Erf2, a Novel Gene Product That Affects the Localization and Palmitoylation of Ras2 in Saccharomyces cerevisiae

Strains, media, and yeast techniques.

The yeast strains used in this study are listed in Table 1. Solid and liquid media were prepared as described by Sherman et al. (59) and included synthetic complete (SC) medium lacking one or more specified amino acids and rich medium (YPD). Induction of expression of GAL1,10 promoters was achieved by adding 4% galactose to SC medium lacking uracil. Standard procedures were used for yeast manipulations (59). Yeast transformations were done by the lithium acetate procedure (30). Medium containing 5-fluoro-orotic acid (5-FOA; PCR, Inc.) was prepared as described elsewhere (7).

Genetic screen for mutants that affect the subcellular localization of Ras.

The screen was based on a sectoring assay in which the ability to lose an ADE8/URA3-marked RAS2-encoding plasmid (YCp52-Ras2) was monitored by the red/white sectoring of the colonies (see Fig. 1). Cultures of RJY1106 and RJY1107 (8 × 10⁷ cells/ml) were plated on rich medium (YPD) plates (10³ cells/plate) and mutagenized with UV light to obtain approximately an 80% kill rate. Plates were incubated for 5 days (30°C), and the sectoring patterns of 152,000 colonies were assessed. Nonsectored colonies (total of 1,346) were grown as patches on YPD plates and replicated to plates containing 5-FOA (1.0 g/liter). A recessive/dominant test of prospective mutants was performed by backcrossing to either RJY1106 or RJY1107. A complementation test based on restoration of sectoring and 5-FOA resistance was performed on all recessive mutants. A clone by complementation strategy was performed by using the acquisition of 5-FOA resistance as the primary screen to identify the wild-type gene corresponding to the erf mutations. For example, strain RJY1081 was transformed with a YSB32-based (ATCC 77162) genomic library, and transformants were plated onto SC medium plates lacking leucine. To select for cells capable of losing YCp52-Ras2, transformants were replicated to plates containing 5-FOA and plasmid DNA was isolated from the 5-FOA-resistant colonies. Bypass suppressors were eliminated by transforming plasmids into RJY248 (ras1Δ ras2Δ [YCp50Ras1]) and testing for 5-FOA sensitivity. The plasmid (B644) which complemented erf2 was mapped by a combination of deletion analysis and subcloning strategies which allowed the identification of open reading frame (ORF) YLR246w as the gene responsible for complementing the erf2 mutation.

Plasmid construction.

The ERF2 gene (YLR246w) was isolated by PCR amplification from the YSB32-based genomic library plasmid (B644) that complemented the 5-FOA sensitivity and red nonsectoring phenotypes of the erf2-5 mutant. Two oligonucleotide primers, OLI-222 (−165 to −150; 5′-CGCGAATTCTCTGTTTGGTTT-3′) and OLI-225 (+1061 to +1079; 5′ CGATGAGCTCTTAGCGGCCGCATATTTTCTGTATTTTT-3′), were designed to amplify the ERF2 ORF. The 1.2-kb PCR product was digested with EcoRI and SacI (sites incorporated into the PCR oligonucleotides) and ligated into EcoRI/SacI-digested pRS314 (60) to create B642. The OLI-225 primer was designed to include a NotI site into which a triply iterated version of the influenza hemagglutin epitope (HA₃) was placed at the C terminus to create the plasmid B753. Erf2-HA₃ protein expressed from B753 was shown to be expressed by immunoblotting and to be fully functional by complementation of the 5-FOA sensitivity and nonsector phenotype of RJY1277. Low-copy-number and multicopy plasmids expressing Erf2-HA₃ were constructed by subcloning a XhoI/SacI fragment derived from pRS314-Erf2-HA3 (B753) into pRS315 (60) (B754) and YEp351 (27) (B745), respectively.

