Transforming Growth Factor-β3 (TGF-β3) Knock-in Ameliorates Inflammation Due to TGF-β1 Deficiency While Promoting Glucose Tolerance^*

Generation of Chimeric TGF-β1/3 Expression Vector and Targeting Construct

Chimeric TGF-β cDNAs were generated by ligating PCR products of the TGF-β1 LAP with sequence for the mature HA-tagged ligands of murine TGF-β3, murine TGF-β2, and porcine TGF-β1 (21). The resulting chimeric TGF-β cDNAs were subcloned into the pSG5 (Agilent Technologies, Santa Clara, CA) vector to study proper expression and secretion. The chimeric TGF-β1/3 cDNA was selected for further study to test latency and activation. After confirming proper folding latency and activation, TGF-β1 promoter-driven expression vectors were constructed using a clone of the TGF-β1 gene derived from a BALB/c liver genomic library (22). In the E2β1/3 expression vector, the chimeric TGF-β1/3 cDNA was subcloned into a BsaBI site located within exon 2 of the TGF-β1 gene, where placement of the chimeric cDNA would minimize any potential perturbations to the TGF-β1 promoter. The E2β1/3 vector contains about 10.5 kb of the TGF-β1 gene, including both TGF-β1 transcriptional start sites as well as the first exon and intron. For stable transfections, the E2β1/3 expression vector also included a floxed neomycin resistance (Neo^r) gene downstream of the chimeric cDNA that is driven by the thymidine kinase promoter (gift from H. Gu). The E2β1/3 expression vector was transfected into NIH-3T3 cells that contain active Ras, to induce expression via the TGF-β1 promoter. Stable cell lines were established, and the secreted HA epitope-tagged TGF-β1/3 protein was detected in the supernatants. After confirmation that the chimeric protein could be expressed with the TGF-β1 promoter, a targeting construct was generated wherein the E2β1/3 vector was combined with a 1.8-kb 3′ homology arm from the TGF-β1 genomic clone, as well as the HSV-thymidine kinase gene from pPNT (23), for negative selection.

Cell Culture

COS7 cells were transfected with the pSG5-TGF-β1/3 expression vector to study secretion, latency, and activation of the chimeric protein. COS7 cells were transfected with Lipofectamine LTX (Invitrogen), and after overnight incubation, the medium was replaced with serum-free Opti-MEM supplemented with MITO plus (BD Biosciences). Supernatants were then collected after 48 h and tested with Western blot using both reducing and nonreducing conditions to examine the expression and latency of the chimeric TGF-β1/3 (see below for Western blots). To study the signaling capability of the epitope-tagged TGF-β3 ligand, cell-free supernatants from the transfected COS7 cells were diluted 1:3 with fresh serum-free medium and added onto 5 × 10⁵ HepG2 cells in a 6-cm culture dish. HepG2 cells were tested with either unaltered supernatant or with medium from the transfected cells that had been heated at 80 °C for 5 min, which releases the TGF-β3 ligand from the LAP without denaturing/inactivating the receptor-binding mature domain. The cells were lysed after 30 min, and the lysates were run on a Western blot to determine the level of Smad2 phosphorylation. Before proceeding with a targeting vector, TGF-β1 promoter-driven expression vectors were transfected into NIH-3T3 cells using Lipofectamine. These NIH-3T3 cells were previously infected with Harvey Sarcoma virus and expressed Ha-Ras, an oncogene that would stimulate the TGF-β1 promoter (22). Cells were treated with G418 to derive stable cell lines, and serum-free supernatants were collected within 48 h after plating. With confirmation that the TGF-β1 promoter could drive expression of the chimeric TGF-β1/3, a targeting vector was constructed and electroporated into R1 embryonic stem cells, a cell line derived from a 129/Sv mouse strain. Twenty four hours after electroporation, the cells were treated with G418 and gancyclovir. Individual clones were selected after 10 days of drug treatment. Some stem cells used to generate knock-in mice were allowed to differentiate in culture, and supernatants were collected to test for secretion of the tagged chimeric TGF-β1/3 protein.

