TGF-β Regulates miR-206 and miR-29 to Control Myogenic Differentiation through Regulation of HDAC4

Antibodies and Reagents

Antibodies against HDAC4 and Smad3 were obtained from Cell Signaling. The mouse monoclonal myosin heavy chain antibody was a generous gift of Stephen D. Hauschka (University of Washington, Seattle, WA). GAPDH antibody was obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Oligonucleotide-based microRNA mimics and inhibitors and matching negative controls (NC) were obtained from Dharmacon (miR-206 experiments) and Ambion (miR-29 experiments). Recombinant TGF-β1 was purchased from Peprotech. SB431542 (a TGF-β1 receptor inhibitor) was acquired from Sigma. A Myc-Smad7 plasmid was purchased from Genscript. Expression levels of relevant miRNAs were determined using Assay on Demand^TM kits (Applied Biosystems Inc.).

Cell Culture

C2C12 cells were cultured in DMEM containing 10% FBS (Hyclone), 2 mm glutamine, 100 units/ml penicillin, and 100 μg/ml streptomycin (all culture reagents from Invitrogen except where mentioned). To promote myogenic differentiation and the formation of myoblast fusion into syncytial structures (a process that models the formation of myotubes in vivo), culture medium was substituted with 2% horse serum (Hyclone) in place of FBS for up to 4 days (with medium exchange performed every second day). miRNAs were transfected in 12-well plates using Metafectene Pro (Biontex) or Lipofectamine 2000 (Invitrogen). After 4–6 h, the medium was changed to avoid toxicity, and cells were tracked for up to 72 h post-transfection, before harvest.

For culture of primary muscle cells, 2-week-old C57BL/6 mice were sacrificed by cervical dislocation, and the hind limb and lower back muscles were removed and digested using methods described previously (26). Experiments that involved the use of mice were conducted in accordance with international guidelines including the National Institutes of Health Principles of Laboratory Animal Care and the National Health and Medical Council of Australia Code of Practice for the Care and Use of Animals for Scientific Purposes. Briefly, the muscles were finely minced and digested in 0.2% collagenase II in Hanks' balanced salt solution for 60 min at 37 °C with frequent agitation and then washed well with PBS before further digestion with 0.25% trypsin for 15 min. After enzymatic depletion with FCS and two washes with PBS, the final pellet was resuspended in 10 ml of growth medium (Ham's F-10 with 20% FCS and 2.5 ng/ml basic FGF) and plated onto a 100-mm² Petri dish. The cells were incubated at 37 °C for 60 min, at which time unattached myoblasts were transferred to a new dish. Myoblasts were further purified in this manner until all of the fibroblasts were removed from the culture (approximately four passages). Myoblasts were seeded into 12-well plates at 8 × 10⁴ cells/well and treated or transfected 24 h later, as described for C2C12 cells.

Western Blotting

The cells were lysed using Triton-based lysis buffer (30 mm Hepes, 150 mm NaCl, 1% Triton X-100, 2 mm MgCl₂), with Complete^TM EDTA-free protease and phosphatase inhibitor mixture (Roche Applied Science). Lysis was followed by centrifugation at 13,000 × g for 5 min at 4 °C and denaturing of samples for 5 min at 95 °C. Protein concentration was determined using a Pierce micro protein assay kit (Thermo Scientific). Whole proteome fractions from samples were subsequently separated by SDS-PAGE using precast 4–12% Tris gels (Invitrogen), blotted onto nitrocellulose membranes (Bio-Rad), and incubated with the appropriate antibody overnight. After incubation with relevant secondary antibodies, labeled proteins were visualized using an ECL chemiluminescence detection kit (GE Healthcare). Quantification of labeled Western blots was performed using ImageJ pixel analysis (National Institutes of Health Image software), and the data are normalized to the appropriate control of 1. The data from Western blots are presented as band density normalized to the loading control and are representative of three independent experiments.

Cloning of the HDAC4 3′-UTR

To examine the effect of the miR-29 family, the first 500 bp of the HDAC4 3′-UTR were cloned into a luciferase-based readout vector (Promega). Briefly, this was achieved by cloning nucleotides 4297–4759 of the HDAC4 3′-UTR mRNA sequence from human genomic DNA into the XbaI-NotI site downstream of Renilla luciferase in pCI-neo-hRL35 (27). To examine the effect of miR-206 upon HDAC4 translation in separate experiments, the entire 4-kb sequence of the HDAC4 3′-UTR (referred to as full length) was cloned into the pmirGLO^TM miRNA target expression vector (Promega). Briefly, the entire HDAC4 3′-UTR sequence (synthesized by GenScript, based on the sequence data deposited in PubMed) was cloned into the pmirGLO vector (Promega) downstream of the luc2 reporter gene, using flanking-introduced XbaI and SalI restriction sites, and the resulting product was then verified by resequencing.