Construction of erf2::TRP1 (B777) and erf2::HIS3 (B778) plasmids utilized a PstI-BglII subclone of ERF2 in pLITMUS28 (New England Biolabs). pLIT28-ERF2 was digested with SalI and ApaI to remove the ERF2 ORF, and then either TRP1 or HIS3 was ligated to create pErf2::TRP (B777) and pErf2::HIS (B778), respectively. For yeast disruptions included in this study, a 3.3-kb erf2::TRP1 or 3.6-kb erf2::HIS3 fragment was generated by digesting B777 or B778 with SacI/SpeI.

Site-directed mutagenesis of ERF2 was done with a Stratagene QUICK CHANGE kit. Mutagenesis was done on pRS315-Erf2-HA3 (B754). For mutagenesis of Cys189 and Cys-192 to Ser-189 and Ser-192, OLI-350 (5′ CCACCTCGGTCTTCTCACTCTTCCACATCTAACGTCTGCG-3′) and OLI-351 (5′ CGCAGACGTTAGATGTGGAAGAGTGAGAAGACCGAGGTGG-3′) were used (underlining denotes nucleotide changes). For mutagenesis of Asp-200 to Ala, OLI-348 (5′GCGTAATGGTTCATGCCCACCATTGC-3′) and OLI-349 (5′-GCAATGGTGGGCATGAACCATTACGC3′) were used. After mutagenesis, plasmids were checked for expression and ability to complement the nonsectoring and 5-FOA sensitivity phenotypes of RJY1277.

The MET25-RAS1 expression plasmid was created by PCR amplification of a 380-bp region of the MET25 promoter, using OLI-452 (−382 to −368; 5′AGCTAGCTAAGCTTCGGATGCAAGGGTTCG3′) and OLI-457 (−25 to −8; 5′TCGATCGATCTAGAGATGGGGGTAATAGAATTG 3′). The MET25 PCR fragment was digested with HindIII and XbaI and ligated into pRS315 to create B803. RAS1 was amplified from the genome by PCR using OLI-455 (+1 to +19; 5′AGCTAGCTACTAGTATGCAGGGAAATAAATCAA 3′) and OLI-456 (+316 to +365; 5′CGTACGTAGAGCTCGCCGAGTTTATTGTTGCTAG 3′). The RAS1 PCR fragment was digested with SpeI and SacI and ligated into B803 cut with XbaI and SacI to create B804. As expected, the expression of RAS1 from the MET25 promoter construct was under the control of methionine concentrations in the medium (47) (data not shown).

Green fluorescent protein (GFP)-Ras2(SCIIS) (B763) was derived from GFP-Ras2 (9). The glutathione S- (GST)–Ras2 fusion plasmid pEG(KG)Ras2(CCIIS) has been described previously (44). pRS315-Ras2 (B250) was created by removing the 3.1-kb EcoRI-HindIII fragment from YCp50Ras2 (43) and placing into pRS315 (60). pRS315-Ras2 (V19) (B561) and pRS315-Ras2(V19,SCIIS) (B562) were created by site-directed mutagenesis.

Preparation of yeast extracts and immunoblot analysis.

Cultures were grown (25 ml) to a density of 1 × 10⁷ to 2 × 10⁷ cells/ml in synthetic medium and then collected by centrifugation, washed with water, and resuspended in sorbitol buffer (0.3 M sorbitol, 0.1 M NaCl, 5 mM MgCl₂, 10 mM Tris-HCl [pH 7.4]) containing protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 100 U of aprotinin per ml, 1 μM pepstatin, 100 μM leupeptin, and 1 μg of chymostatin per ml) and lysed as described previously (43). Soluble (S100) and membrane (P100) fractions were separated at 100,000 × g at 4°C, using a TLA100.2 rotor of a Beckman TLA100 ultracentrifuge. Protein loading buffer was added, extracts were denatured (95°C, 5 min), and proteins (50 μg) were resolved by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) (12.5% gel). Proteins were transferred to nitrocellulose by semidry electrotransfer in transfer buffer (20 mM Tris base, 150 mM glycine, 0.1% SDS 20% [wt/vol] methanol [pH 8.0]) at 400 mA for 1 h. All subsequent manipulations were performed at room temperature. The filter was blocked for 1 h in buffer A (100 mM Tris-HCl [pH 7.4], 150 mM NaCl, 0.05% Tween 20) containing 5% nonfat dried milk. After one washing with buffer A, the membrane was incubated with the designated primary antibody (2 h), washed three times (15 min) in buffer A, and then incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (2 h). Following three buffer A washes (15 min), the blot was visualized by using a Pierce SUPER-SIGNAL kit.