Derivation and Genotyping of the TGF-β1^Lβ3/Lβ3 Mice

Southern blot analysis and PCR were performed to identify which clones had undergone proper homologous recombination in the R1 cells. The DNA from drug-resistant stem cell clones was purified through phenol and chloroform extraction and digested with BamHI. A 0.5-kb TGF-β1 PCR fragment derived from ES cell genomic DNA was used as a flanking probe for the Southern analysis. An 8-kb band was detected for the wild type allele, whereas a 6-kb band appeared if proper homologous recombination occurred. PCR for homologous recombination was performed using a primer located in the Neo^r marker (GTTCGAGGCCACACGCGTCA) and a primer downstream of any TGF-β1 genetic sequence used in the 3′ homology arm of the targeting construct (GCCTCTGCCTCACAAGCGCA). Two positive clones were injected into C57Bl/6 mouse blastocysts that underwent germ line transmission. The male chimeras were then crossed with C57Bl/6 females to generate F1 offspring. The offspring were bred to homozygosity and were genotyped by PCR using the following primers: In-B3For (GTTTGGTTTTGTTTGAGGCGTG), In-B3Rev (ACACAGCAGTTCTCCTCCAGGTTG), and Ex2 Rev (GGGCTGACCTGTGTGCCACC). The PCR was run for 40 cycles at an annealing temperature of 60 °C. A 1-kb PCR product was generated in this reaction for the knock-in allele, whereas only a 0.6-kb band was produced if the wild type TGF-β1 allele was present. All care to the mice was given in compliance with the National Institutes of Health guidelines on the use of laboratory and experimental animals, and the studies were approved by the NIDCR Animal Care and Use Committee. Food and water were provided ad libitum. Because of defects noticed in the teeth of the mice, animals were supplemented with a transgenic dough diet (Bio Serv, Frenchtown, NJ).

Histology and Immunohistochemistry

Tissues were carefully dissected from the mice and fixed overnight in 10% buffered formalin. The tissues were primarily embedded in paraffin, and 5-μm sections were used for histopathological analysis. Pathology was examined using slides stained with hematoxylin and eosin (H&E); mast cells were detected using toluidine blue staining, and fat accumulation was examined using Oil Red O staining from frozen sections of the liver. For immunohistochemistry, sections were deparaffinized in xylene, rehydrated with descending grades of ethanol, blocked for 30 min, and incubated with primary antibody (see below) prepared in background-reducing antibody diluent (Dako, Carpenteria, CA). Next, the sections were treated with either rabbit on rodent HRP-polymer (Biocare, Concord, CA) or with a biotinylated secondary antibody (Vector Laboratories, Burlingame, CA), followed by treatment with the Vectastain ABC reagent (Vector Laboratories). Antibody complexes were detected using liquid 3,3′-diaminobenzidine (Biogenex, Fremont, CA). For immunohistochemistry of the bone, femurs and tibias of the mice were decalcified using 0.1 m EDTA for 2 weeks. For antigen retrieval, slides were heated overnight at 60 °C in target retrieval solution (Dako). Primary antibody dilutions are as follows: a 1:50 dilution for F4/80 (Invitrogen); 1:150 anti-Smad2, phospho-specific (Ser-465/467) (AB3849 Millipore, Billerica, MA); 1:200 TGF-β3 (24), anti-Smad3, phospho-specific (Ser-423/425) (9520 Cell Signaling, Danvers, MA); 1:1000 phospho-TAK1 (Thr-187) (ab79583 Abcam Cambridge, MA) and 1:2000 Osteocalcin (Takara Otsu, Shiga, Japan).

Western Blot Analysis

Protein lysates were generated from cultured cells and mouse tissues using T-PER (Thermo Scientific Pierce) with a complete mini protease inhibitor mixture (Roche Applied Science). To study secretion of the TGF-β proteins, serum-free medium from the cultured cell lines was collected, treated with 200 mm PMSF (Sigma), and concentrated using an Amicon ultracentrifugal filter device (Millipore). Activation of the chimeric TGF-β1/3 protein was achieved by heating supernatants at 80 °C for 5 min or through incubation with two known TGF-β activators, either plasmin (0.001 unit/ml, Sigma) or thrombospondin (0.04 mg/ml, Sigma) at 37 °C for 2 h. For Western blot, about 50 μg of protein were denatured and separated with electrophoresis on NuPAGE 4–12% BisTris precast gels using XCell SureLock Mini-Cell (Invitrogen). Nonreducing Western blot was performed using conditions specified for the NativePAGE Novex BisTris gel system (Invitrogen). Proteins were then transferred onto a nitrocellulose membrane, blocked for 1 h, and incubated with primary antibodies overnight. The bound primary antibodies were then visualized using a horseradish peroxidase-conjugated secondary antibody (Santa Cruz Biotechnology, Santa Cruz, CA) followed by chemiluminescence detection (Pierce). The following primary antibody dilutions were used: 1:1000 anti-actin (Millipore MAB1501); 1:100 anti-glyceraldehyde-3-phosphate dehydrogenase (Abcam ab9485); 1:500 TGF-β1 (Promega G1221); 1:500 TGF-β2 (Santa Cruz Biotechnology); 1:500 TGF-β3 (Santa Cruz Biotechnology); 1:1000 anti-HA (Cell Signaling); 1:200 TGF-β1 LAP (R&D Systems); 1:500 anti-Smad2 (Invitrogen 51-1300); and 1:500 anti-Smad2, phospho-specific (Ser-465/467) (Millipore AB3849).

