Topoisomerase II minimizes DNA entanglements by proofreading DNA topology after DNA strand passage

DNA and topoisomerases

Plasmids pBR322 (4.3 kb) and YCp50 (7.9 kb) were purified by density gradient centrifugation in cesium chloride following standard procedures. Topoisomerase I of vaccinia virus (T1) was produced in Escherichia coli and purified as previously described (26). A CTD-less topoisomerase II of Saccharomyces cerevisiae (T2) was produced from pGAL1Top2(1196)-HMK-His (27) in the protease-deficient yeast strain BCY123-Δtop1. This strain was constructed by disrupting the TOP1 gene in BCY123, as previously described (28). T2 was purified following the procedures previously described for the full-length yeast topo II (4). T2 was stored at a concentration of 2 mg/ml at −80°C, and working stocks at 100 ng/ml were kept at −20°C in 50 mM Tris-HCI (pH 8), 1 mM ethylenediaminetetraacetic acid (EDTA), 500 mM KCI, 7 mM 2-mercaptoethanol, 100 µg/ml bovine serum albumin (BSA) and 50% (v/v) glycerol. The T2 derivative, in which the C-gate can be reversibly locked by a pair of engineered disulfide bonds, was obtained by mutating two amino residues, N1043C and K1127C, as previously described (6). This enzyme was produced and kept under the same conditions as T2, but omitting sulfhydryl reagents in all buffers.

DNA relaxation and analysis of Lk distributions

DNA plasmids (0.2 pmol) were incubated with T1(catalytic excess) or T2 (at the specified molar ratio) in a 50-μL volume of 50 mM Tris–HCl (pH 8), 1 mM EDTA, 150 mM KCl, 8 mM MgCl₂, 7 mM 2-mercaptoethanol and 100 µg/ml BSA. T2 reactions were initiated by the addition of ATP (1 mM) when indicated. Temperature and incubation times are specified in each experiment. Reactions were stopped with the addition of 20 mM EDTA, 0.5% (w/v) sodium dodecyl sulphate (SDS) and 100 μg/ml proteinase K, and incubated for 15 min at 50°C. Reaction samples were loaded onto 0.8% (w/v) agarose gels. DNA electrophoresis was carried out at 1.6 V/cm for 18 h in TBE buffer (50 mM Tris-borate, 1 mM EDTA) containing 0.2 μg/ml chloroquine. In these conditions, the distributions of Lk topoisomers of relaxed DNA circles adopt positive writhe and migrate faster than nicked circles. Gels were stained with ethidium bromide, destained in water and photographed over an ultraviolet light source with a Kodak GL1500 camera. Plots of Lk distributions and quantification of Lk topoisomers were done using Kodak Molecular Imaging Software v4.5 and Image 1.34 s. The topoisomer variance of Lk distributions <ΔLk²> was calculated as Σ[pi(ΔLki)²]/Σpi, where pi is the amount of each topoisomer i in the distribution and ΔLki is the linking number for topoisomer i relative to that of a reference topoisomer near the center of the distribution.

T-segment capture in single Lk topoisomers

Individual Lk topoisomers of pBR322 (4.3 kb) were purified from unstained agarose gel slices. Approximately 50 fmol of DNA topoisomer and 25 fmol of T2 were mixed at 25°C in a 25 -μL volume containing 50 mM Tris–HCl (pH 8), 1 mM EDTA, 150 mM KCl, 8 mM MgCl₂, 7 mM 2-mercaptoethanol and 100 mg/ml BSA. AMPPNP was added to 2 mM to close the N-gate and form high salt-resistant T2/DNA complexes (3). After 5 min of incubation, 1 volume of 2 M NaCl was added, and the mixture was passed through a GF/C (Whatman) fiberglass filter as described in (29). Free DNA molecules were recovered from the filtrate, and T2-bound DNA circles were eluted from the filter with 1% SDS. Both fractions were analyzed by electrophoresis (2 V/cm for 14 h) in 1% agarose in TBE buffer (50 mM Tris-borate, 1 mM EDTA) containing 0.2 μg/ml chloroquine. DNA populations were quantified by phosphor-imaging analysis of the gel-blot probed with ³²P-labeled DNA obtained by random priming.

