BACE-1 is expressed in the blood–brain barrier endothelium and is upregulated in a murine model of Alzheimer’s disease

Reagents

All chemicals and reagents were obtained from Sigma (Germany) unless otherwise specified. Nylon mesh cell strainers for microvessel preparation were obtained from BD Biosciences (Germany). Glass-Teflon homogenizer was obtained from Wheaton sciences (USA). Electric overhead stirrer (VOS 14) was from VWR (Germany). Tricarboxy Ethyl Phosphine (TCEP) for Western blotting was obtained from Thermo Fisher Scientific (Germany). All the secondary antibodies for Western blotting were obtained from LI-COR Biosciences (Germany) and for immunofluorescence staining from Invitrogen (Germany). Cell culture media and its components were obtained from GIBCO® (Germany). The primary antibodies used are listed in the Table 1.

Animal care and handling

This study was performed in strict compliance with animal handling protocols approved by the Regierungspräsidium Darmstadt, Germany (No. V54-19c20/15 – F94/18) and following the guide for the Care and Use of Laboratory Animals published by the National Institutes of Health. All the experiments complied with the ARRIVE guidelines for conducting animal experiments. Animals were sacrificed under appropriate anesthesia and every effort was made to minimize their suffering. The number of mice was kept to the minimum required for valid results.

Isolation of mouse brain microvessels (MBMV)

Brain microvessels were isolated from 2-month-old wild-type C57BL/6 mice (6–8 mice/preparation) or hAPP_SL mice at an age of 10 months along with age-matched wild-type mice as described previously.¹⁷ Briefly, animals were anesthetized with isofluorane followed by sacrificing the mice by cervical dislocation and extracting the brains into ice-cold microvessel isolation buffer (1 × MVB¹⁷). The cerebellum and olfactory lobes were removed and meninges were peeled off the cortical hemispheres by rolling on Whatmann filter paper. The brains were then subjected to homogenization 20 strokes using a glass-Teflon homogenizer (0.25 mm clearance) attached to an overhead electrical stirrer, centrifuged at 1000 × g for 10 min at 4℃. The pellet was made to 17% dextran followed by centrifugation at 4000 × g for 30 min to pellet the blood vessels, which was filtered through 70, 40 micron nylon meshes to eliminate erythrocytes and pericytes and to obtain the final microvessels on the 40 micron mesh. The final sample was re-suspended in Hepes EDTA Sucrose buffer (HES; 10:1:250 mM, pH 7.4)¹⁷ containing protease inhibitor cocktail (Roche, Germany) and phosphatase inhibitor cocktail (Sigma, Germany) for Western blotting and stored at –80℃ or directly lysed for RNA in the RLT lysis buffer (Qiagen, Germany) and stored –80℃ for qRT-PCR experiments. For immunocytochemistry, the vessels were re-suspended in 1 × PBS and stored on ice and used immediately.

Isolation of primary MBMECs and culture of HBMECs, hCMEC/D3 cells

Primary mouse brain microvascular endothelial cells (MBMECs) were isolated from 2 to 6 adult C57BL/6 mice in each preparation as described previously with only modification being the use of a dounce homogenizer instead of mincing the tissue.¹⁸ Cultures were maintained and routinely characterized for endothelial markers such as claudin-5, VE-cadherin by immunofluorescence staining, and transendothelial electrical resistance (TEER) assay for barrier tightness as described previously.^18,19 Primary human brain endothelial cells (HBMECs) were obtained at passage 2 from Pelobiotech (Germany) and cultured as above for MBMECs and used within passage 4. Immortalized human brain endothelial line, hCMEC/D3 cells were obtained from Prof Pierre-Olivier Couraud (INSERM, Paris, France) and cultured as we described previously.¹⁹

Fractionation of bovine and HBMECs

Briefly, the microvessels isolated from bovine cerebral cortices were digested with collagenase type IA (1800 units/g) to remove the basement membrane, pericytes, and glial fragments. The refined microvessels were homogenized and the luminal and abluminal membrane fractions were separated by discontinuous Ficoll gradient as indicated in the supplementary flow diagram (Figure S2). Sample purity was assessed as we described previously and stored at –80℃.^20,21