Transfections and Luciferase Assays

C2C12 cells were transfected in 12-well plates either with 50 nm of each of the miR-29 family or 200 nm of miR-206 using Lipofectamine 2000 (Invitrogen) or Metafectene Pro (Biontex). 300 ng/well of HDAC4 3′-UTR was transfected with 200 ng/well of β-galactosidase. The medium was changed 5 h later and supplemented with either vehicle or 5 ng/ml TGF-β for 48 h. The cells were subsequently lysed with commercial cell lysis buffer (Promega), and luciferase activity was measured using a Berthold luminometer according to kit protocols. Luciferase activity was normalized to β-galactosidase activity, which was detected using a Promega β-galactosidase detection assay. Briefly, lysate was frozen and thawed at −80 °C twice, followed by centrifugation at 13,000 rpm and addition of 2× β-galactosidase buffer for 1 h at 37 °C. β-Galactosidase expression was detected at a wavelength of 420 nm. Luciferase activity is presented as the ratio of HDAC 3′-UTR luciferase activity-to-β-galactosidase reporter activity, and the data are representative of three independent experiments. All of the data are expressed relative to the control, which is set at 1.

Quantitative RT-PCR

Total RNA was collected from cells using a TRIzol-based extraction protocol (Invitrogen). 500–1000 ng of RNA was reverse transcribed using the high capacity RNA-to-cDNA kit (Applied Biosystems). cDNA was analyzed for HDAC4 by quantitative RT-PCR using TaqMan assay on Demand^TM kits utilizing a specific probe and primer and ABI detection software run on Applied Biosystems hardware (Applied Biosystems Inc.). For analysis of miRNA and pri-miR-206 levels, ABI Assay on Demand^TM kits were used according to the manufacturer's instructions. Pri-miR-29 specific primer mixes were purchased from Qiagen. MyoD transcription was quantitated using primers (forward, AGTGAATGAGGCCTTCGAGA; reverse, GCATCTGAGTCGCCACTGTA) and a SYBR Green-based analysis. Primers for 18 S were used to standardize cDNA concentrations. miRNA expression was normalized to sno135 RNA or 18 S RNA. The data were analyzed using the ΔΔC_T method of analysis and are presented as averages of three independent experiments, where the control is standardized to 1.

Statistical Analysis

The Student t test was used to assess the differences in one variable between two groups, and all of the differences reported are p < 0.05 unless otherwise stated. The data are presented as the means ± S.E. unless indicated and are representative of at least three independent experiments.

TGF-β Regulates the Expression of miRNAs Expressed in Skeletal Muscle

In our studies (and in agreement with the work of others), the C2C12 cell line exhibits robustly increased expression of miR-206 and -133 when differentiation is induced by the application of culture medium supplemented with 2% horse serum (Fig. 1a) (14, 28). We also observed elevated levels of other more widely expressed (i.e. not muscle-specific) miRs that have been implicated in myogenic commitment including the miR-29 family (17) (Fig. 1a). Because TGF-β is a well characterized inhibitor of muscle cell differentiation, we investigated whether this growth factor regulates these and other recognized pro-differentiation miRNAs. When C2C12 myoblasts incubated in differentiation media were assessed 48 h after treatment with TGF-β, we found a significant reduction in the endogenous expression of miR-206, -133a, and -133b, as well as the miR-29 family (Fig. 1b). Interestingly, although members of the miR-200 family have been shown to be TGF-β-responsive in epithelial cells (27), TGF-β had no effect on these miRNAs in C2C12 cells. Furthermore, given recent reports that have demonstrated that members of the TGF-β superfamily can regulate miRNAs, including miR-206, at a post-transcriptional level, we assessed whether TGF-β similarly regulated the primary and mature forms of miR-206 (29). We found that TGF-β potently reduced both forms of miR-206, and furthermore, this held true for the effect of TGF-β on pri-miR-29 (Fig. 1c). This indicates that TGF-β, unlike BMP-2 (29), inhibits the processing of the primary form of these miRNAs into their mature forms. Furthermore, we examined whether these findings could be replicated in primary muscle cells subjected to TGF-β treatment for 48 h. These cells exhibited increased proliferation rates (Fig. 1d, right panel, lower image versus upper image). Importantly, we found that in primary muscle cultures, TGF-β also suppressed the mature and primary forms of the miR-29 family and of miR-206, although it had no effect on miR-151, thereby demonstrating that the effects of TGF-β are specific for particular miRs. These data demonstrate that expression of the pro-differentiation miR-206 and miR-29 is altered in myogenic cells by TGF-β treatment, which represents a mechanism by which TGF-β could inhibit myogenesis.

