Excess sphingomyelin disturbs ATG9A trafficking and autophagosome closure

NPA fibroblasts accumulate immature autophagic membranes

To enlighten the impact of SM metabolism on autophagy, we first investigated primary NPA patient fibroblasts with low residual SMPD1 enzyme activities and corresponding intracellular accumulation of SM (Fig. 1A and B). Notably, the activities of lysosomal cysteine cathepsins and NAGLU (N-acetyl-glucosaminidase, alpha) were not compromised in NPA cells (Fig. 1C and data not shown). In line with this, the lysosomal membranes of NPA fibroblasts were intact as shown by the absence of LGALS1/galectin-1- or LGALS3/galectin-3-positive lysosomes (Fig. 1D). Indicative of reduced autophagic flux, all NPA cells accumulated MAP1LC3B-positive puncta, and had increased levels of MAP1LC3B -II and an autophagic cargo protein SQSTM1/p62, which were only marginally increased upon autophagy inhibition by concanamycin A (ConA) (Fig. 1E and F). The autophagy defect could be effectively reverted by recombinant human (Homo sapiens) SMPD1 (rHsSMPD1) and bacterial neutral sphingomyelinase (bSMase) and partially overcome by amino acid starvation (Fig. 1G-I).

Analysis of the ultrastructure of NPA fibroblasts by TEM revealed a complete lack of normal initial (AVi) or degradative (AVd) autophagic vesicles (Fig. 2A and B). Instead, they had numerous unclosed and elongated membranes resembling omegasomes and phagophores that were only infrequently found in control fibroblasts (Fig. 2A i, ii, vii and B). Some of them formed vesicle-like structures with swollen intermembrane space and small vesicles frequently attached to their outer membranes (Fig. 2A vi). Lysosomes were enlarged and contained inclusions of electron-dense and lamellar structures indicative of membrane stacking and accumulation (Fig. 2A iv, v). Super resolution 3D-SIM confirmed the accumulation of WIPI2- and MAP1LC3B-positive immature membranes in NPA fibroblasts (Fig. 2C and D, and movies 1 to 4). Induction of autophagosome biogenesis by starvation resulted also in an increase in early autophagic membranes in control cells (Fig. 2C and D). They were, however, less abundant and generally smaller and more compact than in NPA fibroblasts. In contrast, ConA, which inhibits autophagic cargo degradation and triggers autophagosome biogenesis,²² increased the number of MAP1LC3B positive structures in control cells without altering the proportions of immature and mature vesicles (Fig. 2C and D). Confocal microscopy confirmed the accumulation of WIPI2 and MAP1LC3B-positive phagophores in NPA fibroblasts and revealed an additional accumulation of MAP1LC3B-negative WIPI2 puncta with a diameter of 200 to 400 nm corresponding to the size of early omegasomes (Fig. 2E). Akin to MAP1LC3B puncta (Fig. 1F), the accumulation of WIPI2-positive autophagic membranes was effectively reverted by bSMase (Fig. 2E).

Collectively, these data reveal NPA as a severe autophagy disorder manifested by impaired maturation of early autophagic membranes.