Preparation of RNA and RT-PCR

RNA was extracted from tissues of the mice using miRNeasy (Qiagen) according to the manufacturer's protocol. Using random primers (Invitrogen), about 500 ng of RNA were reverse-transcribed into cDNA through Super Script III reverse transcriptase (Invitrogen). To examine for any TGF-β1 expression, 40 cycles of RT-PCR were performed using TGF-β1 primers from exon 2 to 7 (25). RT-PCR for GAPDH (TGCACCACCAACTGCTTAG and GATGCAGGGATGATGTTC) was used as a control. For gene expression analysis of white adipose tissue, total RNA was isolated from epididymal WAT by using the RNeasy kit, and cDNA was transcribed using high capacity cDNA reverse transcription kit (Invitrogen catalog no. 4368814) according to the manufacturer's protocol. Quantitative gene expression was measured by real time PCR in Applied Biosystems 7500 Fast Real Time PCR System using Fast SYBR® Green Master Mix (catalog no. 4385612). The expression of several adipose tissue- and lipid-related gene markers were determined by performing 40 cycles as follows: Cidea, AGCTCGCCCTTTTCGAGTTTC and GGCCAGTTGTGATGACTAAGAC; PRDM16, TGCTGACGGATACAGAGGTGT and CCACGCAGAACTTCTCGCTAC; Cox8b, TGTGGGGATCTCAGCCATAGT and AGTGGGCTAAGACCCATCCTG; DiO2, ACACTGGAATTGGGAGCATC and ATGCTGACCTCAGAAGGGCT; UCP-1, AGGCTTCCAGTACCATTAGGT and CTGAGTGAGGCAAAGCTGATTT; PGC1a, TATGGAGTGACATAGAGTGTGCT and CCACTTCAATCCACCCAGAAAG; ELOVL3, CCGCGTTCTCATGTAGGTCT and CTTAAGGCCCTTTTTGGAGG; Tgfbr1, CAACCCAGGTCCTTCCTAAA and GGAGAGCCCTGGATACCAAC; Tgfbr2, CCGCTGCATATCGTCCTGTG and AGTGGATGGATGGTCCTATTACA; ID1, GGTGAACGTCCTGCTCTACGA and AGACTCCGAGTTCAGCTCCAG; Jun-B, TGCGGACGGTTTTGTCAA and GCGTCACGTGGTTCATCTTG; Serpine1, CAGAGCAACAAGTTCAACTACACTGA and CAGCGATGAACATGCTGAGG; Smad7, GGCCGGATCTCAGGCATTC and TTGGGTATCTGGAGTAAGGAGG.

Gene expression was analyzed by adopting the standard ΔΔC_T method of real time PCR, and results were expressed as a relative fold change in gene expression compared with wild type/control.

Analysis of TGF-β1 Levels in Serum by ELISA

Mice were euthanized with CO₂, and blood samples were collected by intracardiac puncture into microtainer tubes. Blood samples were left on ice for 15 min and spun at 3500 × g for 25 min in an Eppendorf centrifuge at room temperature. Serum was collected, aliquoted, and stored at −70 °C. The level of TGF-β1 in the serum was determined by ELISA using the mouse/rat/porcine TGF-β1 immunoassay kit (R&D Systems). Serum was diluted 60-fold after acid activation, and total TGF-β1 was determined according to the manufacturer's instructions.

Metabolic Studies of the TGF-β1^Lβ3/Lβ3 Mice

For the glucose tolerance test (26), mice underwent a 12-h fast, and the next morning they were injected with intraperitoneal glucose (2 mg/kg body weight). Tail blood was collected at given time intervals for automated glucose measurement using Alphatrak glucometer and glucose strips (catalog no. 32006-06). For adipokine measurement, mice were fasted for 12 h; a tail bleed was performed, and serum was analyzed using the Mouse Adipokine Panel- 7 Plex (Millipore MADPK-71K-07) according to the manufacturer's instructions. For food intake, 10–4-week-old female TGF-β1^Lβ3/Lβ3 and TGF-β1^Lβ3/+ mice were housed separately and supplied standard pellet food and water. The amount of food consumed along with the weight of the mice was measured three times a week for month.

