Sulfasalazine, an inhibitor of the cystine-glutamate antiporter, reduces DNA damage repair and enhances radiosensitivity in murine B16F10 melanoma

Reagents

Roswell Park Memorial Institute-1640 medium (RPMI-1640; Cat. No. 043–30085), Dulbecco’s modified Eagle’s medium (DMEM; Cat. No. 189–02025), and non-essential amino acids (NEAA; Cat. No. 139–15651) were purchased from Wako Pure Chemical Industries (Osaka, Japan). SAS (Cat No. S0883) and 2’,7’-dichlorofluorescin diacetate (DCFDA; Cat. No. D6883), siRNA (Product no. Mm_Slc7a11_1916), and MISSION siRNA Universal Negative Control #2 (Product no. MISSSION_SIC-002) were purchased from Sigma-Aldrich (St. Louis, MO). Lipofectamine^® RNAiMAX and Opti-mem were purchased from Thermo Fisher Scientific (Waltham, MA). Water soluble tetrazolium salt-1 (WST-1; Cat. No. W201) and 1-methoxy phenazine methosulfate (Cat. No. M003) were purchased from Dojindo (Kumamoto, Japan). The following antibodies were used for western blotting and immunostaining: anti-γ-tubulin (Cat. No. ab179503, Abcam, Cambridge, United Kingdom), anti-pSer139-histone H3 (γH2AX; Cat. No. #9718, Cell Signaling Technology, Beverly, MA), Alexa Fluor 488- or 598-conjugated secondary antibodies (Thermo Fisher Scientific), anti-xCT (Cat. No. sc-98552), anti-actin (Cat. No. sc-1615), and horseradish peroxidase (HRP)-conjugated secondary antibodies (Santa Cruz Biotechnology, Santa Cruz, CA). Immobilon western HRP substrate was purchased from Merck Millipore (Billerica, MA).

Cell culture

Murine melanoma B16F10 cells (Cat No. TKG0348, Cell Resource Center for Biomedical Research, Tohoku University, Sendai, Japan) were maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum at 37°C, 5% CO₂. Mouse embryonic fibroblasts (MEF) were maintained in DMEM supplemented with 10% fetal bovine serum and NEAA at 37°C, 5% CO₂. MEF were used between passages 3 and 8.

Intracellular ROS detection

Intracellular oxidative stress was evaluated by DCFDA staining, as reported [10]. Cells were treated with 0–1,000 μM SAS for 24 h. After SAS treatment, cells were stained with 20 μM DCFDA for 30 min at 37°C. Cells were trypsinized and their fluorescence intensity was analyzed using an EC800 Analyzer (Sony Biotechnology, Tokyo, Japan).

Cell viability assay

To determine the effect of SAS and exogenous oxidative stress on cellular viability, a WST-1 viability assay was employed, as described previously [11]. Cells (1,000–2,000 per well) were seeded into all wells of 96-well plates, and medium was replaced with SAS-containing medium (0–1000 μM) for 24 h. To determine the effect of SAS on H₂O₂ toxicity, cells were treated with H₂O₂ (10–200 μM, 24 h) after SAS treatment (200 μM, 24 h). After treatment with SAS alone or H₂O₂ plus SAS, cells were treated with WST-1 solution (3.6 μg/μL WST-1, 70 ng/μL 1-methoxy phenazine methosulfate in 20 mM 4-(2-hydroxyethyl)-1-piperazineethanesufonic acid—KOH [pH 7.4]; Dojindo). The cells were incubated for 1 h at 37°C, and the absorbance of each well was recorded at 440 nm using a Multiskan FC microplate reader (Thermo Fisher Scientific).