SMPD1 is essential for autophagosome formation in MCF7 breast cancer cells

Chronic SM accumulation in NPA patient cells has numerous secondary effects on cellular functions.²³ Thus, we investigated the more direct effects of SM on autophagy in SMPD1 siRNA-treated MCF7 breast cancer cells expressing various MAP1LC3B reporter constructs. As expected, SMPD1 siRNAs effectively reduced the SMPD1 activity and increased the volume of the lysosomal compartment with only small effect on other lysosomal hydrolases (Fig. 3A and S1A to 1C). SMPD1 siRNAs increased the number of enhanced green fluorescence-MAP1LC3B (eGFP-LC3B)-positive autophagic puncta but reduced autophagic flux as analyzed by MAP1LC3B-II and SQSTM1 immunoblots and a Renilla luciferase reporter-based MAP1LC3B turnover assay (Figs. 3A to D and S1D). The autophagy inhibitory effect of SMPD1 siRNAs was further supported by the accumulation of predominantly yellow (neutral pH) puncta in MCF7 cells expressing a tandem fluorescent MAP1LC3B fusion protein, tfLC3B (Figs. 3E and S1F), whose acid-sensitive green fluorescence is lost upon fusion of autophagosomes and lysosomes while the red fluorescence remains.²⁴ Similar to NPA cells, the ultrastructural analysis revealed abnormal, elongated and enlarged phagophores, and super resolution 3D-SIM verified the abundance of unclosed WIPI2- and eGFP-LC3B-positive omegasomes and phagophores in SMPD1 siRNA-treated MCF7-eGFP-LC3B cells (Fig. 3F and G). Staining of SMPD1-depleted MCF7-eGFP-LC3B cells for WIPI2 and ATG16L1 verified an increase in early autophagic membranes, especially those positive for WIPI2 alone or together with ATG16L1 or eGFP-LC3B (Figs. 3H, 3I and S1G). Notably, the accumulating phagophores did not contain SM at levels detectable by a SM-binding protein, lysenin (Fig. 3J). CRISPr-Cas9-mediated homozygous deletion of SMPD1 induced a similar phenotype regarding the enlargement of the lysosomal compartment and accumulation of WIPI2- and MAP1LC3B-positive puncta (Fig. 4A to E). Notably, even the total SMPD1 deficiency did not destabilize lysosomal membranes as demonstrated by the lack of LGALS3 puncta formation (Fig. 4F).

These data support the hypothesis that the NPA-associated autophagy defect is a direct consequence of reduced SMPD1 activity rather than a secondary adaptive response, and that it is primarily caused by a failure to form proper autophagic vesicles rather than destabilization of lysosomal membranes as suggested previously.²¹

Altered trafficking of ATG9A in SMPD1-deficient cells

ATG9A and ATG2A being essential for the maturation and closure of phagophores, we investigated their codistribution with autophagic membranes in organelle fractions from fibroblasts from 2 controls and 2 NPA patients. Early autophagic membranes were found in light density fractions 1 and 2 as judged by the presence of WIPI2 and MAP1LC3B-II and the absence of lysosomal markers (Figs. 5A, S3A and S3B). ATG9A was not detected in these fractions in untreated control cells, but approximately 4% of total ATG9A appeared there after autophagy induction (Figs. 5A and S3B). In spite of the abundance of phagophores, fractions 1 and 2 from NPA cells were devoid of ATG9A, whereas no consistent difference in the distribution of ATG2A or ATG16L1 was observed between control and NPA cells (Figs. 5A, S2A and S2B).

Contrary to the rather even punctate distribution throughout the cytosol and plasma membrane of control cells, ATG9A accumulated in the juxtanuclear Golgi region in NPA cells (Fig. 5B). The distribution of Golgi-resident protein GOLGA1 (golgin A1) was, however, largely unaltered and LAMP2 (lysosomal-associated membrane protein 2) that traffics from the Golgi to lysosomes did not concentrate in the Golgi region (Figs. 5B and S2C). Abundance and localization of EEA1 (early endosome antigen 1) were also unaltered in NPA cells (Fig. S2C). On the contrary, immunocytochemistry suggested NPA-associated alterations in the localization of REs but due to very heterogeneous staining patterns in primary fibroblasts, the data remained inconclusive. Thus, we continued the analysis in more homogenous MCF7-SMPD1-KO cells, in which ATG9A showed an NPA-like accumulation in the Golgi region with only a modest direct colocalization with Golgi markers (GOLGA1, TGOLN2/TGN46 and M6PR) (Figs. 5B and S2D). Instead, TFRC, which normally traffics in a SM-dependent manner between plasma membrane and juxtanuclear REs,¹³ displayed a significantly increased colocalization with ATG9A in the juxtanuclear area of SMPD1-KO cells (Fig. 5C and D). In line with the ability of starvation to partially overcome the autophagy defect in SMPD1-deficient cells (Fig. 1H), it reverted the juxtanuclear clustering of ATG9A and TFRC-positive puncta and induced their more peripheral distribution (Fig. 5C, bottom). The lack of SMPD1 did not affect the expression levels of ATG9A or TFRC but increased their mobility in SDS-PAGE (Fig. 5E), possibly reflecting their reduced phosphorylation.^25,26 Additionally, the juxtanuclear clustering of ATG9A was associated with its significantly reduced colocalization with WIPI2-positive early autophagic membranes in unstressed and starved SMPD1-KO cells (Figs. 5F and S2E). Contrary to ATG9A, ATG16L1, which has been reported to interact with ATG9A in TFRC-positive REs,⁹ did not accumulate in the juxtanuclear area and its association with WIPI2 was increased in SMPD1-depleted cells (Figs. 3H, 3I and S1G). Importantly, ectopic expression of eGFP-ATG9A rescued the autophagy defect in SMPD1-KO cells as demonstrated by the significant reduction of WIPI2 and MAP1LC3B puncta (Figs. 5G and S2F). Contrary to the endogenous ATG9A, the ectopic eGFP-ATG9A did not cluster in the juxtanuclear area but was more evenly distributed in the cytoplasm and plasma membrane (Fig. S2F). These data strongly suggest that the trapping of ATG9A in the TFRC-positive RE compartment contributes to the maturation defect of autophagic membranes in SMPD1-deficient cells.