T-segment backtracking in single Lk topoisomers

Approximately 50 fmol of gel-purified Lk_i topoisomer and 25 fmol of the T2 derivative, in which the C-gate was locked by a pair of disulfide bonds, were mixed at 15°C in a 40 -μL volume of 50 mM Tris–HCl (pH 8), 1 mM EDTA, 25 mM KCl, 8 mM MgCl₂ and 100 mg/ml BSA. The mixture was supplemented either with ATP (1 mM) or AMPPNP (2 mM) and incubated for 5 min. Half of the mixture (20 µL) was then shifted to 40°C. After 5 min of incubation, both reactions were quenched with 1 volume of 50 mM EDTA, 1% (w/v) SDS. DNA products were analyzed by electrophoresis in 1% agarose gel in TBE buffer (50 mM Tris-borate, 1 mM EDTA) containing 0.2 μg/ml chloroquine. DNA populations were quantified by phosphor-imaging analysis of the gel-blot probed with ³²P-labeled DNA obtained by random priming.

Construction of T2Δ83

Plasmid pGAL1Top2(1196)-HMK-His was used as polymerase chain reaction template to generate an 83-amino acid deletion between Leu1039 and Trp1122 of the TOP2 gene. Primer Δ83-Fwd, 5′ GCGGGTTGGTCATTGACCAAGGAAAG 3′, was complement to the 3367–3386 TOP2 gene fragment and had a 5′-six nt tail (italicized) coding for Ala-Gly. Primer Δ83-Rev, 5′ GGCCGCTAACTCCTTTTCAATAATCA 3′, was reverse complement to the 3098–3117 TOP2 gene fragment and included a 5′-six nt tail (italicized) coding for Ala-Ala. Both primers were extended in a thermal cycler by Pfu DNA polymerase. The reaction products were digested with DpnI endonuclease to degrade the initial template, and the amplified DNA was transformed into E. coli DH5α electrocompetent cells. Transformants were screened for those containing the religated DNA plasmid that substituted the 83 amino acids by the spacer sequence Ala-Ala-Ala-Gly, which gave rise to unique NotI and SacII restriction sites. The modification was confirmed by DNA sequencing. The new plasmid, pGALT2Δ83HMK-His, was introduced in the BCY123-Δtop1 yeast strain to overexpress and purify T2Δ83, following the procedure described in (4).

Simplified distributions of DNA supercoils produced by topoisomerase II

Figure 1B compares the distributions of DNA linking number topoisomers (Lk) obtained after incubating a supercoiled DNA plasmid with topoisomerase I of vaccinia virus (T1) and topoisomerase II of S. cerevisiae (T2). As expected, T2 generated an Lk distribution, the variance <ΔLk²> _T2 of which was smaller than that of the thermal equilibrium Lk distribution <ΔLk²>_eq produced by T1 in the same reaction conditions. The parameter R_Lk, defined as <ΔLk²>_eq/<ΔLk²> _T2, was ∼1.6. Because the center of the non-equilibrium Lk distribution generated by T2 (Lk^S) did not always coincide with the equilibrium center (Lk⁰) produced by T1, Lk^S–Lk⁰ was defined as ΔLk^S. This simplification activity of T2 is efficient and robust. With T2/DNA molar ratios of 1:1, a negatively supercoiled 7.9-kb plasmid was relaxed and its thermal Lk distribution narrowed (R_Lk∼1.6) in ∼1 min (Supplementary Figure S1A). Similar R_Lk values were achieved in a broad range of salt concentrations, from 10 to 250 mM KCl (Supplementary Figure S1B), and reaction temperatures, from 10 to 45°C (Supplementary Figure S1C). However, the symmetry of the narrowing process (ΔLk^S) highly depends on the reaction temperature. At 25°C, ΔLk^S∼0; at higher temperature, ΔLk^S>0; and, at lower temperature, ΔLk^S<0. Thus, thermal changes do not deviate Lk^S as much as they deviate Lk⁰ (Supplementary Figure S1C).

Supercoil simplification is not determined by T-segment capture

Figure 2A shows the Lk distributions produced by T1 and T2 on a 4.3-kb plasmid at 25°C. Because type-IIA topoisomerases change Lk in steps of two, the Lk distribution generated by T2 is in fact composed of two independent Lk distributions, one of odd values and one of even values. Therefore, topoisomers Lk⁰ and Lk⁰⁻² have steady-state concentrations (C₀ and C_-2) related by the equation C₋₂/C₀ = k_{(0,− 2)}/k₍₋₂, ₀₎, where k_{(0, −2)} is the rate constant for conversion of Lk⁰ molecules into Lk⁰⁻², and k₍₋₂, ₀₎ is the reverse rate constant (23,30). As expected, T2 activity produced a C₋₂/C₀ ratio (0.17) much lower than that generated by T1 (0.35). To reduce C₋₂/C₀, T2 must decrease k_{(0, −2)}/k ₍₋₂, ₀₎. In a covalently closed DNA circle, any DNA transport event done by T2 results in a change in Lk. Therefore, rate constants k_{(0, −2)} and k₍₋₂, ₀₎ may relate directly to the corresponding probability (P) of capturing and passing a T-segment across the G-segment. It would then follow that C₋₂/C₀ = P_{(0, −2)}/P₍₋₂, ₀₎. Later, we present experimental evidence that disproves this equality.