TGF-β Regulates HDAC4 Expression through Regulation of Its 3′-UTR

Given the recent reports demonstrating that HDAC4 is a target of miR-206 and the miR-29 family (20, 21) and our data demonstrating that TGF-β can suppress miR-206 and miR-29 expression, we investigated the ability of cellular responses driven by TGF-β exposure to regulate HDAC4 levels. According to existing databases, the human HDAC4 3′-UTR contains three target sites for miR-206 and one for the miR-29 family (Fig. 2a). We cloned short and long versions of the 3′ HDAC4 UTR into a luciferase reporter construct (providing targets for the mir-29 family, as well as miR-206, respectively) and observed that luciferase activity was increased in cells transfected with a Luc-HDAC4 3′-UTR construct, when treated with TGF-β (Fig. 2b). We further tested the effect of TGF-β on the expression of endogenous HDAC4 protein and confirmed that TGF-β exposure induces accumulation of HDAC4 protein in a dose-dependent manner up to doses of 1.25 ng/ml, after which HDAC4 protein induction was maximal (Fig. 2c). We also tested the ability of TGF-β to regulate HDAC4 protein levels in primary muscle cells and found that TGF-β at doses of 0.5 ng/ml could maximally induce HDAC4 protein levels (Fig. 2c). To establish whether TGF-β acts only through post-transcriptional mechanisms to regulate HDAC4 protein expression, the HDAC4 mRNA levels were also examined. Although plasminogen activator inhibitor, a known downstream target of TGF-β (30, 31), was significantly induced by TGF-β, we observed no effect of TGF-β on HDAC4 gene expression (Fig. 2d). Taken together, these data establish that TGF-β increases expression of HDAC4 protein via a post-transcriptional mechanism that involves the HDAC4 3′-UTR rather than an increase in HDAC4 transcription.

Regulation of HDAC4 Is via the Canonical TGF-β Pathway

Having observed an effect upon HDAC4 levels associated with TGF-β treatment, we sought to determine whether the regulation of HDAC4 by TGF-β was dependent on canonical TGF-β signaling, by investigating the capacity of other TGF-β superfamily members to regulate HDAC4 3′-UTR luciferase activity. Over the growth factor concentrations used, we found that TGF-β1 and TGF-β2 treatment significantly increased Luc-HDAC4 3′-UTR activity, whereas BMP-7 and activin-A had no significant effect (Fig. 3a). These findings suggest that the effect of TGF-β upon HDAC4 is contingent on signaling situated primarily downstream of the TGF-β receptor complex and is unlikely to involve Smad proteins-1 and -5 that are more closely associated with BMP-dependent signaling operating through distinct receptor complexes. To further characterize the effect of TGF-β on the HDAC4 3′-UTR, we assessed the ability of TGF-β to induce luciferase activity in the presence of selected TGF-β pathway inhibition. We found that increased expression of the inhibitory Smad7 abrogated the ability of TGF-β to increase luciferase activity (Fig. 3b), lending further support to the induction of HDAC4 expression being dependent on canonical (i.e. Smad2/3-based) TGF-β signaling. In a complementary set of experiments, we observed that chemical inhibition of the type I receptor with SB431542 at 1 or 10 μm also abrogated TGF-β-induced 3′-UTR HDAC4 luciferase activity (Fig. 3c).

miR-206 and miR-29 Inhibit TGF-β-mediated Induction of HDAC4

Given that TGF-β can influence HDAC4 expression and HDAC4 3′-UTR luciferase activity (Fig. 2) and that miR-206 and miR-29 levels change with TGF-β treatment, we investigated the relationship between TGF-β, the HDAC4 3′-UTR, and the aforementioned miRs. Consistent with recent reports that miR-206 and miR-29abc target the 3′-UTR of HDAC4, we observed that cells transfected with synthetic miR-29abc and -206 mimics demonstrated reduced Luc-HDAC4 3′-UTR activity (Fig. 4, a and b) and conversely that cells transfected with miR-29abc- and miR-206-specific anti-miRs or hair-pin inhibitors displayed increased Luc-HDAC4 3′-UTR activity (Fig. 4, c and d). Importantly, we noted that increases in luciferase activity following TGF-β treatment were potently inhibited when cells were co-transfected with either miR-29 or miR-206 mimics (Fig. 4, a and b). Furthermore, we demonstrated that inhibition of miR-29abc or miR-206 with specific inhibitors potentiated the luciferase activity in cells treated with TGF-β (Fig. 4, c and d). These data confirm that the HDAC4 3′-UTR is a target of both miR-29 and miR-206 and, more importantly, demonstrate the ability of these miRNAs to potently modulate TGF-β-induced changes in HDAC4 expression.