Excess SM disturbs autophagosome biogenesis

Next, we investigated whether the autophagosome maturation defect caused by reduced SMPD1 activity was due to the accumulation of SM or lack of its breakdown product ceramide. Supporting the former, C12-SM increased the levels of both SQSTM1/p62 and LC3-II in control fibroblasts, whereas C16-ceramide failed to revert the autophagy defect in patient fibroblasts (Fig. 6A). Similar results were obtained in control fibroblasts treated with BODIPY®-FL-labeled C12-SM (data not shown), which was effectively internalized and distributed mainly to nonlysosomal, WIPI2-negative membranes and accumulated in the juxtanuclear area (Fig. 6B). C12-SM treatment of control fibroblasts resulted in the enlargement of the acidic compartment and accumulation of WIPI2-, as well as WIPI2- and MAP1LC3B-positive unclosed autophagic membranes that resembled omegasomes and phagophores (Fig. 6C to F). This phenotype was effectively reverted by the addition of bSMase (Fig. 6D and E). Treatment with C12-SM and C16-SM also phenocopied the juxtanuclear clustering of ATG9A and increased ATG9A colocalization with TFRC (Fig. 6G and S3). Thus, the excess SM rather than lack of its metabolites, is the likely cause of the autophagy defect in SMPD1-deficient cells.

Autophagy defect in smpd1-deficient mice

Corroborating a physiological role for SM in autophagy in vivo, SQSTM1 and MAP1LC3B-II accumulated in pneumocytes, hepatocytes and renal tubules of smpd1-deficient (smpd1^−/−) mice (Fig. 7A and B). MAP1LC3B-II accumulated also in smpd1^−/− neurons, where SQSTM1 was only marginally increased (Fig. 7A and B). More detailed analysis of smpd1^−/− kidneys revealed a significant increase also in MAP1LC3B and WIPI2 puncta, and prominent juxtanuclear clustering of ATG9A (Figs. 7C, 7D and S4).

Next, we tested the functional consequences of the smpd1^−/−-associated autophagy defect in a kidney ischemia-reperfusion (IR) model, in which autophagy plays a protective role.^27,28 The sham-operated smpd1^−/− kidneys displayed a significantly higher number of strongly SQSTM1- and MAP1LC3B puncta-positive cells than the wild-type kidneys consistent with a basal autophagy defect (Fig. 7E). Ischemia decreased the levels of MAP1LC3B-II in wild-type and smpd1^−/− kidneys, indicative of autophagosome turnover in both genotypes (Fig. 7F). Reperfusion resulted, however, in a greater increase in MAP1LC3B puncta- and SQSTM1-positive cells and MAP1LC3B-II levels in smpd1^−/− kidneys than wild-type ones (Fig. 7E and F). These data suggest that the autophagy response of kidneys exposed to IR injury is defective and autophagosome maturation and turnover are delayed although not completely absent in smpd1^−/− kidneys. Accordingly, smpd1 deficiency worsened renal IR injury considerably as indicated by significantly higher elevations in serum urea and creatinine, more severe renal tissue damage, and dramatically decreased survival when compared to similarly treated wild-type mice (Fig. 7G to I).