Reverse transcription–quantitative polymerase chain reaction analysis

Reverse transcription–quantitative polymerase chain reaction (RT-qPCR) analysis was performed as previously described [12]. Total RNA from B16F10 and MEF cells was isolated using TRIzol Reagent (Cat. No. 15596026, Thermo Fisher Scientific) according to the manufacturer’s instructions. Five-hundred nanograms of RNA were reverse-transcribed using ReverTra Ace qPCR RT Master Mix with gDNA remover (Cat. No. FSQ-301, TOYOBO, Osaka, Japan). Real-time PCR analysis was performed using a LightCycler Nano System together with a KAPA SYBR FAST qPCR Kit (Cat. No. KK4602, KAPA Biosystems, MA, USA). The primer sequences for qPCR were as follows: for xCT, 5′- ACATTCTGGAGGTCTTTGGT -3′ and 5′- GCAAGTTCAGGAATTTCACA -3′; for β2-microglobulin (B2M), 5′- TTTCTGGTGCTTGTCTCACT -3′ and 5′- GTTCAGTATGTTCGGCTTCC -3′. PCR conditions were as follows: 95°C for 3 min, followed by 45 cycles of 95°C for 10 s, 60°C for 10 s, and 72°C for 15 s. The fluorescence intensity was measured at the end of every extension phase. Relative mRNA expression was normalized to that of B2M, as an internal control.

Sodium dodecyl sulfate–polyacrylamide gel electrophoresis and western blotting

Western blotting was performed as previously described, with some modifications [13]. For B16F10 and MEF, cells were collected and lysed in modified RIPA buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, 1 mM ethylenediaminetetraacetic acid, 1% NP-40, 0.1% sodium dodecyl sulfate (SDS), 0.1% sodium deoxycholate, and protease inhibitor cocktail) following sonication using a Bioruptor UCD-200 (BM Equipment, Tokyo, Japan) at low intensity for 3 min. For tumor and skin tissues, tissues were lysed in modified RIPA buffer using an bead beater-type homogenizer (μT-12, Taitec corporation, Saitama, Japan). Lysed cell and tissue were centrifuged at 15,000×g for 15 min at 4°C, and the supernatants were collected as protein samples. Three-fold concentrated Laemmli’s sample buffer (0.1875 M Tris-HCl [pH 6.8], 15% β-mercaptoethanol, 6% SDS, 30% glycerol and 0.006% bromophenol blue) was added to the supernatant, and samples were boiled for 3 min. Proteins were separated by SDS–polyacrylamide gel electrophoresis and transferred onto a nitrocellulose membrane (BioTrace NT; Pall Corporation, FL, USA). Transfer conditions were 100 V in Towbin buffer (25 mM Tris, 192 mM glycine, 1%SDS, and 20% methanol) for 90 min at 4°C. The membrane was probed with specific antibodies diluted with TBST (10 mM Tris-HCl [pH 7.4], 0.1 M NaCl and 0.1% Tween-20) containing 5% bovine serum albumin overnight at 4°C. After probing with HRP-conjugated secondary antibodies, bound antibodies were detected with Immobilon western HRP substrate. Densitometry was performed using ImageJ software (NIH, Bethesda, MD).

GSH measurement

Total GSH concentration was evaluated using a Total GSH Quantification Kit (Cat No. T419; Dojindo), following the manufacturer’s instructions. Harvested cells and tumor tissue were lysed in 10 mM HCl and 1% 5-sulfosalicylic acid dihydrate (Wako Pure Chemical Industries). Lysate was centrifuged (8,000×g) and the supernatant collected. An equal volume of H₂O was added to the supernatant and incubated with coloring reagents.

RNA interference

Mouse xCT siRNA (Product no. Mm_Slc7a11_1916) and MISSION siRNA Universal Negative Control (Product no. MISSSION_SIC-002) were purchased from Sigma-Aldrich. Cells were reverse-transfected with these siRNAs (30 nM) with Lipofectamine^® RNAiMAX (4.4 μL per 35 mm dish). RNAi complex were formed in 200 μL of Opti-mem^® (Product no. 31985–070) for 20 min of incubation, then 2 mL of cell suspension (5×10⁵ cells per 35 mm dish) were merged into RNAi complex. At 48–72 h after transfection, cells were proceeded to further analysis.