Subcellular fractionation of Erf2.

RJY1318 was transformed with an Erf2-HA₃-expressing plasmid (B754), and the resulting strain was grown at 30°C to an A₆₀₀ of 0.5 to 1.0 in SC medium lacking tryptophan (2% glucose). Subcellular fractionation was performed essentially as previously described (28). Briefly, cells were spheroplasted, lysed by Dounce homogenization, and subjected to centrifugation in a Beckman GS-15R to obtain 13,000 × g pellet (P13) and supernatant (S13) fractions. The P100 and S100 fractions were obtained and immunoblot analyses were performed as described above. Erf2-HA₃ was detected by using mouse anti-HA antibody (BAbCo) followed by sheep anti-mouse–HRP conjugate (Amersham). Dpm1 was detected by using an anti-Dpm1 antibody (1:20) followed by sheep anti-mouse–HRP conjugate. Kar2 was detected by using an anti-Kar2 antibody (55) (1/20,000 dilution) followed by HRP-conjugated goat anti-rabbit (1:1,000) (Bio-Rad). Pma1 was detected with anti-Pma1 (1:2,000) antibody followed by HRP conjugated sheep anti-mouse–HRP.

In vivo labeling of GST-Ras2 with [³H]palmitate.

Metabolic labeling of GST-Ras was performed as described previously (43). The galactose-inducible GST-Ras2 expression plasmid, pEG(KG)Ras(CCIIS) (B529), was also described previously (43). RJY1270, RJY1272, and RJY1274 cells (100 ml) were grown to a density of 2 × 10⁷ cells/ml in SC medium lacking uracil (4% raffinose), spun, and resuspended in 10 ml of the same medium containing 3 μg of cerulenin per ml, and the cells were incubated for 2 h. The expression of GST-Ras2 was induced by the addition of galactose (4%), and cells were labeled for 4 h with [³H]palmitic acid (1 mCi, 50 Ci/mmol; NEN). Cells were broken with glass beads, and the sample was subjected to low-speed centrifugation (100 × g, 2 min) to remove unbroken cells. The cleared lysate was resuspended in protein loading buffer without β-mercaptoethanol and heated (60°C, 5 min). After separation by SDS-PAGE, the gel was fixed and visualized as described elsewhere (43).

Immunofluorescence and fluorescence microscopy.

Immunolocalization of Erf2-HA₃ was performed as described previously (4), with the following modifications. RJY1318 was transformed with YEp351-Erf2-HA3 (B745) and grown in SC medium lacking leucine (2% glucose) to 10⁷ cells/ml. Erf2-HA₃ was detected by using mouse anti-HA epitope antibody (1:400) (BAbCo) followed by Oregon Green 488-conjugated goat anti-mouse immunoglobulin G (IgG; 1:240 dilution; Molecular Probes Inc., Eugene, Oreg.). Kar2 was detected with anti-Kar2 antibody (55) (1/2,000 dilution) and lissamine rhodamine-conjugated goat anti-rabbit (1:240 dilution; Jackson ImmunoResearch Laboratories, West Grove, Pa.). To visualize GFP-Ras, cultures (5 ml) were grown to mid-exponential phase in synthetic medium under the same conditions as the palmitate labeling and concentrated by centrifugation. FM4-64 labeling of the vacuoles was done as described elsewhere (68). Images were obtained for Erf2-HA₃ with a Zeiss Axioskop microscope (100× objective). GFP-Ras localization images were obtained with a laser scanning confocal system (MRC-1024; Bio-Rad) (60× objective).

Heat shock assay.