Biochemical studies have shown that a T-segment cannot be accommodated between the closed N-gate and the DNA-gate of T2 (31). This restraint is consistent with the swapped configuration of the closed N-gate (32), which enforces unidirectional passage of the T-segment across the DNA-gate following the capture step. Consequently, P_{(0, −2)} and P₍₋₂, ₀₎ can be calculated by examining the fractions of Lk⁰ and Lk⁰⁻² bound to T2 that interconvert after the irreversible closure of the N-gate with the non-hydrolysable ATP analog AMPPNP (Figure 2B) (33). Thus, we purified the Lk⁰ and Lk⁰⁻² topoisomers and conducted these one-step reactions in the same conditions used to calculate C₀ and C₋₂. We found that the probability of capturing a T-segment to convert Lk⁰ into Lk⁰⁻² was 0.17, whereas the probability to convert Lk⁰⁻² into Lk⁰ was 0.50 (Figure 2C). These values predicted a P_{(0, −2)}/P₍₋₂, ₀₎ ratio of 0.34. This value was similar to the C₋₂/C₀ ratio at thermal equilibrium (0.35) and thus differed from the steady-state C₋₂/C₀ ratio generated by T2 (0.17). Therefore, the mechanism that narrows the equilibrium distributions of DNA supercoils does not rely on T-segment capture probability.

Passed T-segment can backtrack across the DNA-gate and N-gate

Once the captured T-segment has crossed the DNA-gate, it can be accommodated in the central cavity of the topoisomerase (6,31). To complete DNA transport, the passed T-segment has to be expelled by the C-gate. Otherwise, if the N-gate reopens or loosens its swapped configuration, the T-segment could still backtrack across the DNA-gate and produce no net DNA transport. This uncoupling between T-segment capture and transport has been observed in DNA gyrase when the supercoiling density of DNA reaches a threshold (10). Later, we present experimental evidence that such backtracking can also occur in T2.

Previous studies have shown that when the C-gate of T2 is locked by means of engineered disulfide bonds, each enzyme bound to supercoiled DNA can change Lk only by 2 U because any T-segment passed ends up entrapped inside the topoisomerase (6,31). In those experiments, DNA supercoiling energy favored unidirectional movement of the T-segment, and backtracking was not observed. Here, we conducted a similar experiment but with relaxed DNA. To test backtracking, we purified a precise topoisomer (Lk_i) within the simplified Lk distribution produced by T2. Lk_i was chosen because Lk_i<Lk^S at 15°C and Lk_i>Lk^S at 40°C (Figure 3A). In this way, we could invert the preferential directionality of a T-segment across the DNA-gate by changing the reaction temperature from 15 to 40°C. Accordingly, we first incubated Lk_i with T2 (with the C-gate locked and in presence of ATP) at 15°C. As expected, a fraction of Lk_i was converted into Lk_i+2. Next, we raised the temperature to 40°C. As a result, the Lk_i+2 fraction nearly disappeared and a fraction of Lk_i−2 molecules developed (Figure 3B). The disappearance of the Lk_i+2 revealed the backtracking of T-segments entrapped at 15°C. Likewise, the appearance of Lk_i−2 indicated that such T-segments had escaped by the N-gate. Only by this way could new T-segments have been captured and passed at 40°C to produce the population of Lk_i−2. We corroborated that backtracking requires the opening of the N-gate by doing an analogous experiment, in which we added AMPPNP instead of ATP. In this case, Lk_i were also converted into Lk_i+2 at 15°C. However, because AMPPNP did not allow the N-gate to reopen, no more Lk changes occurred when the temperature was raised to 40°C (Figure 3C).