Microradiography and Microcomputed Tomography Analysis

Skulls from the mice were radiographed using a Faxitron MX20 Specimen Radiography System (Faxitron X-Ray Corp., Wheeling, IL) for 20 s at 20 kV. The images were captured on Kodak MIN-R film. Using ImageJ software (National Institutes of Health), the mean gray values were measured to calculate the difference in opacities of the molars/incisors for both the wild type and the knock-in mice. To examine kyphosis, mice were radiographed for 40 s at 30 kV, and images were captured using Kodak PPL X-Ray film. With microcomputed tomography, femurs were dissected from the TGF-β1^Lβ3/Lβ3 mice, fixed overnight in 10% buffered formalin, and changed to 70% ethanol. Femurs were analyzed using the SkyScan 1172 (Bruker microCT Kontich, Belgium) at 40 kV.

Flow Cytometry Analysis

Cells from spleen, mesenteric lymph nodes, and peripheral lymph node organs were removed and prepared as described previously (27). Briefly, cells were stained with the indicated fluorochrome-conjugated antibodies against surface markers. For Foxp3 staining, cells were subsequently stained using the Foxp3 staining set (eBioscience, San Diego) according to the manufacturer's instructions. To detect cytokine production ex vivo, cell suspensions were stimulated with 25 ng/ml phorbol 12-myristate 13-acetate (Sigma) and 2.5 μg/ml ionomycin (Sigma) in the presence of Golgi stop (BD Biosciences) for 4 h. After stimulation, cell surface markers were stained before cells were fixed in Cytofix/Cytoperm (BD Biosciences). Cells were stained with fluorochrome-conjugated antibodies against cytokines for 40 min in Permeabilization Buffer (BD Biosciences). Cell acquisition was performed on an LSRII or Calibur (both BD Biosciences), and data were analyzed using FlowJo software (Tree Star, Ashland, OR). Mice used for FACS analysis were aged between 18 and 28 weeks, and data were pooled from four female TGF-β1^Lβ3/Lβ3 mice along with the corresponding littermate controls. Two male mice aged 29–33 weeks were also analyzed.

Statistical Analysis

The data were analyzed for statistical significance using GraphPad Prism version 5.00 for Windows (Graph-Pad Software Inc., La Jolla, CA). Survival curves were generated using the Kaplan-Meier method and evaluated using the log-rank (Mantel-Cox) test. A two-tailed Student's unpaired t test was used to determine statistical significance for all other comparisons. Values of p ≤ 0.05 were considered statistically significant.

Development and Testing of the Chimeric TGF-β1/3 Protein

Chimeric TGF-β constructs were generated where the sequence from the TGF-β1 LAP was fused with HA-tagged versions of the TGF-β ligands, including murine TGF-β3, murine TGF-β2, and the porcine TGF-β1 as a control (21). The strategy behind making the chimeric constructs is demonstrated in Fig. 1A with the chimeric TGF-β1/3 protein as an example. In this case, cell signaling occurs via the TGF-β3 ligand, but the TGF-β1 LAP determines localization, bioavailability, and activation of the protein. Expression vectors for each chimeric TGF-β construct were transfected into COS7 cells, and the supernatants were collected and concentrated. Fig. 1B shows the efficient expression of each chimeric TGF-β protein. Because both TGF-β1 and TGF-β3 share similar binding affinities to the TGF-β receptor TβR-II (28), the chimeric TGF-β1/3 protein was chosen for further analysis. Although TGF-β1 LAP has previously been shown to bind to recombinant TGF-β3 ligand, rendering it inactive (29), Western blot using nonreducing conditions was nevertheless performed to show the formation of both a small and large latent complex (Fig. 1C). With high heat, these complexes could also be dissociated to cause release of the active TGF-β3 ligand. Dissociation of the TGF-β1/3 latent complexes could also occur via the known TGF-β activation mechanisms of plasmin-mediated proteolysis and thrombospondin-induced conformational change (Fig. 1D) (30, 31). Formation of a latent complex was further confirmed via immunoprecipitation, wherein the HA-tagged TGF-β3 ligand was pulled down using a TGF-β1 LAP antibody (Fig. 1E). Untagged full-length human TGF-β3 was used as a control. Finally, increased TGF-β associated phosphorylation of Smad2 occurred primarily upon heat activation of the chimeric TGF-β1/3, further confirming the formation of a latent complex (Fig. 1F). Although these TGF-β isoforms share a high degree of homology, the proper folding and binding of these two protein domains into a latent yet activatable chimeric complex needed to be ensured, because uncontrolled TGF-β signaling would be deleterious.