The heat shock assay was performed by growing LRB759 (ERF2) and RJY1438 (erf2::HIS3) harboring a pRS315 plasmid expressing RAS2 (B250), RAS2(V19) (B561), or RAS2(V19,SCIIS) (B562) in SC medium lacking leucine for 3 days 30°C. Equal numbers of cells (10⁷) were aliquoted into wells of a 96-well titer plate, and a fivefold dilution series prepared. Heat shock was carried out by placing the microtiter plate, at 55°C for the indicated period of time (typically 10 to 30 min). An aliquot of cells was transferred to SC medium plates lacking leucine, using a CLONEMASTER (Immusine Laboratories), and allowed to grow for 2 days (30°C).

Isolation of mutants affecting Ras localization.

In a previous study, we described a group of RAS2 mutants in which the CaaX box (Cys-Cys-Ile-Ile-Ser) was replaced by the basic extension sequence Cys-Ser-Ile-Ile-Lys-Leu-Ile-Lys-Arg-Lys (Ras2-ext) (43). The membrane association of the Ras2-ext form of Ras2 requires the basic residues in the extension as well as palmitoylation but not prenylation (43). It was not possible in that study to determine how these nonprenylated Ras2-ext proteins functioned given the overall lack of information on Ras trafficking. In an attempt to shed light on this process, we performed a genetic screen that was designed to uncover mutants that affect Ras processing and/or subcellular trafficking. The screen was based on the assumption that the nonprenylated Ras2-ext alleles are partially defective in membrane binding and therefore more sensitive than wild-type Ras to defects in the processing or trafficking pathway.

Strains RJY1106 and RJY1107 were mutagenized as described in Materials and Methods and screened as illustrated in Fig. 1. Mutants exhibiting a synthetic lethality with the Ras2-ext allele were detected by a red/white sectoring assay and by monitoring the inability of the strain to lose an ade8/URA3 plasmid expressing RAS2 (YCp52-Ras2). The screen is a variation of a method described by Bender and Pringle to isolate synthetic lethal mutants (2), except that we used ade8 instead of ade3 to block the production of pigment accumulation of ade2 mutants. A total of 152,000 colonies were screened by the sectoring assay. To confirm that nonsectoring colonies represented cells unable to lose the (YCp52-Ras2) (URA3/ADE8) plasmid, patches (total of 1,346) were replicated to plates containing 5-FOA (1 g/liter). Approximately 0.9% of the colonies satisfied the criteria of being unable to sector and 5-FOA sensitive.

Three complementation groups, designated erf (effect on Ras function) mutants were identified. The erf1 complementation group consisted of two distinct alleles mapped to the Ras2-ext locus and was not pursued. A second complementation group, represented by six alleles of erf4, was determined to be allelic with SHR5, a previously described suppressor of the heat shock sensitivity of Ras2(V19) (31). Deletion of ERF4/SHR5 caused a decrease in palmitoylation and mislocalization of Ras (31). The final complementation group, erf2, consisted of six alleles and is the topic of this report.

Isolation of ERF2.

The ERF2 gene was isolated by complementation of the 5-FOA sensitivity and nonsectoring phenotype of RJY1081 (MATa ras1::HIS3 ras2-ext erf2-5 ura3 ade2 ade8 leu2 [YCp52-Ras2]), using a low-copy-number (YSB32) yeast genomic DNA library (ATCC 77162). Plasmid B644 was recovered and found by sequencing the plasmid/insert junctions to contain an insert encompassing 12.3 kb of chromosome XII. Two known genes, MAP1 and ARV1, and four uncharacterized ORFs are encoded in this interval (Fig. 2A). A series of deletion plasmids was constructed and tested for the ability to complement the 5-FOA sensitivity of an erf2 mutant. Deletions that removed YLR246w failed to complement erf2 (Fig. 2A), and a construct expressing only YLR246w was able to restore 5-FOA resistance (data not shown). In addition, a TRP1 gene disruption of YLR246w exhibits the nonsectoring phenotype of the original erf2 mutants. When a diploid arising from a cross between erf2-5 and a strain harboring the TRP1 disruption of YLR246w was sporulated, all of the resulting progeny were nonsectoring and 5-FOA sensitive. Finally, sequence analysis of all but one of the erf2 mutants uncovered either missense or nonsense mutations in YLR246w.

