Cell Membrane-bound Kaposi's Sarcoma-associated Herpesvirus-encoded Glycoprotein B Promotes Virus Latency by Regulating Expression of Cellular Egr-1^*

Cells

HMVEC-d cells were propagated in EGM^TM MV-microvascular endothelial cell medium (Clonetics) as per standard protocols (9). The passage numbers for HMVEC-d cells used in this study ranged between 5 and 9. 293 and BCBL-1 cells were cultured in DMEM and RPMI (Invitrogen) as per earlier studies (17, 18).

Plasmids

pCDNA3.1.CT-GFP-TOPO (pCDNA), gB/pCDNA3.1.CT-GFP-TOPO (gB/pCDNA), and gL/pCDNA are plasmids that encode full-length gB and gL, respectively (7, 19). Like gB, gL is also expressed independently on the cell membrane (19). Another plasmid, gB-RGA/pCDNA, encodes for full-length gB with a mutation to the RGD domain (RGD to RGA). All of these plasmids encode green fluorescent protein (GFP), which was used as a marker for sorting cells. We also used egr-1/pCDNA3.1(+) and gL/pCDNA3.1(+) vectors without the GFP tag for the short interfering RNA (siRNA) experiments (Fig. 2) and luciferase assay. Vectors pCMV and pCMV-MEK1 (20) were also used in this study.

Antibodies

Antibodies to gB, anti-RGDgB-N1 (developed against RGD-containing peptide sequences in gB; amino acids 27–44), anti-gB-C (developed against non-RGD-containing peptide sequences in gB; amino acids 828–845) (9); anti-phospho-ERK1/2, anti-total ERK1/2, anti-actin, and monoclonal antibodies (15F7) to Egr-1 (Cell Signaling Technology, Beverly, MA) were used in this study. All of the above antibodies were made in rabbits. A mouse anti-Egr-1 monoclonal antibody purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA) was used in the immunofluorescence assay.

Inhibitors

U0126 was purchased from Promega (Madison, WI) and used in this study.

Recombinant KSHV gB

Expression and purification of the recombinant KSHV gBΔTM (2106 bp; encoding amino acids 1–702 lacking the transmembrane and cytoplasmic domains) and gBΔTM-RGA proteins from the infected High-5 cells were done using nickel columns (PharMingen, Pasadena, CA) as per procedures described before (21). All of the reagents (including the above recombinant proteins) used in this study were prepared using endotoxin-free water. Additionally, the sample preparation was tested and determined free of contamination using an end point chromogenic Limulus amebocyte lysate assay (Charles River Laboratories, Charleston, SC).

Dose Optimization Assay for KSHV gBΔTM

Target cells were treated with different concentrations of gBΔTM at 37 °C in a V-bottom 96-well plate. After a 24-h incubation, the cells were analyzed for the expression of LDH, as an indicator of cell death. The LDH assay was performed using the CytoTox 96 non-radioactive kit (Promega) as per earlier studies (22).

PCR Arrays

We analyzed the manner by which gB could possibly alter signaling in endothelial cells using the NFκB signaling pathway PCR arrays. Briefly, cells cultured in growth medium were either left untreated or treated with 100 ng/ml gBΔTM at 37 °C. At the end of 2 and 4 h post-treatment, the cells were lysed, RNA was extracted, and cDNA was prepared (23). The cDNA was later used to analyze the profile of 84 genes regulated by NFκB signaling using the PCR array (catalog no. PAHS-025) as per the manufacturer's recommendations (SABiosciences, Frederick, MD).

Quantitative RT-PCR (qRT-PCR)

The qRT-PCR was performed using the synthesized cDNA in a 25-μl reaction volume to analyze the expression of ORF50, egr-1, and β-actin as per earlier protocols (24).

KSHV Infection of HMVEC-d Cells

HMVEC-d cells were infected as per earlier procedures (25). Briefly, monolayers of HMVEC-d cells were infected with a multiplicity of infection of 10 ORF73 units for 2 h (26). After incubation, the cells were washed three times in DMEM before incubating in growth medium for 48 h. This allowed virus to establish a latent infection of cells.