Cell culture and treatments

Fibroblasts were cultured in DMEM supplemented with glutamax, 12% fetal calf serum (FCS), nonessential amino acids and antibiotics (Life Technologies, 31966–021, 10270–106, 11140–050, 15140–122), and MCF7 breast cancer cells and their derivatives in RPMI-1640 supplemented with 10% FCS and antibiotics (Life Technologies, 61870–010, 10270–106, 15140–122). NPA-1 fibroblasts from a 5-mo-old NPA patient with hepatosplenomegaly were kindly provided by Professor Konrad Sandhoff (University of Bonn, Bonn, Germany). NPA-2 (GM13205) and NPA-3 (GM00112) fibroblasts from NPA patients as well as HC-1 (GM05659), HC-2 (GM06808) and HC-3 (GM00200) fibroblasts from healthy individuals were obtained from Coriell Cell Repositories. The origin of the S1 clone of MCF7 human breast carcinoma cells,⁴⁶ and its transfected derivatives expressing eGFP-LC3B,⁴⁷ mRFP-eGFP-LC3B,⁴⁸ and RLuc-LC3B⁴⁹ has been described previously.

Amino acid starvation was performed in Hank's balanced salt solution (HBSS) containing 1 g/L glucose (Gibco, 14025–050). C16-Ceramide (d18:1/6:0) C12-SM (d18:1/12:0) and C16-SM (d18:1/16:0) were from Avanti Polar Lipids (860516P, 860583P, 860584P) and BODIPY® FL C12-SM from Life Technologies (D-7711). Neutral bSMase was purified from Bacillus cereus (Sigma-Aldrich, S9396). Recombinant human SMPD1 (stock 4g/L) was provided by Dr Petra Ross-Macdonald (Genzyme). L-leucyl-L-leucine-O-methylester (LLOMe) and concanamycin A were from Santa Cruz Biotechnology (sc-285992) and Sigma-Aldrich (27689), respectively.

CRISPr-Cas9

The guide RNA sequence to target exon 1 of the human SMPD1 was chosen from the “Bioinformatically computed genome-wide resource of candidate unique gRNA targets in human exons” (http://arep.med.harvard.edu/human_crispr).⁵⁰ SMPD1-gRNA-f (ACCGGCGGAGTGACGCTCCGTAG) and SMPD1-gRNA-r (AAACCTACGGAGCGTCACTCCGC) oligos were annealed and inserted into the guideRNA plasmid digested with Bsa1. MCF7 cells were transfected with guide-RNA vector, cas9 expression vector and pBabe-puro and selected for 72 h in 1 µg/ml puromycin (Sigma-Aldrich, P-7255). Single cell clones were established and tested for SMPD1 activity. Clone 2.5 with very low activity was chosen for further study and the target site was amplified using following primers: CRISPr-SMPD1-f: GAGAGATCAGCTGTCAGAGA and CRISPr-SMPD1-r: CCATCAGGGATGCATTCTGA. Sequencing revealed a homozygous deletion of 4 base pairs deletion and one substitution at the target site (Fig. S2A).

Subcellular fractionation

Pellets of approximately 10 × 10⁶ cells washed in ice cold Dulbecco's phosphate-buffered saline (DPBS; Life Technologies, 14190–094) were suspended in 1 vol of homogenization buffer (10 mM Tris-HCl [Sigma-Aldrich, T1378], pH 7.4, 1 mM EDTA [Riedel de Haen, 27270], and 0.25 M sucrose [Sigma-Aldrich, S0389]) containing 5x cOmplete protease inhibitor cocktail (Roche, 11697498001). Postnuclear supernatant fractions were collected by centrifugation at 1500 g for 10 min and top-layered on an 8 ml preformed continuous iodixanol 0 to 32% gradient (Sigma-Aldrich, D1556).⁵¹ Organelle and membrane separation by sedimentation was performed at 100000 g for 17 h after which 500-µl fractions were manually collected from the top. The whole procedure was performed at 4°C. The linearity of the gradient and the integrity of the purified organelles were confirmed by measuring in each fraction OD₂₄₄ and lysosomal activity (NAGLU activity after digitonin extraction), respectively.