ERF2 encodes a novel protein containing a DHHC-CRD.

ERF2 is predicted to encode a 359-residue protein with a calculated molecular mass of 41 kDa and four predicted transmembrane (TM) segments (Fig. 2B). A possible metal binding site consisting of a DHHC-CRD is found between TM2 and TM3. The DHHC-CRD has been referred to as a NEW1 variant of the C₂H₂ zinc finger motif (8). The appearance of the DHHC motif within the CRD distinguishes this family from other cysteine-rich metal binding domains (42, 52). However, the function of this domain has not been established despite the presence of the sequence in genomic databases of S. cerevisiae, Schizosaccharomyces pombe, Arabidopsis thaliana, Drosophila melanogaster, Caenorhabditis elegans, and Homo sapiens (Fig. 2C). The region of highest sequence identity encompasses the DHHC-CRD and ranges from 65% (YDR126w) to 36% (YDR459c). Members of the Erf2 subgroup of this family share additional similarities. All are predicted to encode integral membrane proteins, often with four TM segments and a molecular mass of approximately 40 kDa. YDR459c and Akr1 (YDR264c) may be more distantly related to Erf2 because the DHHC motif has been replaced by DHYC, several cysteines within the CRD are not conserved, and the number of TM domains is less certain.

The CRD region of Erf2 appears to be critical for its function. Several of the mutant alleles isolated in the screen map to this region (Fig. 2B). For example, mutation of the conserved residue Arg-182 to Gln (erf2-7) and Lys-174 to Glu (erf2-1) abolishes Erf2 function without significantly affecting the expression level of the protein (data not shown). Site-directed mutagenesis was used to mutate two of the conserved Cys residues within the CRD to Ser (C189S and C192S). The erf2(C189S,C192S) mutant protein was expressed normally but failed to complement the nonsectoring and 5-FOA sensitivity of the erf2Δ mutant (RJY1277) (data not shown). The DHHC motif is also required for Erf2 function. Mutating Asp-200 to Ala inactivated Erf2, as measured by the failure to complement the nonsectoring and 5-FOA sensitivity in RJY1277 (data not shown). The screen also identified a F218S substitution (erf2-2) in the region predicted to be the start of TM3. The other alleles identified in the screen resulted in the insertion of stop codon at Leu-3 (erf2-5) or Leu-145 (erf2-6). In one case (erf2-4), we were unable to detect a change within the ORF and presume that the mutation affects the expression of the protein, but this was not confirmed.

No overlap in function was observed between Erf2 and the other yeast DHHC-CRD ORFs. First, deletion of YDR126, YOL003, YNL326, or YDR459 in RJY1107 had no effect on viability or 5-FOA sensitivity, and all strains sectored normally. Second, overexpression of YDR126, YOL003, YNL326, or YDR459 could not compensate for the loss of ERF2 in the sector or 5-FOA sensitivity assays in RJY1277 (data not shown). Finally, we deleted each of these ORFs alone or in combination with ERF2 and found that the double deletions did not alter the viability of the erf2Δ strain alone (data not shown). Therefore, the other Erf2-like proteins appear to function outside the Ras pathway.

Subcellular localization of Erf2-HA₃.

The subcellular localization of Erf2 was investigated next in an effort to understand its function. A hydropathy plot of the Erf2 sequence predicts that it is an integral membrane protein with four TM segments (Fig. 3A). To examine this directly, an HA₃ tag was inserted at the C terminus of Erf2 in a low-copy-number Erf2-HA₃ expression plasmid (B754). Expression of B754 in RJY1277 (erf2Δ) was able to complement the 5-FOA sensitivity and nonsectoring phenotypes (data not shown). Total cell lysates were fractionated by centrifugation to obtain soluble (S100) and high-speed crude membrane (P100) fractions, and Erf2-HA₃ was found exclusively in the P100 fraction (Fig. 3B). Addition of 1.0 M NaCl, 1.6 M urea or 0.1 M sodium bicarbonate (pH 11) was unable to release Erf2-HA₃ from the P100 fraction, consistent with it being an integral membrane protein. Ras1 and Ras2 proteins also fractionated with the P100 fraction under the same conditions. The nonionic detergent Triton X-100 (1%) extracted only a portion of the Erf2-HA₃ from the membrane (Fig. 3B). Similar results were obtained with the ionic detergent sodium cholate (1%). In contrast, Ras proteins were effectively solubilized by Triton X-100 (1%) or sodium cholate (1%) (Fig. 3B). The combination of Triton X-100 and sodium cholate was able to complete the solubilization of Erf2-HA₃.