Generation of a TGF-β1/3 Targeting Vector

Before generating a targeting construct, expression of the chimeric TGF-β1/3 protein by the TGF-β1 promoter was tested. For this purpose, TGF-β1 promoter-driven expression vectors were transfected into NIH-3T3 cells expressing Ha-ras to activate TGF-β production (Fig. 1G). Fusing the chimeric TGF-β1/3 construct into exon 2 of a TGF-β1 genomic clone not only seemed to show the best results for driving expression by the TGF-β1 promoter but also minimized any perturbation to the transcriptional and translational elements in the promoter. This strategy was used to develop the targeting construct (Fig. 2A). The 3′ homology arm of the targeting vector consisted of a sequence downstream of exon 2 that included all of exon 3. A floxed Neo^r was cloned after the chimeric TGF-β1/3 cDNA for positive selection of integrated constructs, whereas the thymidine kinase gene was added downstream of the 3′ homology arm to select against random integrants. The chimeric TGF-β1/3 targeting vector was electroporated into R1 cells, an embryonic stem cell line derived from a 129/Sv mouse strain. Of the clones collected after drug selection, about 1 in 20 showed proper homologous recombination as determined by both Southern blot (Fig. 2B) and PCR analyses (Fig. 2, C and D). Targeted clones were injected into C57Bl/6 blastocysts for derivation of the knock-in mice. Following injection, some of the targeted stem cell clones, along with the parent R1 cells, were then allowed to differentiate in culture, and supernatants were collected. As seen in Fig. 3A, the parent R1 cells actively secrete TGF-β1, although its expression is diminished in the recombined clone that has one targeted knock-in allele. The TGF-β1 promoter in the recombined allele, however, was able to drive expression of the HA-tagged TGF-β3 ligand that is absent in the unaltered parent R1 cells.

Replacement of TGF-β1 Ligand with TGF-β3 in a Genetically Engineered Mouse

Germ line transmission was achieved with two targeted stem cell clones and mice were bred to homozygosity. The resulting TGF-β1^Lβ3/Lβ3 mice had no measurable TGF-β1 present in the serum, as measured through ELISA (Fig. 3B). Additionally, RT-PCR with primers from exon 2 to 7 was unable to detect any TGF-β1 mRNA transcript in tissues from the TGF-β1^Lβ3/Lβ3 mice (Fig. 3C). An HA-tagged TGF-β3 protein, however, was detected by Western blot in tissues from the TGF-β1^Lβ3/Lβ3 mice such as the spleen and lung (Fig. 3D). Finally, strong TGF-β3 staining was seen in the TGF-β1^Lβ3/Lβ3 tissues as compared with either the wild type controls or the TGF-β1^−/− mice (Fig. 3E). The stronger TGF-β3 staining seen in the TGF-β1^Lβ3/Lβ3 mice versus the TGF-β1^−/− mice suggests that the TGF-β3 detected is expressed by the knock-in allele and is probably not due to compensatory TGF-β3 expression resulting from a lack of TGF-β1. In addition, no changes in TGF-β2 staining were apparent between the TGF-β1^Lβ3/Lβ3 mice and either the TGF-β^+/+ or the TGF-β1^−/− mice (Fig. 4A). The genetically engineered targeted recombination in the TGF-β1^Lβ3/Lβ3 mice therefore appears to have caused disruption of the TGF-β1 gene while allowing for generation of the chimeric TGF-β1/3 protein by the TGF-β1 promoter. Smad-dependent and -independent signaling also seems to be unchanged overall between the TGF-β1^Lβ3/Lβ3 and the wild type mice in tissues such as the lung and kidneys (Fig. 4, B–D).

Breeding heterozygous mice to generate the TGF-β1^Lβ3/Lβ3 mice resulted in the pups being born close to the expected genotypic ratio (30% TGF-β1^Lβ3/Lβ3, 50% TGF-β1^Lβ3/+, and 20% TGF-β1^+/+; n = 141 mice). This finding differs from the TGF-β1^−/− mouse, wherein over half of the pups in a genetically mixed background die in utero because of vasculogenesis defects (11). With no signs of embryonic lethality, the knock-in of TGF-β3 appears able to compensate for the lack of TGF-β1 in terms of early developmental vasculogenesis. The TGF-β1^Lβ3/Lβ3 embryos, however, are not completely devoid of any TGF-β1 during development because TGF-β1 can cross the placenta from the TGF-β1^Lβ3/+ mothers (32). The TGF-β1^Lβ3/Lβ3 female mice appear so far to be infertile, so a complete lack of developmental TGF-β1 could not be tested in this animal model.