Fractionation of cultured primary HBMECs was performed by classic differential centrifugation. Briefly, confluent HBMECs were harvested in ice-cold isotonic HES buffer plus protease, and phosphatase inhibitor cocktails (Roche) followed by homogenization in a douncer applying 40 strokes. The resultant cell lysate was centrifuged at 1000 × g for 5 min at 4℃ to obtain the nuclear pellet (NU) that was washed once with HES buffer and re-suspended in 10-fold lower SB buffer (2.3 M Urea, 1.5% SDS, 50 mM Tris, 25 mM TCEP, and 0.01% BPB) for Western blotting compared to the starting volume of HBMEC lysate. The supernatant was centrifuged at 15000 × g, 15 min, 4℃ to obtain the Golgi/mitochondrial pellet (trans-Golgi network; TGN) that was washed once as above and also re-suspended in 10-fold lower SB buffer. The supernatant was subjected to ultracentrifugation at 80,000 × g (30,000 r/min, F45L rotor (Piramoon), Sorvall WX Ultra 80 (Thermo Scientific)), 1 h, 4℃ to obtain the plasma membrane (PM) pellet which was again washed once in HES and re-suspended in SB buffer as above. The supernatant was subjected to a final round of ultracentrifugation at 220,000 × g (45,000 r/min) for 3 h, 4℃ to obtain the endosomal vesicles (EN) pellet that was re-suspended in SB buffer. The supernatant represented the cytoplasmic (CYTO) fraction.

RNA isolation and qRT-PCR

For RNA isolation, RNeasy mini kit (Qiagen, Germany) was used according to manufacturer’s protocol for low sample yields, followed by cDNA preparation using First Strand cDNA Synthesis Kit (Fermentas) also according to the manufacturer’s protocol. qRT-PCR using ABsolute QPCR SYBR Green Fluorescein Mix (Thermofisher Scientific, USA) was according to the manufacturer’s protocol applying the following conditions: 15 min at 95℃, 45 cycles of 30 s at 95℃, 30 s at 61℃, and 35 s at 72℃ in MyiQ Real-Time PCR Detection System (Bio-Rad). Analysis of the qRT-PCR data was performed with iQ5 2.1 software (Bio-Rad). Primer sequences (5′-3′, sense_antisense) for qRT-PCR: BACE-1_01(tgccatcactgaatcggacaa_tctgcttcaccagggagtcaa)/BACE-1_02(tggagatggtggacaacctga_cggaggtctcgatatgtgctg)/LRP1(atcaggcgcattgaccttcac_ggccaagccatactgaatcacc)/FcRN(gactgctaggccacctggaga_gaaagcagcacaggtcagcac)/RAGE(aagccctcctgtcagcatcag_ctctcctcacgcctgggttgt)/PgP(gctatcacggccaacatctcc_tgtccaacactgaatgctccaa)/GLUT1(tcgtcgttggcatccttattg_gtagcagggctgggatgaaga)/Cldn5(tgtcgtgcgtggtgcagagt_tgctacccgtgccttaactgg)/ZO1(tgcttctcttgctggccctaa_gggtggcttcacttgaggtttc)/VECadherin(gcccagccctacgaacctaaa_gggtgaagttgctgtcctcgt)/RNApol(atgagctggaacgggaatttga_accactttgatgggatgcaggt)/CD31(attcctcaggctcgggtcttc_ccgccttctgtcacctccttt)/G6PDX(gggtccaccactgccacttt_tttgcgttcattcagggcttt)/RPLPO(gtgtttgacaacggcagcatt_tctccacagacaatgccagga)/AQP4(agtgacagagctgcggcaagg_ttccagaaagcctgagtcca)/NG2(cctggccttggctcttacctt_gctgggatgtggagaactgga)/DCX(ggaaggggaaagctatgtctg_ ttgctgctagccaaggactg).

Western blotting

Samples for Western blotting were solubilized in SB buffer for 1 h at 30℃ with shaking at 600 r/min. Electrophoresis was performed at a constant 80 V for 3 h at room temperature using 7–15% Tris-HCL Bis-acrylamide gels. The separated proteins were transferred to nitrocellulose membrane at 4℃, 36 V constant for 16 h. Reversible Ponceau S staining was performed to confirm equal protein loading and was followed by Western blotting as described previously.²¹ Imaging was performed in Odyssey (LI-COR, Germany) multichannel imaging device and raw images were exported in tiff format using Image Studio 2.1 software (LI-COR, Germany) and quantitation performed as described previously.²¹