Indirect immunofluorescence of cells expressing Erf2-HA₃ from a multicopy plasmid (B745) was performed to determine subcellular distribution of Erf2. As seen in Fig. 4A, Erf2-HA₃ appears as a ring surrounding the nucleus which is stained by 4′,6-diamidino-2-phenylindole (DAPI). This perinuclear staining pattern is similar to that seen with the ER-resident protein Kar2 (Fig. 4A) (55). Because it was necessary to overexpress Erf2-HA₃ in order to detect it by immunofluorescence, we also performed subcellular fractionation experiments using strains expressing Erf2-HA₃ at physiological levels from a low-copy-number vector (B754). As seen in Fig. 4B, Erf2-HA₃ is found primarily in the P13 fraction along with Dpm1 and Kar2, two ER-resident proteins. Very little Erf2-HA is seen in the P100 membrane fraction, where plasma membrane proteins such as Pma1 reside (Fig. 4B).

Deletion of ERF2 affects the function of wild-type Ras.

Deletion of ERF2 has no discernible effect on growth or viability of RAS1 RAS2 wild-type cells growing in rich or synthetic growth medium (Fig. 5 and data not shown). However, ERF2 is required when the CaaX mutant Ras2-ext is the only Ras expressed. This might indicate that Erf2 is essential only when Ras is not prenylated. Alternatively, there may be a differential requirement for Erf2 depending on the allele of RAS being expressed. We examined the requirement for ERF2 when either RAS1 or RAS2 is deleted. Tetrad analysis revealed that ras2Δ erf2Δ strains exhibited a severe growth defect, whereas a ras1Δ erf2Δ strain grew normally (Fig. 5A). This effect was not due to a sporulation or germination defects because the slow growth of ras2Δ erf2Δ strains was also observed when cells were streaked on plates (Fig. 5B) or growth curves were measured (data not shown). The apparent differential requirement of Erf2 depending on the RAS gene being expressed could arise from differences in the level of Ras activity in ras2Δ and ras1Δ cells or perhaps a functional difference between the two Ras proteins. RAS1 and RAS2 are differentially expressed depending on growth conditions and the position in the growth curve (10, 11). However, we did not observe a difference in the steady-state levels of Ras1 and Ras2 proteins in our strains (Fig. 3B). ras2Δ cells have lower cyclic AMP levels than isogenic ras1Δ cells, and purified recombinant Ras2 protein is a more effective activator of adenylyl cyclase than Ras1 (13, 29). We reasoned therefore that Erf2 is required in ras2Δ cells because the overall Ras activity in the cell is reduced. Consistent with this explanation, overexpression of RAS1 from the MET25 promoter rescues the growth defect of a ras2Δ erf2Δ strain (Fig. 5A). We cannot, however, rule out the possibility that Erf2 has a preference for Ras1 and that this preference can be overcome by overexpression of RAS1.

Overexpression of GPA2 fails to suppress the growth defect of a ras2-ext erf2Δ strain.

