on further retrograde transport to the ER. This suggests that within the retrograde pathway, Syn5 function is restricted to the EE/RE-TGN interface.

Surprisingly however, although Syn5 RNAi had no effect on toxin trafficking beyond the EE/RE-to-TGN step, it significantly protected cells against STx action, considerably more (∼100 fold) than against ricin or CTx. STx and ricin have the same catalytic mechanism (Endo et al., 1987; Endo et al., 1988), and our studies show that STxB transport to the ER is not inhibited more in Syn5 RNAi cells than in Syn16 or GS15 RNAi transfected cells. Therefore, the STx-specific effect of Syn5 RNAi most likely resides at the level of the ER. Whether this effect is direct, such as a role of Syn5 in retrotranslocation or in the distribution of Shiga toxin receptors within ER microdomains (Smith et al., 2006a), or indirect, such as a requirement for ER-Golgi cycling prior to retrotranslocation, remains to be determined in later studies.

In conclusion, we have shown that several exogenous and endogenous cargo proteins share the same protein machinery for efficient retrograde transport at the EE/RE-TGN interface, which suggests the existence of limited molecular redundancy for targeting the TGN/Golgi from endosomes.

Materials, recombinant proteins and antibodies

Monoclonal antibody anti-CTR433 was from M. Bornens (Institut Curie, Paris, France), and polyclonal antibodies against Syn16 and Syn5 were from W. Hong (IMCB, Singapore). Monoclonal antibodies against TfR (Sigma), GFP (Roche), clathrin heavy chain, γ-adaptin, GS15 (BD Biosciences), polyclonal antibodies against Syn7 (Synaptic Systems), and FITC-, Cy3- and Cy5-coupled secondary antibodies (Jackson Immuno-research) were purchased from the indicated suppliers. STxB-FITC, CTxB-Cy3 and STxB-Sulf2, and monoclonal anti-STxB antibody 13C4 were prepared as previously described (Johannes et al., 1997; Mallard et al., 1998).

Cells

HeLa cells were cultured as described (Johannes et al., 1997). Hela cells stably transfected with GFP-MPR300 were from B. Hoflack (Universität Dresden, Germany) and were grown in the presence of 0.5 mg/ml of Geneticin (G418).

RNA interference

Three Synthetic siRNA duplex (21-mers) targeting human syntaxin 16 (first: ACAGCUUCACAAGGCAGAA; second: GGACCUUUGAUACUGCUGC; third: GCAGCGAUUGGUGUGACAA), two 21-mers targeting human syntaxin 5 (first: AAGTGAGGACAGAGAACCTGA; second: AAAGGAAGCGTTGGCAGCAAA), two siRNA targeting syntaxin 7 (first: ACTTCCAGAAGGTCCAGAGTT; second: GTTTTGGGCCACATTGCATT), and one scrambled siRNA (GACAAGAACCAGAACGCCATT) were designed and purchased from a commercial supplier (MWG-Biotech, Germany). Cells were transfected using oligofectAMINE (Invitrogen) according to the manufacturer's instructions. Experiments were carried out 3 days after transfection. Except for the experiments described in Figure 1, concentrations of 200 nM of siRNA were used for transfection in the remainder of the manuscript.

Imunofluorescence analysis

Immunofluorescence analysis was performed as previously described (Mallard et al., 1998). Briefly, cells were incubated with 1 μM STxB-FITC, STxB-Cy3, or CTxB-Cy3 for 30 min at 4°C, shifted to 37°C for 45 min, fixed in 4% paraformaldehyde, and permeabilized with saponin. After labeling with the indicated antibodies, coverslips were mounted and analyzed by confocal microscopy (Leica Microsystems, Mannheim, Germany).

Chemical coupling

For the coupling of sulfation site peptide to CTxB or anti-GFP antibody, the following procedure was performed as described (Amessou et al., in press). Breifly, CTxB or anti-GFP antibody (50 to 100 μM in 50 mM sodium phosphate buffer, 1 mM EDTA, pH 7.5) was incubated at room temperature for 30 min with 0.8-1.5 mM SATA reagent (N-Succinimidyl-S-acetylthioacetate; Pierce). Activated molecules were then incubated for 2 hours at room temperature with bromo-acetylated sulfation site peptide (Neosystem, Strasbourg, France) in presence of 500 mM hydroxylamine. The coupling reaction was then stopped by dialysis against PBS buffer.