Survival and Weight Gain in the TGF-β1^Lβ3/Lβ3 Mice

The TGF-β1^Lβ3/Lβ3 mice are born developmentally normal and show no signs of any congenital defects. The life span of the TGF-β1^Lβ3/Lβ3 mice, however, was shortened to a median of 30 weeks of age as compared with the controls (Fig. 5A). A shorter life span shows that all the defects associated with targeted disruption of TGF-β1 could not be completely rescued by knock-in of TGF-β3 and that these two TGF-β isoforms are not totally interchangeable. Although the life spans of the TGF-β1^Lβ3/Lβ3 mice are reduced, their survival is still dramatically longer when compared with the TGF-β1^−/− mice that only live at most to 3–4 weeks of age and generally die from multifocal inflammation. A longer life span seems to suggest that the knock-in of the TGF-β3 may have prevented some of the severe autoimmunity typical to TGF-β1 deficiency. Overall, the TGF-β1^Lβ3/Lβ3 mice are smaller in stature than their control littermates. The TGF-β1^Lβ3/Lβ3 mice keep pace developmentally with the littermate controls until about 7–8 weeks of age when the weight of the TGF-β1^Lβ3/Lβ3 mice generally plateaus (Fig. 5B). These size differences became more noticeable as the TGF-β1^Lβ3/Lβ3 animals age (Fig. 5C).

TGF-β3 Does Not Fully Compensate for the Lack of TGF-β1 in Dental Homeostasis

Kyphosis was commonly seen in most older TGF-β1^Lβ3/Lβ3 mice (Fig. 5D), and tooth defects were observed in the TGF-β1^Lβ3/Lβ3 mice, with the incisors appearing aberrantly white, undermineralized, and chipped (Fig. 5E). A few mice (3 out of 34) displayed severe malocclusions of the teeth, whereas none of the controls had such dental defects. Because of these tooth defects, mice were supplemented with a high fat dough diet. The size and weight of the TGF-β1^Lβ3/Lβ3 mice, however, remained unchanged even with the addition of the dough diet, suggesting that the tooth defects were not responsible for the differences in weight and did not hinder normal food consumption. Microradiography was nevertheless performed using the skulls of the mice, and the images confirmed that the teeth of the TGF-β1^Lβ3/Lβ3 were undermineralized. The lower incisors specifically displayed a significant reduction in relative mineral opacity as compared with the controls (Fig. 5F). The molars of the TGF-β1^Lβ3/Lβ3 mice also displayed signs of attrition, particularly wearing of the molar cuspids. In all the TGF-β1^Lβ3/Lβ3 mice examined, the upper and lower incisors were offset and striking onto one another rather than self-sharpening like the wild type mice. The TGF-β1^Lβ3/Lβ3 mice additionally showed indications of atrophy in the ameloblasts, along with abnormal enamel. Dental attrition has been reported in TGF-β1^−/− mice, which suggests an isoform-specific role for TGF-β1 in tooth mineralization (33). The tooth defects seen in the TGF-β1^Lβ3/Lβ3 mice, although not as severe as in the TGF-β1^−/− mice, still share enough similarities to indicate that the knock-in of TGF-β3 may not be able to fully compensate for the lack of TGF-β1 in terms of dental homeostasis.

Isoform-specific Effects on Bone Formation in TGF-β1^Lβ3/Lβ3 Mice

The defects in tooth mineralization, along with the aberrantly small stature of some of the TGF-β1^Lβ3/Lβ3 mice, point to possible skeletal defects in these animals as well. Bones from the knock-in mice were therefore examined histologically. Defects in secondary ossification were present in the long bones of the older TGF-β1^Lβ3/Lβ3 mice (Fig. 6, A and B). Tang et al. (34) have reported that in TGF-β1^−/− Rag2^−/− mice the osteoblasts are absent on the trabecular bone, which matches with TGF-β1's critical role in guiding osteogenic bone mesenchymal stem cells (BMSCs) to the bone resorptive surfaces. In bone sections from the TGF-β1^Lβ3/Lβ3 mice, we also observed reduced numbers of osteoblasts on the trabecular bone by staining for the osteoblast marker osteocalcin (Fig. 6C). Tang et al. (34) showed that TGF-β3 seems to lack the same potent migratory effects on BMSCs as TGF-β1, where neutralization of TGF-β1 from bone resorption-conditioned medium stops BMSC migration, but inhibition of TGF-β3, in contrast, has no effect. The bone defects in the TGF-β1^Lβ3/Lβ3 mice may therefore reflect these migratory differences between the two TGF-β isoforms. Any bone defects in the mice, however, would probably not explain such differences in weight when compared with the controls.