Transfections

siRNAs were transfected with Oligofectamine (Invitrogen, 12252–011) at 20 nM according to the manufacturer's protocol and cells were analyzed 72 h later if not otherwise indicated. ATG2A/B,¹⁰ ATG5,⁵² BECN1,²², MCOLN1,⁵³ RPTOR,⁴⁸ SMPD1-1 and SMPD1-2,¹⁸ ULK1-5 and ULK1-6,⁴⁵ and nontargeting control⁵⁴ siRNAs were purchased from Qiagen or Invitrogen and ATG4B siRNA (A-005786-13) was from Dharmacon. The pN1 vector encoding eGFP and the pN1-ATG9A plasmid encoding eGFP fused to ATG9A were kindly provided by Professor Tamotsu Yoshimori (Osaka University, Japan).⁵⁵ Plasmids were transfected to subconfluent cells with a carrier DNA (1:5) using FuGENE® HD reagent (Promega, E2311) according to the manufacturer's instructions. The transfected cells were analyzed 48 h after the transfection.

Hydrolase activity assays

Total SMPD1 activity in cultured cells and tissue samples was measured by the cleavage of HMU-PC using the SMPD1 activity kit (Echelon Bioscience, K-3200) as recommended by the manufacturer. Total cysteine cathepsin and NAGLU/β-N-acetyl-glucosaminidase activities were determined as previously described.⁵⁶

Volume of acidic compartment (VAC)

Cells plated in 96-well plates (10,000 cells per well) and treated as indicated were incubated with 0.1 µg/ml Hoechst 33342 (Life Technologies, B2261) and 25 nM LysoTracker Red DND-99 (Molecular Probes, L-7528) for 15 min at 37°C. Thereafter, both fluorescence intensities were measured by Celigo® Cell Imaging Cytometer (Brooks Automation, Chelmsford, MA, USA) and the resulting images were analyzed by ImageJ.

Antibodies

Primary antibodies used included murine monoclonal antibodies against ceramide (Sigma-Aldrich, C8104), HSP90 (HSP90AA1 and HSP90AB1; BD Transduction Laboratories, 610418), MAP1LC3B (NanoTools, 0231–100), LAMP2 (Developmental Studies Hybridoma Bank, clone H4B4), M6PR (Thermo Fisher Scientific Pierce, MA1-066), TFRC (Life Technologies, 13–6800), TGOLN2/TGN46 (Abcam, ab2809) and WIPI2 (Abcam, ab105459), rabbit antibodies against SQSTM1/p62 (Enzo Scientific, BML-PW960), TUBA1A/alpha-tubulin (Abcam, ab15246), ATG2A (MBL Life Science, PD041), ATG2B (Sigma-Aldrich, HPA019665), ATG9A for immunoblotting (Cell Signaling Technology, D4O9D), ATG9A for staining (Abcam, ab71795), ATG16L1 (Cell Signaling Technology, D6D5), CAT (catalase; Abcam, ab1877), EEA1 (Abcam, ab2900), GOLGA1 (golgin A1; Life Technologies, A21270), LAMP1 (Abcam, ab24170), MAP1LC3B (Cell Signaling Technology, 3868), lysenin (Peptides International, NLY-14802-v), RAB11 (Cell Signaling Technology, 5589), WIPI2 (Abcam, ab131271), and rabbit anti-LGALS1/galectin-1 (Abcam, ab25138), rat anti-LGALS3/galectin-3 supernatant (anti-Mac-2, kindly provided by Dr. Hakon Leffler, Lund University, Sweden) and guinea pig polyclonal antibodies against SQSTM1/p62 (Progen Biotech, GP62-C). Appropriate peroxidase-conjugated secondary antibodies were from Vector Laboratories, DAKO A/S and Abcam (anti-rabbit IgG, Vector Laboratories, PI-1000; anti-mouse IgG, DAKO, P0260; anti-guinea pig IgG, Abcam, ab6771), and Alexa Fluor 488-, Alexa Fluor 555-, Alexa Fluor 568-, Alexa Fluor 594- and Alexa Fluor 647-conjugated secondary antibodies for were from Invitrogen (A-21202, A-21206, A-21422, A-11077, A-21043, A-21207, A-21235, A-21245).