Immunocytochemistry and image processing

MBMECs cultured on 24-well transwell inserts or freshly isolated MBMVs were subjected to the immunocytochemistry protocol exactly as described previously¹⁹ with MBMVs first subjected to brief drying on glass chamber slides followed by –20℃ methanol fixation for 4 min or 4% PFA for 10 min at room temperature. At the end of the staining protocol the slides were mounted with coverslips using Aqua-Poly/Mount mounting medium (Polysciences Inc., Germany) and visualized with an 80i microscope (Nikon) and documented with a digital DS-5Mc camera or with a C1si confocal microscope (Nikon). Images were processed in NIS Elements AR Imaging Software (Nikon) and Photoshop CS6 for Macintosh (Adobe). Deconvolution was performed on confocal Z stacks with Huygens Essential software, applying a theoretical point spread function (SVI, The Netherlands).

Immunohistochemistry from human samples

Formalin-fixed and paraffin-embedded normal and CAA brain specimens from patients (ethical review No. 0409) were cut into 4-µm thick sections and automatically stained with antibodies against human BACE-1 (Abcam) and human amyloid-β (Millipore) using standard protocols on the Ventana Discovery XT automated immunohistochemistry system (Roche, Switzerland).

3D-dSTORM super-resolution imaging and analysis

HBMECs were stained exactly as described for MBMECs followed by 3D-dSTORM imaging on a custom-built setup for single-molecule imaging as described previously.²² An astigmatic lens was placed in the emission light path in order to facilitate 3D imaging. Samples were illuminated using ∼2–3 kW/cm² 647 nm excitation (Innova 70C, Coherent) in highly-inclined laminar optical (HILO) sheet imaging mode to reduce background fluorescence; 10.000–15.000 frames were recorded at a frame rate of 33 Hz using the µManager software. Fluorophore density was adjusted by 404 nm reactivation (Coherent Cube 404). Samples were imaged in a buffer containing 50 mM Tris pH 8.0, 75 mM MEA (cysteamine hydrochloride, Sigma Aldrich), 23 mM glucose, and an oxygen scavenger system (20 units glucose oxidase and 400 units catalase, Sigma Aldrich). The final buffer included 70% D₂O to increase brightness of the fluorophores.²² Acquired image series were analyzed using the rapidSTORM software (V. 2.21) and a cubic B-spline calibration followed by creating z-slices with rapidSTORM. All images were post-processed using the Fiji software package (http://fiji.sc/Fiji). Histograms of z-slices were created in Origin Pro 9.1G (Origin Labs) by counting z-positions of all localizations within the depicted region of interest (bin size 50 nm).

Statistics

Most experiments were repeated at least twice with the number of animals included in the corresponding figure legend. Quantitation was performed in Microsoft Excel (MS Office 2008) followed by exporting the data to Prism 5.0 (GraphPad). Graphs and statistics were performed in Prism with the significance level set to p < 0.05. Paired analysis was performed to account for batch-to-batch variations in primary endothelial cell isolation/culture. The specific statistical test and the p values are included in the figure legends.

Expression of BACE-1 in mouse brain microvessels and cultured endothelial cells

Total RNA from mouse brain microvessels was isolated as previously published.¹⁹ We performed quantitative real time RT-PCR to obtain the expression levels of BACE-1 transcripts in vessels and compared it to that of whole brain RNA as a positive control (Figure 1). The purity of microvessel preparations was assessed by the expression of the BBB endothelial marker claudin-5 (Cldn-5) when compared to the whole brain sample (Figure S1). To eliminate the possibility of contamination from other brain cells in the vessel preparation (MBMV) such as neurons that are known to express BACE-1, we isolated and cultured murine brain endothelial cells (MBMECs) as previously described and tested BACE-1 expression in these pure endothelial cells.¹⁸ Purity analysis of MBMV and MBMEC by qRT-PCR is included in the supplementary Figure S1 using markers for astrocytes (aquaporin-4, AQP4), pericytes (neural/glial antigen 2, NG-2), and neurons (doublecortin, DCX). These data show minimal contamination from other cell types in the MBMV and the complete absence of contamination in MBMECs. Using two different primer pairs we observed a significant expression of BACE-1 in microvessels and in pure cultured endothelial cells (∼30%; Figure 1) compared to whole brain lysates. Consequently, the detected expression of BACE-1 is primarily endothelial-specific in the vessels fragments (MBMVs) and in the pure, primary cultured cells (MBMECs) it is entirely of endothelial origin. Protein analysis was first performed by Western blotting for BACE-1 after testing six commercially available anti-BACE-1 antibodies with corresponding competing peptides to show specificity and employing recombinant BACE-1 as a positive control. Three of these antibodies showed strong reactions with BACE-1 in the total protein extracts from mouse brain microvessels with an electrophoretic mobility corresponding to ∼75 kDa as predicted from the literature for the full-length protein (Figure 2b, c). Figure 2 shows that the full-length isoform (∼75 kDa), known to be the active isoform,²³ is indeed expressed in brain endothelial cells. The antibody against the N-terminus that is able to detect most isoforms also showed a strong band at ∼50 kDa, likely representing the soluble isoform that lacks the intra-cellular domain recognized by the two antibodies against the C-terminus.¹⁴ The function of the soluble isoform is not entirely clear.