Finally, TGF-β3 is commonly known to be involved in palate fusion (15–18). We therefore examined the palate of 1-day-old pups to determine whether doubling the alleles that express TGF-β3 would result in any palate defects. The palates from a TGF-β1^Lβ3/Lβ3 and a TGF-β1^+/+ mouse were essentially indistinguishable, so no defects in palate development arose with additional copies of TGF-β3 (Fig. 6D).

Knock-in of TGF-β3 Prevents Multifocal Inflammation Typical to TGF-β1 Deficiency

A characteristic of the TGF-β1^−/− mice is multifocal inflammation that results in a wasting syndrome (12, 13), and inhibition of the TGF-β signaling with a pan-specific antibody also leads to decreased food intake and weight loss through inflammation of the tongue and esophagus (35). To determine whether inflammation is responsible for decreased survival and reduced weight of the knock-in mice, we examined tissues from the TGF-β1^Lβ3/Lβ3 mice at a time point when the TGF-β1^−/− mice generally develop multifocal inflammation. Unlike the TGF-β1^−/− mice, the tissues from the TGF-β1^Lβ3/Lβ3 mice are indistinguishable from the TGF-β1^Lβ3/+ controls and show no major signs of infiltration and inflammation (Fig. 7A and Tables 1 and 2). No change in the number and localization of macrophages was seen in the TGF-β1^Lβ3/Lβ3 mice through F4/80 staining, whereas the numbers of mast cells detected in dermis of the skin were increased but not significantly (Fig. 7, B and C). Inflammation also did not appear to be a factor in the survival of the TGF-β1^Lβ3/Lβ3 mice, as tissues taken perimortem still lacked any signs of widespread autoimmunity. The TGF-β1^Lβ3/Lβ3 mice also showed a higher monocyte blood count compared with the controls (0.38 ± 0.15 TGF-β1^Lβ3/Lβ3 versus 0.14 ± 0.01 K/μl for TGF-β1^+/+ mice). Although high monocyte counts are often indicative of inflammation, the exact underlying cause for this increase is not known.

To further study the immunological effects of replacing TGF-β1 with TGF-β3, FACS analysis was performed to examine the immune profile of T cells in the TGF-β1^Lβ3/Lβ3 mice, as TGF-β1^−/− mice exhibit extreme lymphoproliferation and overactivation of T cells. Analysis of four female mice (aged 5–7 months) showed no significant difference in either the percent of T cell receptor β⁺ lymphocytes between TGF-β1^Lβ3/Lβ3 and TGF-β1^+/+ mice (Fig. 7D) or the numbers of activated CD44^hi and naive CD62L^hi T cells (data not shown). However, there was a slight alteration in the CD4⁺/CD8⁺ ratio of the TGF-β1^Lβ3/Lβ3 mice, but this was not as dramatic as that seen in the TGF-β1^−/− mice (Fig. 7E). Because TGF-β1 expression is known to regulate the development of Tregs (27), we examined the frequencies of Foxp3⁺ Tregs in lymphoid tissues. In the peripheral lymph nodes of the TGF-β1^Lβ3/Lβ3 mice, there was a significant increase in the percent of Foxp3⁺ regulatory T cells (Fig. 7F), but this increase was not see in any other location. Inflammatory cytokines, however, were also analyzed, and no difference could be detected in the production of IFN-γ, IL-17, IL-10, or IL-9 (Fig. 7G and data not shown). Overall, these findings hint at the possibility that TGF-β3 has immunoregulatory properties similar to TGF-β1, as there were no signs in TGF-β1^Lβ3/Lβ3 mice of the uncontrolled autoimmunity that is associated with TGF-β1^−/− mice. In addition, multifocal inflammation was not responsible for the reduced weight of these mice when compared with the controls.

Improved Glucose Homeostasis in TGF-β1^Lβ3/Lβ3 Mice

TGF-β signaling is known to play a key role in glucose homeostasis. We have previously reported that a loss of the TGF-β signal transducer Smad3 results in improved whole body glucose homeostasis via beneficial effects on pancreatic islet beta cells (36) and the WAT (26). Smad3^−/− WAT exhibits phenotypic and functional characteristics typically seen in brown adipose tissue. Moreover, Smad3^−/− mice are resistant to the obesogenic and diabetic effects of a high fat diet challenge. Finally, levels of TGF-β1 are elevated as a function of obesity, and a TGF-β-neutralization antibody (1D11) protects mice from obesity and diabetes.