Clonogenic survival assay and irradiation

A clonogenic survival assay for determination of the radio-sensitizing effect of SAS was performed as previously described [14]. B16F10 cells were trypsinized, diluted, counted, and seeded into 60-mm dishes at densities of 100–10,000 cells/dish before being allowed to adhere in a 37°C incubator for 6 hours. Prior to irradiation, cells were incubated with SAS for 24 h. X-irradiation was performed with a linear accelerator (Primus MidEnergy, Siemens, Berlin, Germany). The dose rate was 2 Gy/min, determined using Fricke’s chemical dosimeter. The irradiated cells were then allowed to grow in a humidified 5% CO₂ atmosphere at 37°C for 5 days before being fixed with methanol and stained with 0.05% crystal violet solution (Wako Pure Chemical Industries). Colonies that containing more than 50 cells were scored as surviving cells. The survival curves were then fitted to a linear–quadratic model using Origin Pro 7 data analysis software (Origin Lab Co., MA).

Analysis of mitotic catastrophe

Radiation-induced mitotic catastrophe (MC) was analyzed as previously described, with some modifications [15]. Cells were seeded onto glass coverslips coated with poly-L-lysine (Sigma-Aldrich) and cultured overnight followed by SAS treatment (200 μM, 24 h). After 8 Gy of X-irradiation, the cells were fixed with 4% paraformaldehyde/phosphate-buffered saline (PBS) for 10 min at 4°C. After permeabilization with 0.1% Triton X-100/PBS for 5 min at 4°C, the cells were treated with blocking buffer (PBS containing 1% bovine serum albumin and 5% goat serum) for 30 min at room temperature. For MC analysis, cells were then incubated with anti-γ-tubulin antibody (1:500 in blocking buffer) at 4°C overnight, followed by Alexa Fluor^® 488-conjugated secondary antibody (1:2000 in blocking buffer) for 1 h. After being washed twice with PBS, the cells were incubated with 300 nM 4′,6-diamidino-2-phenylindole for 5 min at room temperature, and the coverslips were mounted with ProLong Gold antifade reagent (Thermo Fisher Scientific). At least 100 cells were counted, and the cells either with features of aberrant mitotic nuclei (micronuclei, multilobular nuclei, or fragmented nuclei) or with more than two γ-tubulin foci were scored as cells undergoing MC.

DNA damage repair assay

DNA damage repair assays were performed as reported previously [16]. The cells were fixed and permeabilized as described in 2.9. Analysis of mitotic catastrophe, above. The cells were then incubated with anti-γH2AX antibody (1:500 in blocking buffer) at 4°C overnight followed by incubation with Alexa Fluor^® 488-conjugated secondary antibody (1:2000 in blocking buffer, 1 h, room temperature). After two washes with PBS, they were incubated with 300 nM 4′,6-diamidino-2-phenylindole for 20 min at room temperature, and the coverslips were mounted with ProLong Gold antifade reagent (Thermo Fisher Scientific). Fluorescence microscopic analysis was performed using an Olympus BX61. Foci of γH2AX were manually counted in at least 100 cells.

Alkaline comet assay

To detect primary cytotoxicity of X-irradiation, DNA strand breaks were quantified by alkaline comet assay [17]. Cells were incubated with SAS (200 μM, 24h) prior to 1 Gy of X-irradiation. After irradiation, cells were suspended in 1% low-melting point agarose (Cat No. 317–01182; Nippon Gene, Tokyo, Japan) dissolved in serum free medium. Cell suspension containing 5×10³ cells were applied to microscope slide that pre-coated by 1% agarose (Cat No. 313–90231; Nippon Gene, Tokyo, Japan). Slides were incubated with comet lysis buffer (1.2 M NaCl, 100 mM EDTA, 0.1% sodium lauryl sarcosinate, 0.26 M NaOH) at 4°C for overnight. Then, slides were washed twice by alkaline buffer (0.03 M NaOH, 2 mM EDTA). Genomic DNA were separated in alkaline buffer at 9 V for 15min. After being washed with distilled water, DNA were stained by Propidium iodide (10 μg/mL, 4 °C, 30min). Fluorescent images were acquired using an BZ-X700 microscope (Keyence, Osaka, Japan), and comet tail were analyzed using Image J software with OpenComet plug-in at least 30 cells per sample [18].