Localization and activity of BACE-1 at the BBB

We next performed immunofluorescence staining for BACE-1 in purified wild-type brain microvessels and in cultured MBMECs employing the N-terminal antibody (B 0681) that showed strongest immunoreactivity in Western blots for both isoforms (Figure 3a, b). We detected BACE-1 in the vessels as well as in MBMECs with an expression profile indicating localization at the PM and in intracellular compartments as described previously for other cell types.¹⁴ The staining for Cldn-5 was primarily junctional and present in all the cells, confirming the purity of MBMEC cultures and microvessel preparations (Figure 3b).¹⁸ To investigate the distribution of BACE-1 at the BBB endothelium, we utilized fractionated bovine brain microvessels as described previously.²¹ Using markers for luminal (blood-facing) and abluminal (brain-facing) membranes such as P-glycoprotein (PgP) and glutamate transporter (EAAT2), respectively, we obtained the localization of BACE-1 at these membranes. GLUT-1 served as a marker expressed equally on both membranes. Our data indicate a predominant localization of BACE-1 at the abluminal membrane, as the quantification showed ∼2.5-fold higher concentration on this site when compared to the luminal membrane (Figure 3c). The intracellular, endosomal vesicles showed minimal BACE-1 content (Figure S3b).

In order to elucidate if BBB endothelial BACE-1 is enzymatically active, we treated MBMECs from adult wild-type mice (C57BL/6) with a commercial BACE-1 inhibitor (10 µM inhibitor IV, Merck) in medium containing 20% bovine serum that is known to contain full length APP.^3,4 The endothelium as a source of APP, however, cannot be ruled out. The Western blot data indicate an increase in the expression of both the mature APP and the soluble APP-α (sAPP-α) isoforms in the medium upon BACE-1 inhibition (Figure 3d). The higher levels of mature APP in BACE-1-inhibited cells indicates that the majority of the full-length APP is not cleaved, which indicates that active BACE-1 has been inhibited in brain endothelial cells. Soluble sAPP-α is a cleavage product of α-secretase, whose activity has been shown to be increased upon BACE-1 inhibition by a competition mechanism in vivo, again suggesting that brain endothelial cells do possess active BACE-1.²⁴

In order to understand if BACE-1 is also expressed in a comparable fashion in human brain ECs, primary cultured human brain endothelial cells (HBMECs) were stained for BACE-1 (Figure 4a). The punctate expression pattern was similar to those in MBMECs, and the endothelial adherens junction marker VE-cadherin displayed the expected junctional localization. Western blot analyses for BACE-1 in HBMECs and hCMEC/D3 (transformed human brain endothelial cells) also showed the specific BACE-1 band at ∼75 kDa, Cldn-5 served as an endothelial-specific marker (Figure 4b). The expression of BACE-1 in D3 cells was higher than in HBMECs that could be explained by potential differences between the transformed cell line and primary cells. Scientifically more attractive but difficult to recapitulate in these cells might be age-related differences in BACE-1 levels between the donors of these cell types.