We therefore evaluated the metabolic phenotype of TGF-β1^Lβ3/Lβ3 mice to determine whether it contributed to the reduced weight gain. As mentioned, the TGF-β1^Lβ3/Lβ3 mice were mainly fed a dough diet as a means of offsetting any weight loss that could be caused by tooth defects, but instead this diet only exaggerated the discrepancies in weight gain (Figs. 5B and 8A), as the male TGF-β1^Lβ3/Lβ3 mice differed from the controls by as much as 20 g. Both monitored groups ate about the same daily amount of food, eliminating the possibility that a difference in energy intake could explain the reduced body weight. However, when the weight of the mice was factored in, the food intake in the TGF-β1^Lβ3/Lβ3 mice was actually significantly higher than the controls (Fig. 8B). The TGF-β1^Lβ3/Lβ3 mice displayed reduced fat mass compared with that seen in control littermates, and fat accumulation in all the fat depots was significantly less in TGF-β1^Lβ3/Lβ3 mice, and the layer of fat between the muscle and the dermis was reduced (Fig. 8C). Furthermore, we observed reduced hepatic steatosis, a condition associated with fat accumulation in the liver (Fig. 8D). Adipocytes from the TGF-β1^Lβ3/Lβ3 mouse epididymal WAT appeared significantly smaller (Fig. 8E), as confirmed by quantification of the adipocyte diameter (Fig. 8F). Morphologically, these smaller adipocyte cells were multilocular and similar to brown adipocytes, compared with normal white adipocytes that are characterized by unilocular lipid droplets.

With the histological findings seen in the TGF-β1^Lβ3/Lβ3 mice, we next examined gene expression from the epididymal WAT. Gene expression analysis revealed elevated mRNA transcripts of genes that represent brown adipocytes such as UCP-1, PGC1-α, and Cidea (Fig. 9A) (26). Because of the brown adipocyte-specific gene signature, glucose homeostasis in the TGF-β1^Lβ3/Lβ3 mice was then assessed where we observed increased glucose tolerance in the TGF-β1^Lβ3/Lβ3 mice (Fig. 9B). Fasting insulin levels were significantly lower in TGF-β1^Lβ3/Lβ3 mice (Fig. 9C). The adipokine leptin was also significantly lower in TGF-β1^Lβ3/Lβ3 mice, consistent with the improved glucose metabolism in the TGF-β1^Lβ3/Lβ3 mice (Fig. 9C). Taken together, these results suggest that improved metabolic phenotypes in the form of reduced body weight and improved glucose homeostasis can be attributed to the appearance of brown-like cells in the WAT of TGF-β1^Lβ3/Lβ3 mice.

These findings mimic the metabolic phenotype of the Smad3^−/− mouse, yet the TGF-β1^Lβ3/Lβ3 mice do not share the same immune or skeletal phenotypes as these mice (26, 37, 38). In addition, inhibition of TGF-β-mediated signaling through an anti-TGF-β neutralizing antibody also promotes improved glucose tolerance and reduced weight gain in mouse models of obesity (26). Because of the parallels between the TGF-β1^Lβ3/Lβ3 mice and these mouse models of impaired TGF-β signaling, we decided to examine the WAT from the mice for any shifts associated with the cellular mechanisms mediating TGF-β signaling. In the WAT of the TGF-β1^Lβ3/Lβ3 mice, the expression of the level of the TGF-β receptor I was significantly reduced, which, in turn, could lead to a decrease in the capacity of adipocytes to respond to TGF-β signaling (Fig. 9D). This correlated with a trend toward increased levels of PGC-1α in the WAT of the TGF-β1^Lβ3/Lβ3 mice (Fig. 9A), as the expression of PGC-1α is known to be inhibited by Smad3 (26). The effects of reduced receptor I expression in the WAT was further confirmed by reductions of other known TGF-β target genes that are normally induced with TGF-β signaling such as Smad7 and JunB (Fig. 9E). Isoform differences in regulating the expression of the TGF-β receptors have been reported where TGF-β1 was shown to induce more receptor I levels than TGF-β3 with no difference in phosphorylated Smad2 or Smad3, yet this effect involved mouse lung tissue (39). Reduced TGF-β-mediated signaling, however, may be one possible explanation why the adipose tissue in the TGF-β1^Lβ3/Lβ3 mice displays characteristics similar with brown fat.