Previous studies have demonstrated that TGF-β exerts effects that can inhibit muscle differentiation through actions upon Smad3 (9). We therefore considered whether the inhibition of myogenic differentiation could be mediated by the effect of miR-29 and miR-206 on Smad3, hypothesizing that this may act as a mechanism by which these miRs suppress the effect of TGF-β on the 3′-UTR of HDAC4. We found that ectopic expression of miR-29 (but not miR-206) attenuated basal levels of Smad3 protein (Fig. 4e). We then tested the effect of these miRNAs on the induction of Smad3 by TGF-β and found that both miR-206 and miR-29 prevented the induction of Smad3 following the exposure of cells to TGF-β (Fig. 4f). The results suggest that differential modes of Smad3 regulation are exerted by miR-29 and miR-206 and that the miR-29 family serves a particularly significant role in regulating basal Smad3 levels in muscle. Moreover, the data indicate that although TGF-β acts to elevate HDAC4 expression, miR-29 and miR-206, as two modulators of the program contributing to myogenic differentiation, have the ability to suppress cellular effects following TGF-β treatment via mechanisms that can interfere with the induction of Smad3. The mechanisms of this precise effect remain incompletely defined, however, because neither miR-206 nor miR-29abc is presently predicted to strongly target the murine Smad3 3′-UTR or open reading frame (although a predicted miR-206 target exists in the human and primate Smad3 3′-UTR).

Regulation of HDAC4 Protein Expression by TGF-β and miR-206 and -29 Is Independent of Transcription

To determine whether miR-206 and miR-29 regulate HDAC4 expression at a post-transcriptional level, we assessed HDAC4 gene expression in response to ectopic expression of these miRNAs in the absence or presence of TGF-β. As shown in Fig. 5 (a and b), both TGF-β and the miRs-29 and -206 had little effect on HDAC4 mRNA levels, whereas HDAC4 protein levels were clearly induced in the presence of TGF-β, and this response was attenuated by ectopic expression of miR-29 or miR-206 (Fig. 5, c and d). These findings are consistent with the inability of TGF-β to induce HDAC-3′-UTR-driven luciferase activity in the presence of these miRNAs, as in Fig. 4.

miR-206 and miR-29 Can Partially Rescue the Inhibitory Effect of TGF-β on Skeletal Muscle Cell Differentiation

Our data indicate that TGF-β prevents the differentiation of myogenic cells by processes that include increasing expression of HDAC4, an established inhibitor of muscle differentiation. This mechanism involves the down-regulation of miR-206 and miR-29, which can each act as translational repressors of HDAC4 by targeting the 3′-UTR of this gene. The stimulatory effects of TGF-β upon HDAC4 protein expression can be attenuated by elevated expression of miR-206 and miR-29, which, apart from preventing TGF-β-mediated induction of HDAC4 expression, can also interfere with Smad signaling that occurs downstream of the TGF-β receptor. To confirm the effects of TGF-β on myogenic differentiation in the presence of these miRNAs, we examined the levels of MyoD and Mef-2 because these regulatory factors are integral players in control of myogenic programming that are under direct repression by HDAC4 and also examined the expression of myosin heavy chain protein, as a marker of muscle differentiation.

Although TGF-β acts as a potent inhibitor of muscle cell differentiation and fusion (Fig. 6, a and b, panel 1 versus panel 2), the inhibition of differentiation by TGF-β is reduced in the presence of miR-206 or the miR-29 family (Fig. 6, a and b, panel 2 versus panel 4). These morphological effects were also confirmed by determining the expression levels of MyoD transcripts. Although MyoD gene expression was reduced in cells after administration of TGF-β, the effect of TGF-β upon cells simultaneously administered miR-29 (and to a lesser degree miR-206) was reduced (Fig. 6, c and d). Similar trends were observed of Mef-2 and myosin heavy chain protein levels in cells treated with TGF-β in the presence and absence of increased concentrations of miR-29 and 206 (Fig. 6, e and f). These data further demonstrate that increasing miR-206 and miR-29 can override (at least to a degree) the inhibitory effect of TGF-β upon induction of the myogenic program.