Cell cycle analysis

To analyze cell cycle perturbation, DNA was stained with propidium iodide and the cells were analyzed by flow cytometry [19]. Cells were incubated with SAS prior to 1 Gy of X-irradiation. At the indicated time points, 0.5×10⁶ cells were resuspended in PBS and fixed in ice cold 70% ethanol for at least 6 h. Fixed cells were washed in PBS twice, and incubated with propidium iodide staining solution (50 μg/mL propidium iodide, 5 μg/mL RNase I, 137 mM NaCl, 2.7 mM KCl, 8.1 mM Na₂HPO₄, and 1.47 mM KH₂PO₄) at 37°C for 30 min. The DNA content of at least 10,000 cells/sample was analyzed using an EC800 Analyzer (Sony Biotechnology).

General animal methods

All animal experiments were performed according to the established guidelines of the ‘‘Law for the Care and Welfare of Animals in Japan”, and approved by the Animal Experiment Committee of Azabu University (Approved No. 160402). Mice were housed in plastic cages in an air-conditioned room at 24 °C in a 12 h light-dark cycle (light on at 7:00 am) with food and water available ad libitum on SPF condition. Tumor-bearing mice was ethically sacrificed when the tumor volume reached 1,500 mm³ (or ~1.5 cm in any dimension) or a tumor burden greater than 10% of the body weight; tumor that ulcerate, become necrotic or infected, when a tumor impedes an animal’s ability to move their limbs and assume normal body postures, and any animal found to be moribund, cachectic, or unable to obtain food or water. At the end of experiments, animals will be anesthetized with 2% isoflurane and sacrificed by cervical dislocation. Death will be determined by confirming that dislocation took place if the mice head hangs loosely from the body.

Tumor transplantation

Female C57BL/6N mice aged 7–8 weeks were purchased from Charles river laboratories Japan (Kanagawa, Japan) and maintained and inbred in the animal facility of Azabu University. For allograft transplantation, skin will be disinfected with 70% alcohol, and one million B16F10 cells were inoculated subcutaneously into the hind-legs of the mice under anesthesia by 2% of isoflurane (Intervet, Tokyo, Japan). Tumor volume was calculated as V (mm³) = π/6 × a × b × c, where a, b, and c are the orthogonal dimensions of the tumor. In this allograft model, we did not observe the decrease of body weight (S1 Fig).

Immunohistochemistry

Immunohistochemistry was performed as previously described [12]. Tumor tissues were excised and fixed with 4% buffered formaldehyde. Fixed tissues were frozen in OCT compound, and sectioned at 5-μm thickness. After incubation with blocking buffer (5% bovine serum albumin, 0.01% triton-X100; 4°C, 60 min), slides were probed with anti-xCT or anti-γH2AX antibody (Santa Cruz Biotechnology) at 4°C overnight. The slides were then incubated with Alexa Fluor 488-conjugated anti-rabbit IgG secondary antibodies (1:2000, Thermo Fisher Scientific). After being washed twice with PBS, they were incubated with 300 nM 4′,6-diamidino-2-phenylindole for 20 min at room temperature, and mounted with ProLong Gold antifade reagent (Thermo Fisher Scientific). Fluorescent images were acquired using an BZ-X700 microscope.

Experimental radiotherapy

When the tumor size was 100–200 mm³, SAS dissolved in PBS was intraperitoneally injected into tumor-bearing mice at a dose of 250 mg/kg/day for 3 sequential days. At 24 h after the third SAS administration, anesthetized tumor-bearing mice were locally X-irradiated at a dose of 4 Gy.