Simplified Lk distributions widen when T-segment backtracking is precluded

The above results indicated that backtracking of passed T-segments is possible when DNA topology is near equilibrium. Accordingly, we envisaged that T2 narrows equilibrium Lk distributions because passed T-segments driving Lk away from equilibrium are more prone to backtrack than those driving Lk toward it (Figure 4A). If this hypothesis is correct, interfering with the reopening of the N-gate while T2 is narrowing an Lk distribution, it should broaden the Lk distribution because none of the T-segments being passed at that time would be able to backtrack (Figure 4B). Thus, we relaxed a supercoiled plasmid with T2 in the presence of ATP. Once the reaction had reached the steady state, we blocked the reopening of the N-gate by adding an excess of AMPPNP over the initial ATP concentration. As seen in Figure 4C, the simplified Lk distribution generated by T2 readily increased its variance on the addition of AMPPNP. This broadening cannot be attributed to contaminating topo I because T2 was purified from Δtop1 cells, and no trace of DNA relaxation activity was observed in the absence of ATP. Likewise, this broadening was unlikely to be produced by the structure of T2/AMPPNP complexes, as previous studies indicated that they do not significantly alter the topology of the interacting DNA (19). Yet, because each T2/AMPPNP complex precluded at most one backtracking event, this effect had to be stoichiometric and, effectively, the widening increased with the molar ratio of T2 to DNA. Note also that the widening was not symmetric. This shift occurred because Lk^S>Lk⁰ at 30°C (Supplementary Figure S1C). Accordingly, most DNA passage events displaced the non-equilibrium distribution (centered in Lk^S) toward the equilibrium distribution (centered in Lk⁰). Remarkably, an identical result was obtained by blocking the reopening of the N-gate in a different way. Instead of adding AMPPNP to compete with ATP, we added the N-gate inhibitor ICRF193 (34,35) (Supplementary Figure S2).

To further verify that supercoil simplification depends on the backtracking of passed T-segments that drive Lk away from equilibrium, we conducted a similar experiment but using as initial DNA substrate a purified Lk distribution previously narrowed by T2. As seen in Figure 4D, the simplified Lk distribution was not altered after T2 incubation, either in the absence or presence of ATP. However, it clearly broadened when incubation with T2 was followed by the addition of AMPPNP. As expected, without possible backtracking of passed T-segments, most DNA passage events tended to convert the non-equilibrium Lk distribution into the thermal equilibrium distribution produced by T1.

C-gate integrity is required to simplify equilibrium Lk distributions

The mechanism for topology simplification inferred from the above results predicted another experimental outcome: if the C-gate were deleted to leave the central chamber of T2 open, all passed T-segments would readily exit the enzyme and produce net transport. Consequently, topology simplification that relies on DNA backtracking would not occur. To test this hypothesis, we engineered a T2 polypeptide chain (T2Δ83), in which 83 amino residues of the C-gate of T2 (36), between L1039 and W1122, were substituted by a short residue linker (AAAG) (Figure 5A). T2Δ83 was produced in the yeast strain BCY123-Δtop1 and purified to test its activity (Supplementary Figure S3). Filter-binding assays (29) revealed that, although T2Δ83 binds DNA, it does not form high salt-stable complexes with circular DNA following AMPPNP addition (Supplementary Figure S4). This observation corroborated that the disruption of the C-gate lets the central chamber of the enzyme permanently open and, hence, it cannot produce a toroid around DNA on closure of the N-gate.

T2Δ83 relaxed supercoiled DNA in an ATP-dependent manner (Figure 5B). However, the specific activity of T2Δ83 was near two orders of magnitude below that of T2 because it required a 2-h incubation at an enzyme/DNA molar ratio of 1:1 to produce steady-state Lk distributions (Figure 5B). This reduced activity was expected, as the global stability of the enzyme could be altered and its interdomain couplings could be less efficient in the absence of the C-gate interface. When we compared the steady-state Lk distributions produced by T2Δ83, T2 and T1 in the same reaction conditions and longer incubation times (6 h), we found that T2Δ83 was not able to simplify DNA topology to below equilibrium (Figure 5C). This outcome could not be attributed to contaminating topo I because T2Δ83 was purified from Δtop1 cells. To further corroborate that simplified Lk distributions were not the final product of T2Δ83 activity, we use as initial DNA substrate of the relaxation reaction an Lk distribution previously narrowed by T2. As shown in Figure 5D, incubation of the simplified Lk distribution with T2Δ83 in the absence of ATP produced no changes. However, in the presence of ATP, T2Δ83 broadened and shifted the Lk distribution into a shape similar to that produced by T1. Therefore, the C-gate integrity was not essential for relaxing DNA supercoils but it was required for narrowing Lk distributions to below the equilibrium values.

Given that T2Δ83 has the C-gate permanently open, it is conceivable that this enzyme may be able to conduct DNA transport in reverse. However, when a simplified Lk distribution was incubated with T2Δ83 and AMPPNP was added (instead of ATP), a broadening effect was also observed (Figure 5D, right). Because a T-segment cannot be held between the DNA-gate and the closed N-gate, this observation argued against DNA passage in reverse. Yet, it cannot be fully discredited that a T-segment enters by the open C-gate, crosses the DNA-gate and then exits by the N-gate before it closes on nucleotide binding.