Immunoblotting

Cells were lysed in Laemmli sample buffer (125 mM Tris, pH 6.7, 20% glycerol, 140 mM SDS [Sigma-Aldrich, G5516 and L3771]) supplemented with 3x complete protease inhibitor cocktail (Roche, 11697498001) and 40 µg/ml pepstatin A (Roche, 10359053001) at 10000 cells/µl. After addition of 0.1 M dithiothreitol and bromophenol blue (Sigma-Aldrich, D9779 and B0126), boiling and separation by 4–20% gradient SDS-PAGE, proteins were transferred onto polyvinylidene difluoride (PVDF) membranes using Bio-Rad Trans-Blot Turbo system. Membranes were blocked with DPBS containing 5% milk and 0.1% Tween-20 (Sigma-Aldrich, 274348) and labeled with the antibodies listed above. The signal was detected with Clarity Western ECL Substrate (Bio-Rad, 170–5061), and Luminescent Image Reader (LAS-1000Plus, Fujifilm, Tokyo, Japan), and quantified by densitometry with ImageJ software.

Immunocytochemistry

Cells were grown on glass coverslips, fixed with 4% paraformaldehyde (Ampliqon, 43226.1000) or ice-cold methanol (Fluka 34966), quenched with 50 mM ammonium chloride (Sigma-Aldrich, A0171) in DPBS, permeabilized and blocked in 5% goat serum (DAKO, X0907), 1% BSA (Amresco, E531), 0.3% Triton-X-100 (Sigma-Aldrich, T9284) in DPBS, and stained with the antibodies listed above. Nuclei were labeled with 5 µg/ml Hoechst 33342 and coverslips were mounted with Prolong Gold Antifade mounting medium (Life Technologies, P36930). Images were acquired using a Zeiss LSM510 microscope with a Plan-Apochromat 63x/1.40 Oil DIC M27 objective or a Zeiss LSM700 microscope with _ECPlan-Neofluar 40x/1.30 Oil DIC M27 or Plan-Apochromat 63x/1.40 Oil DIC M27 objective and Zen 2010 software (all equipment and software from Carl Zeiss, Jena, Germany). Pinholes were set so that the section thickness was equal for all channels and ≤ 1AU. For colocalization analyses, z-stacks (300-nm slices) were acquired. Cell contours (n > 20) were defined manually and green and red thresholds were set up in single channel mode and retained for all samples in an experiment. Manders coefficients were obtained with the colocalization module of the Zen 2012 (Black Edition) software using one slice per stack.

SM staining

To label intracellular SM, cells growing on cover slips were fixed for 10 min in ultrapure 3.7% paraformaldehyde (TH.Geyer Polysciences, 18814–20), quenched for 10 min in 50 mM NH₄Cl, permeabilized with 50 µg/ml digitonin (Sigma-Aldrich, D141) for 15 min, blocked for 30 min in DPBS containing 5% goat serum and 2% BSA at 20°C and incubated with 1 µg/ml lysenin (PeptaNova GmbH, 4802-v) in the blocking buffer for 18 h at 4°C. After washing, lysenin was visualized with rabbit anti-lysenin antiserum (PeptaNova GmbH, 14802-v) and anti-rabbit Alexa Fluor 594 secondary antibody (Invitrogen, A-21207).

Autophagy assays

The puncta formation in MCF7 cells expressing fluorescent MAP1LC3B constructs was assessed after fixation in 3.7% formaldehyde (Sigma-Aldrich, 252549) applying a Zeiss LSM510 microscope. In fibroblasts, MAP1LC3B-puncta formation was analyzed after methanol permeabilization and antibody staining. A minimum of 200 randomly chosen cells was counted for each condition. Autophagic flux was analyzed by measuring the ratio of luciferase activities in lysates of MCF7 cells expressing RLuc fused to either wild-type LC3B or its autophagy deficient mutant, LC3B^G120A, essentially as described previously.⁴⁹

Confocal analysis of autophagic membranes

Confocal images were acquired by confocal laser scanning microscope 700 using Zen2009 software (Carl Zeiss, Jena, Germany). After subtraction of the image background (rolling ball algorithm) and thresholding, colocalization of 2 molecules was determined using the ImageJ Colocalization plugin, and the colocalization of a third molecule by determining the extent of colocalized spots using the RG2B plugin.