Our results demonstrate that Erf2 is required when the Ras CaaX box is mutated and under conditions of reduced Ras activity. Recently, the heterotrimeric G protein α subunit Gpa2 has been shown to act in parallel to Ras when Ras activity is compromised (17, 35, 70). Specifically, elevated expression of Gpa2 rescues the growth defect of a ras2ts strain at the nonpermissive temperature (49). A ras2Δ gpa2Δ strain grows very poorly, reminiscent of the growth defect of a ras2Δ erf2Δ strain (35, 38). This raises the possibility that the effect of Erf2 on the Ras pathway is actually mediated through modulation of the Gpa2 pathway. To test this hypothesis, we constructed a set of double and triple mutants and analyzed tetrads following sporulation. Strains harboring ras2Δ erf2Δ and ras2Δ gpa2Δ deletions were viable but grew slowly. In contrast, a ras2Δ erf2Δ gpa2Δ strain was inviable (data not shown). The additive effect of the erf2Δ and gpa2Δ mutations suggests that they operate in different pathways. Consistent with this interpretation, overexpression of GPA2 failed to rescue the inviability of a ras2-ext erf2Δ strain.

Deletion of ERF2 leads to a reduction in Ras palmitoylation.

To examine the effect of Erf2 on Ras palmitoylation, wild-type and erf2Δ cells expressing GST-Ras2 were labeled with [³H]palmitate, and the fusion protein was analyzed by SDS-PAGE. As seen in Fig. 6A, deletion of either ERF2 or ERF4/SHR5 results in a decrease but not complete loss of steady-state Ras palmitoylation. The steady-state palmitoylation of other acylated proteins, however, was not affected in erf2Δ or erf4/shr5Δ strains (Fig. 6B). It is therefore unlikely that either ERF2 or ERF4/SHR5 encodes a component of a general palmitoyltransferase. It is possible that Erf2 is a Ras-specific palmitoylation system. Alternatively, Erf2 and Erf4/Shr5 could be involved in a step in Ras processing or trafficking that precedes palmitoylation.

Deletion of ERF2 causes mislocalization of Ras.

We performed subcellular fractionation and immunofluorescence experiments to examine the role of Erf2 in Ras membrane localization. Extracts from isogenic ERF2 and erf2::TRP1 deletion strains (RJY1107 and RJY1277) were separated into P100 and S100 fractions. As seen in Fig. 7, deletion of ERF2 did not significantly change the distribution of wild-type Ras proteins, but there was a redistribution of Ras2-ext protein from the membrane into the soluble fraction (Fig. 7). The prenyl group appears to be sufficient to retain wild-type Ras in the membrane, whereas the Ras2-ext protein requires palmitoylation for membrane association.

While the fractionation experiments described above suggest that the membrane association of wild-type Ras is not affected by deleting ERF2, palmitoylation of wild-type Ras is diminished in an erf2Δ strain (Fig. 6). We therefore examined the subcellular localization of GFP-Ras by fluorescence microscopy. As seen in Fig. 8A (upper left panel), GFP-Ras2 appears on the cell perimeter, consistent with its localization on the plasma membrane. In contrast, a shift of GFP-Ras to internal membranes occurs when ERF2 is deleted (Fig. 8A, top panels). The internal membrane compartment is stained with FM4-64, indicative of the vacuole (68). A more pronounced Ras mislocalization defect is observed with GFP-Ras2(SCIIS), a Ras mutant that cannot be palmitoylated (Fig. 8B). GFP-Ras2(SCIIS) is found primarily on internal membranes that include, but are not restricted to, the vacuole (Fig. 8B).

Deletion of ERF2 reduces the heat shock sensitivity caused by expression of Ras2(V19).

Yeast strains expressing Ras2(V19), a form that cannot hydrolyze GTP, are sensitive to heat shock. We examined whether Erf2 affected the heat shock sensitivity of strains expressing wild-type and Ras2(V19) proteins. Deletion of ERF2 had no measurable effect on the heat shock sensitivity of wild-type Ras2 but did have a protective effect on strains expressing Ras2(V19) (Fig. 9, 10-min heat shock treatment). It is important to note that the protection afforded by deleting ERF2 is less than the protection seen when palmitoylation is prevented by mutating Cys-318 to Ser [Ras2(V19,SCIIS)]. However, deletion of ERF2 provides further heat shock protection to the nonpalmitoylated Ras2(V19,SCIIS) allele. Since Erf2 affects the function of a nonpalmitoylated form of Ras2(SCIIS), it is not likely to be a component of the palmitoyltransferase; rather, Erf2 appears to play a role in Ras trafficking prior to palmitoylation.