Statistical analysis

All values are expressed as means ± standard deviations (SD) of three to five independent experiments. Differences between groups were evaluated by Student’s t-tests (two-sided) or Tukey-Kramer tests, and considered to be significant at p<0.05.

SAS decreases cellular GSH and increases H₂O₂ cytotoxicity in B16F10 cells

SLC7A11 gene codes for a sodium-independent cystine-glutamate antiporter that is chloride dependent, known as xCT. Firstly, SLC7A11 gene expression was evaluated in B16F10 cells and MEF. RT-qPCR analysis revealed that xCT expression was 1,000-fold higher in B16F10 cells compared with MEF (Fig 1A). Furthermore, xCT protein was increased in B16F10 compared with MEF (Fig 1B and 1C).

Next, we assessed the cytotoxicity of SAS in both cell types. As shown Fig 2A, 0.01–100 μM SAS had little effect on cellular viability at 24 h after treatment, whereas 200–1,000 μM SAS slightly decreased the viability of both cells (Fig 2A). Cellular ROS and GSH levels were measured after SAS treatment. At lower SAS concentrations (10–100 μM), we did not observe any increase in intracellular ROS. At higher concentrations of SAS (800–1,000 μM), intracellular ROS increased approximately 2.3-fold in B16F10 cells (Fig 2B), whereas ROS did not increase in MEF cells (1.13±0.07-fold at 200 μM SAS). SAS significantly decreased intracellular GSH in both cells after 12 to 24 h (Fig 2C). In this condition, GSH/(GSH+GSSG) did not decrease after SAS treatment (S2 Fig).

Depletion of GSH decreases cellular sensitivity to exogenous oxidative stress. The effect of SAS on H₂O₂ cytotoxicity was analyzed in B16F10 cells and MEF. SAS enhanced H₂O₂ cytotoxicity In B16F10 cells (Fig 2D; DMSO half maximal inhibitory concentration, IC₅₀ = 300 μM, SAS IC₅₀ = 90 μM) but not in MEF (Fig 2D; DMSO IC₅₀ = 800 μM, SAS IC₅₀ = 800 μM). These results suggest that B16F10 cells are more sensitive to GSH depletion compared with MEF.

Then, we analyzed the effect of RNA interference toward xCT on cellular GSH level, ROS, and H₂O₂ sensitivity (Fig 3). As shown in Fig 3A, RNA interference decreased xCT expression of B16F10 cells (30 nM; 51.8%, 50 nM; 69.4% compared to control siRNA condition), and we used 30 nM of siRNA in following examination. In this condition, GSH/GSSG ratio and total content of glutathione were decreased compared to scramble siRNA (Fig 3B). In this condition, GSH/(GSH+GSSG) did not decrease after SAS treatment (S2 Fig). With decrease of glutathione, cellular ROS level (Fig 3C) were increased and cellular sensitivity of H₂O₂ were increased in siRNA condition (Fig 3D).

Radio-sensitizing effect of SAS on B16F10 cells

To examine whether radiation-induced cell death was enhanced by SAS treatment, a clonogenic survival assay was employed. B16F10 cells were pretreated with SAS for 24 h and exposed to X-rays in the presence of SAS. Treatment with SAS gradually suppressed cellular survival (Fig 4A). Survival curves are shown in Fig 4B. The 10% lethal doses were 7.8 Gy for controls and 6.75 Gy with SAS treatment (sensitizer enhancement ratio = 1.55). To clarify the effect of SAS on radiation-induced cell death, the fraction of cells undergoing MC, a marker of reproductive death, was evaluated. The nuclei and centrosomes of irradiated cells were stained, and the numbers of cells showing markers of MC, including aberrant mitotic nuclei (micronuclei, multi-lobular nuclei, and fragmented nuclei) and more than two centrosomes (Fig 4C) were scored. As shown in Fig 4D, MC was significantly increased at 24 h after 8 Gy of irradiation, and SAS synergistically increased MC in irradiated cells, especially formation of micronuclei and fragmented nuclei. Under these conditions, we did not observe that SAS increased radiation-induced apoptosis (data not shown). Therefore, SAS enhanced MC after X-irradiation, leading to radio-sensitization of B16F10 cells.