To microscopically elaborate the subcellular localization of BACE-1 in HBMECs, we subjected these cells to super-resolution imaging. 3D-dSTORM imaging of BACE-1 in HBMECs showed an axial distribution of BACE-1 corresponding primarily to the PM (Figure 4c, Figure S5). This distribution was similar to that of laminin α5, a PM marker (Figure S4). The apico-basal distribution of BACE-1 in cultured HBMECs is however not comparable to freshly isolated/fractionated bovine endothelial cells (Figure 3c) due to a loss of endothelial polarity in culture resulting from a downregulation of several BBB-specific markers.²⁵ To more quantitatively assess the subcellular localization, HBMECs were fractionated by differential centrifugation followed by Western blotting. We observed a significant enrichment of BACE-1 in the PM and the TGN fractions (Figures 4d and S3a). It was previously reported that BACE-1 could cycle between the TGN, endosomes, and the PM. BACE-1 and APP from the PM location are known to be segregated into endocytic vesicles that are targeted to endosomal compartments for optimal activity of BACE-1, ensured by the acidic environment.⁸ BACE-1 was also detectable in endosomal (EN) and cytoplasmic (CYTO) fractions albeit to a much lesser extent. BACE-1 in the nuclear fraction (NU) is most likely a result of unbroken cell membranes resulting from incomplete homogenization that contaminate the nuclear fraction.

Expression and regulation of endothelial BACE-1 in vivo in healthy and CAA/AD brain

In order to investigate whether human brain vessels also express BACE-1, we performed immunohistochemistry on human brains sections. The data show expression of BACE-1 in the microvessels of both the white and grey matter (Figure 5a, b). We also observed BACE-1 staining in larger vessels of the leptomeninges (Figure 5c), which are more frequently associated with CAA.² Neurons served as a positive control since they are known to express functional BACE-1 (Figure 5d). We further analyzed a single human CAA case for the expression of BACE-1 at the BBB in a diseased state. We observed a robust BACE-1 staining in the vessels of the CAA brain that showed intense amyloid-β deposits, implicating BBB-localized BACE-1 in the amyloid angiopathy (Figure 5e).

After establishing BACE-1 expression and its activity at the healthy BBB, we addressed the significance of BACE-1 at the BBB in a mouse model for AD. To this end, we isolated brain microvessels from transgenic mice (hAPP_SL) over-expressing the 751 amino acid form of human amyloid precursor protein (hAPP) with London (V717I) and Swedish (KM670/671NL) mutations under the control of the murine Thy-1 promoter.¹⁶ The hAPP_SL mice show an age-dependent increase of Aβ peptides and develop amyloid plaques at an early stage of 3–4 months. In these mice, severity of the brain pathology correlates with increasing age and is characterized by behavioral deficits. In addition, the mice develop CAA with amyloid plaques on SMA-positive blood vessels. In qRT-PCR experiments, we observed a ∼4-fold increase of BACE-1 expression in the BBB microvessels isolated from 10-month-old hAPP_SL mice when compared to age-matched wild-type mice, suggesting an increased APP processing activity by BACE-1 at the BBB in mutant animals (Figure 6a). Several endothelial marker genes such as VE-cadherin and tight junction molecules such as ZO-1 and Cldn-5 were unchanged whereas GLUT-1, the primary glucose transporter at the BBB, was downregulated similar to what was observed in the brains of AD patients, indicating an impairment of the BBB.²⁶ Interestingly, the transcript for luminal Aβ transporter receptor for advanced glycation end products (RAGE) was upregulated in the AD mice. This might suggest that blood-derived Aβ could potentially contribute to vascular and brain amyloidosis, which was demonstrated by Eisele and colleagues²⁷ by peripheral intraperitoneal administration of β-amyloid extracts in mice. Furthermore, the luminally expressed PgP, known to be involved in the efflux of Aβ into the circulation, was downregulated in AD MBMVs, suggesting a decreased clearance of Aβ from the brain by these ECs. The involvement of PgP in Aβ clearance has previously been observed by Cirrito and colleagues²⁸ in PgP-null mice upon intrathecal Aβ administration. In contrast to what was observed in AD, the abluminally located LRP-1 transporter, conferring Aβ clearance from the brain into the BBB endothelium, was upregulated in the hAPP_SL transgenic mice.²⁹ As LRP-1 is also involved in APP endocytosis,³⁰ increased BACE-1 activity together with increased endocytosis of APP from neuronal sources³¹ may result in more Aβ production in brain endothelial cells. Finally, we did not observe any change in the transcript for the neonatal Fc receptor (FcRN), an abluminal transporter, which mediates brain clearance of antibody-bound Aβ.³² A schematic for amyloid processing and transport at the BBB including the potential role of BACE-1 in the endothelium is shown in Figure 6(b).