Super resolution microscopy—3d-structured illumination microscopy (3D-SIM)

SIM was performed using a 63x, 1.4NA, oil immersion objective lens (Carl Zeiss, Jena, Germany) and an sCMOS camera (PCO.edge, Germany) mounted on an Elyra PS.1 microscope (Carl Zeiss, Jena, Germany). Samples were illuminated with 488 and 561 nm lasers passed through diffraction gratings of 34 and 42 µm, respectively. The illumination pattern was shifted 5 times laterally and rotated 3 (MCF7) or 5 (fibroblasts) times laterally. Processing was performed with Zen software black edition 2012 and the channels were aligned in x, y, z according to a matrix calculated with an image of 100 nm beads recorded in the same conditions as the sample. Autophagic structures were classified according to their morphology after 3-D modelization using Zen software (black edition 2012) and the indicated markers.⁵⁷ WIPI2 and LC3-positive puncta with diameter less than 100 nm (resolution limit) were excluded from quantification.

TEM

TEM was performed as described previously.⁵⁸ Fifteen sections (primary magnification ×10,000) were chosen randomly from 2 independent blocks of each sample. The volume of autophagic vesicles was estimated by morphometry using the Visilog program (Noesis Vision, Inc., France). Autophagic structures were classified as described previously.⁵⁹

LGALS1/3 puncta assay

Lysosomal membrane permeabilization was detected by staining leaky lysosomes with anti-LGALS1 and/or anti- LGALS3 antibody as described previously.³⁷

Mice and treatments

Mice used included 6- to 8-wk-old male C57Bl/6 mice (Charles River, Sulzfeld, Germany) or smpd1^−/− mice on a C57Bl/6 × 129/SVEV background and backcrossed over 10 generations to C57Bl/6 background.⁶⁰ The broadly used technique of IR acute kidney injury has been described in detail previously.⁶¹ The mice were either sacrificed 48 h after reperfusion for blood and kidney collection or observed for survival. The time of ischemia was 35 min (survival experiments) or 30 min (all other experiments). Sham-operated mice underwent the identical procedure without clamp settings. All in vivo experiments were performed according to protocols approved by the Protection of Animals Act and approved by the institutional review board.

Immunohistochemistry

Murine organs were fixed in 4% neutral-buffered formaldehyde (Surgipath, Leica 00600E) for 24 h and dehydrated in a graded ethanol series and xylene (Sigma-Aldrich, 32221 and 534056) and finally embedded in paraffin. For chromogenic stainings, paraffin sections (3 to 5 µm) were stained with periodic acid-Schiff reagent (Sigma-Aldrich, 395B) and the indicated antibodies according to a standard routine protocol. Stained sections were analyzed using an Axio Imager microscope (Zeiss, Oberkochen, Germany) at 400x magnification. Micrographs were digitalized using an AxioCam MRm Rev 3 FireWire camera and AxioVision Rel. 4.5 software (Carl Zeiss, Jena, Germany). Experienced pathologists quantified the percentage of SQSTM1-positive or MAP1LC3B-positive cells and the organ damage score (scale ranging from 0 (unaffected tissue) to 10 (severe organ damage) in a double-blinded manner as previously described.⁶²

For staining with fluorescent antibodies, 4-µm sections were deparaffinized in xylene and antigen retrieval was performed by boiling in Tris EDTA buffer, pH 9.0, for 10 min in a microwave oven. After blocking with 5% FCS in DPBS, sections were stained with the indicated antibodies, nuclei labeled with 2.5 µg/ml Hoechst 33342 and coverslips mounted with Prolong Gold Antifade mounting medium. Z-stacks (1-µm slices) were acquired with an LSM 700 confocal microscope using the Plan-Apochromat 63x/1.40 Oil DIC M27 objective and Zen 2010 software (Carl Zeiss, Jena, Germany). Maximum projections were created from the z-stacks using ImageJ analysis software (Fiji).

Statistical analysis

Statistical significance was evaluated using the 2-tailed, unpaired Student t test. The degree of colocalization between fluorophores was quantified by Manders overlap coefficient.