SAS treatment decreases DNA double strand break repair capacity after X-irradiation

It has been demonstrated that MC in mammalian cells results from the failure of mitosis involving incomplete repair of DNA damage [20]. To explore the involvement of cellular DNA damage repair in SAS-induced radio-sensitization, we analyzed double strand break (DSB; γH2AX staining) formation in irradiated cells [21]. When the cells were irradiated at 1 Gy without SAS, the number of DSB peaked at 5.6±1.3 foci per cell at 60 min after X-irradiation, and then decreased at later time points (Fig 5A–5C) until most DSB had been repaired at 180 min (1.69±0.2 foci per cell). However, pretreatment with SAS significantly inhibited the decrease in the number of foci at 180 min (4.5±0.7). At 60 min after irradiation, SAS have tendency to increase the number of γH2AX foci. In addition, knockdown of xCT by siRNA transfection, and knockdown of xCT increased γH2AX after X-irradiation (S3 Fig). To clarify the effect of SAS on primary cytotoxicity toward X-irradiation, we employed alkaline comet assay to analyze formation of strand breaks after X-irradiation. As shown Fig 5D, SAS treatment increased the comet tail moment.

Attenuation of DNA damage repair may influence the cell cycle check point and induce prolonged cell cycle arrest [22]. We therefore investigated the effect of SAS on cell cycle arrest after X-irradiation (Fig 6). The population of G₀/G₁-phase cells significantly increased at 12 h after X-irradiation. Control G₀/G₁-phase cells then decreased to baseline levels at 24 h, whereas SAS pretreatment induced prolonged G₀/G₁ arrest (Fig 6A). Cell numbers in S-phase (Fig 6B) and G₂/M-phase (Fig 6C) were also perturbed by X-irradiation, with control cells returning to baseline levels after 24 h, while SAS pretreatment decreased G₂/M-phase cells at 24 h (Fig 6C). Supporting this result, knockdown of xCT induces these perturbations of cell cycle after X-irradiation (S4 Fig). Therefore, depletion of GSH by SAS attenuated cellular DSB repair capacity and enhanced G₀/G₁ arrest after X-irradiation.

Radio-enhancement effect of SAS on B16F10 allograft tumors

Since SAS decreased intracellular GSH and enhanced radiosensitivity in vitro, we evaluated the effect of SAS on transplanted B16F10 melanomas. Immunohistochemistry of xCT showed enhanced expression in B16F10 tumors and low expression in surrounding skin (Fig 7A and S5 Fig). SAS treatment significantly decreased the intratumoral GSH concentration at 24 h after administration (Fig 7B). We also evaluated the number of γH2AX-positive nuclei after X-irradiation by immunohistochemistry. X-irradiation at 1 Gy slightly increased the number of γH2AX-positive cells, and pretreatment with SAS drastically increased them (Fig 7C). Next, we investigated the effect of SAS treatment on experimental radiotherapy-induced tumor growth delay. As shown in Fig 7D, the tumor volume without treatment increased more than 9.4-fold over 10 days (to 1377.8±163.3 mm³), and SAS alone induced no significant inhibition of tumor growth (1278.4±219.1 mm³ at 10 days). X-irradiation partially decreased tumor growth (993.6±168.2 mm³ at 10 days). Combination therapy of SAS with X-irradiation synergistically decreased tumor growth (651.1±71.9 mm³ at 10 days). These results suggest that SAS treatment sensitized tumors to radiotherapy in the B16F10 cell model.