Sulfation analysis

Sulfation analysis was performed as described before (Mallard et al., 1998). When two cargo proteins were analyzed, the following modifications were used. 1 μM of STxB-Sulf2 were simultaneously incubated with HeLa cells in the presence of 1 μM of CTxB-Sulf2 or 15 μg/ml of anti-GFP-Sulf2 antibody. After uptake in the presence of 0.4 mCi/ml radioactive sulfate (Amersham), the cells were lysed in PBS, 1% Triton X-100, and Protease Inhibitor Cocktail, and centrifuged for 10 min at 3000 rpm to remove the nuclei. 10% of the supernatant was immunprecipitated with monoclonal antibody anti-STxB antibody (13C4), while 90% of the supernatant was precipitated with either streptavidine-agarose (CTxB-Sulf2) or with protein G-Sepharose (anti-GFP-Sulf2 antibody). Sulfated cargos were analyzed by SDS-PAGE autoradiography. In parallel, the sulfation of endogenous proteins and proteoglycans was determined by TCA-precipitation from immunopreciptation supernatants and used to normalize data obtained when studying toxin sulfation in various conditions. Total sulfation counts are usually similar in all conditions, except for Syn5 RNAi (see Figure 2C).

Glycosylation analysis

Glycosylation analysis and tunicamycin treatment were performed as previously described (Johannes et al., 1997; Mallard et al., 1998).

Cytotoxicity assays

STx, DTx, and ricin cytotoxicities were measured by the ability of cells to incorporate [³⁵S]-methionine into acid-precipitable material following toxin treatment. HeLa cells were seeded at 1.5 × 10⁴ cells/well into flat-bottomed 96-well plates, and grown overnight. Cells were then overlaid with medium containing appropriate concentrations of toxin for 60 min. Remaining cellular protein synthesis following toxin treatment was determined from the incorporation of a 60 min pulse of 1 μCi [³⁵S]-methionine/well into total protein. Plates were then washed three times with ice-cold 5% TCA to precipitate proteins. After 2 more washes in PBS, radioactivity was counted in Wallac Optiphase Supermix. For measuring CTx induced cAMP production, cells were detached with 2 mM EDTA in PBS and incubated with indicated concentrations of CTx for 2 hours at 37°C. After lysis in 0.1 M HCl, intracellular cAMP levels were assayed with Direct cAMP Enzyme Immunoassay kit (Sigma).

STxB and Tf internalization assays

STxB-K3 (STxB variant with three C-terminal lysines) and human diferric transferrin were biotinylated using NHS-SS-Biotin following manufacturer's instructions (Pierce). Endocytosis was measured as described recently (Amessou et al., in press). Briefly, serum-starved cells were detached from plates with 2 mM EDTA in PBS and incubated in the presence of 1 μM biotin-STxB and 200 nM biotin-Tf for 30 min on ice. After washing, cells were incubated at 37°C for the indicated times (1.5 × 10⁵ cells per data point). The remaining biotin on cell surface-exposed STxB or transferrin was cleaved by subsequent treatment with 100 mM of the non-membrane permeable reducing agent sodium 2-mercaptoethanesulfonic acid (MESNA) on ice for 20 min. After washing, excess MESNA was quenched with 100 mM iodoacetamide for 20 min. Cells were lysed in blocking buffer (10 mM Tris [pH 7.4], 1 mM EDTA, 50 mM NaCl, 0.2% BSA, 0.1% SDS, and 1% Triton X-100) before loading on ELISA plates coated either with anti-Tf or anti-STxB antibody (13C4). Biotinylated STxB or transferrin was detected using streptavidin-HRP (Roche). The reaction was stopped with 3M sulphuric acid and plate was read at 490 nm. The percentage of internal STxB (or Tf) was determined as the ratio of signal after MESNA reduction (internal ligand) to signal without reduction (total ligand).

EGF degradation and Tf recycling assays

The assays were performed as described previously (Mallard et al., 1998; Saint-Pol et al., 2004). Briefly, Hela cells were serum starved and incubated for 30 min on ice with iodinated EGF (750 Ci/mmol; Amersham Life Sciences). Cells were washed, shifted to 37°C for the indicated times, and put back on ice. TCA-soluble counts from cells and culture medium were expressed as percentage of total cell-associated radioactivity.

VSVG-GFP anterograde transport assay

Cells were transfected with ts045-VSVG-GFPct plasmid DNA (Scales et al., 1997). Transfection was carried out with Calcium Phosphate Transfection Kit (Invitrogen) using 5 μg of plasmid per transfection. After transfection, the cells were incubated at 40°C for 20 hours. The cells were detached from plates with 20 mM EDTA in PBS, washed in PBS++ (PBS containing 0.1mM CaCl2 and 0.1 mM MgCl2, pH 7.4) and pre-incubated or not with 5 μg/ml BFA at 40°C. Cells were then incubated for 2 hours at 32°C or put on ice. Surface proteins were biotinylated with 2.5 mg/ml NHS-SS-biotin in PBS containing Ca²⁺ and Mg²⁺ for 10 min on ice. The reaction was quenched with 50 mM NH4Cl for 10 min on ice, the cells were lysed in buffer containing 1% Triton X-100, 0.1% SDS, 0.2% BSA, 50 mM NaCl, 1 mM EDTA, 10 mM Tris pH 7.4. Cell lysates were divided in two, transferred to 96-wells ELISA plates coated with anti-VSVG antibody, and revealed by ELISA for anti-HRP-streptavidin (cell surface VSVG) or anti-GFP antibody (total VSVG protein). The latter was used for normalization.