Co-culture Experiments

This assay was developed to analyze the effect of membrane-bound gB on the expression of egr-1 and ORF50 (virus reactivation). Two cell populations were used in this assay: the target and the effector cells. Target cells were HMVEC-d cells that were cultured as monolayers in 12-well plates. The effector cell population included 293 cells that were untransfected or were transfected with pCDNA, gB/pCDNA, or gL/pCDNA using the Nucleofector II device (27). We tested 293, HFF, HMVEC-d, and COS-1 cells as effector cells. We determined that 293 cells expressed gB on their cell surface at levels comparable with BCBL-1 cells that were induced with TPA for 48 h as measured by the mean fluorescent intensity (data not shown). Target cells were infected with KSHV as described above (26). These cells were washed twice in DMEM before trypsinizing them to obtain single cell suspension. The above single cell suspension of KSHV-infected target cells was mixed with 2, 5, 10, and 30% of effector cells that specifically expressed gB on their cell surface; seeded onto a 12-well plate; and incubated in growth medium at 37 °C. The gB- and gL-positive cells were sorted using a flow cytometer based on the expression of GFP. The time at which the mixture of cells was seeded onto 12-well plates was considered as 0 h. At different time points (1, 4, 8, 12, 24, 48, 72, 96, and 120 h) post-seeding, the cells were lysed, RNA was extracted, cDNA was prepared, and the expression of ORF50 was monitored by qRT-PCR using specific primers. The relative copy numbers of the ORF50 transcripts were calculated from the standard graph plotted using the Ct values for different dilutions of in vitro transcribed ORF50 (using ORF50/pGEM-T plasmid). These values were normalized to each other using the values of the β-actin control reactions. As reported earlier (28), the lowest limit of detection in the standard samples was 6–60 copies for the ORF50 gene. Expression of egr-1 in the above cells was monitored in the same lines.

Western Blotting

Equal amounts of protein were used in Western blotting experiments as per earlier studies (24). We used 60 μg (3 times more) of protein in this experiment for clarity of the bands. The bands were scanned, and the band intensities were assessed using the ImageQuaNT software program (Amersham Biosciences).

Silencing Egr-1 RNA Expression

Expression of Egr-1 was inhibited by the transfection of double-stranded RNA oligonucleotides as described previously (23, 29). The siRNAs used in this experiment were obtained from Dharmacon (Lafayette, CO) as the ON-TARGET plus Smart pool. The nonspecific (NS) siRNAs used were those described previously (29).

Immunofluorescence Assay for Examination of Egr-1 and Rta

Target cells were fixed for 10 min in ice-cold acetone and washed three times in phosphate-buffered saline (PBS). These cells were stained with mouse anti-Egr-1 monoclonal antibodies and rabbit peptide IgGs to Rta synthesized as per earlier studies (30) for 45 min at room temperature and incubated with goat anti-mouse FITC and goat anti-rabbit TRITC (Sigma) for 30 min at room temperature. Stained cells were washed in PBS and examined under a Nikon fluorescent microscope with appropriate filters.

In Vitro Transcription and Translation (IVT)

IVT of egr-1/pCDNA3.1(+) and gL/pCDNA3.1(+) was conducted as per earlier studies using the TNT-coupled rabbit reticulocyte lysate system (Promega).

Electromobility Shift Assay (EMSA) and Immunoprecipitated (IP) EMSA

IVT products of egr-1 or KSHV gL were evaluated by EMSA for DNA binding using a 25-bp DIG-labeled probe containing the ORF50 promoter (ORF50P) sequences (ORF50P probe). The probe encompasses the tttgacctgcgtgcgctctccggct sequence. 2.5 μl of IVT product and 50 ng/μl DIG-labeled probe were mixed in a binding buffer and allowed to incubate at room temperature for 30 min. Appropriate nonspecific probe at 1-μg amounts was used in the reaction. For supershift, IVT products were incubated with rabbit monoclonal antibodies to Egr-1 or nonspecific IgG at 37 °C for 30 min prior to the addition of the DIG-labeled probe. All samples were run on a 4% non- denaturing gel for ∼1.5 h and transferred to a PVDF membrane. The protein-DNA interaction was detected using the CSPD detection system (Roche Applied Science). The IP EMSA was conducted as per the procedures outlined in earlier studies (31) using 0.5 mg of protein from target cells, precleared with normal rabbit serum and protein A-Sepharose. In another set of experiments, we analyzed the ability of Egr-1 in the nuclear extracts to bind ORF50P by performing EMSA. Briefly, we used the annealed double-stranded DIG-labeled oligonucleotides containing the consensus binding site for Egr-1 on ORF50P as described above. EMSA was performed as per procedures outlined for testing IVT-synthesized Egr-1 using 4 μg of nuclear extract. For supershift assays, we incubated nuclear extracts with 1:50, 1:500, and 1:5000 dilutions of rabbit monoclonal antibodies to Egr-1 or nonspecific IgG at 37 °C for 30 min prior to the addition of the DIG-labeled probe and analyzing the protein-DNA interactions as per standard procedures.

Luciferase Assay

Target cells grown to 65% confluence were transiently co-transfected with 500 ng of pCDNA3.1(+), egr-1/pCDNA3.1(+), or gL/pCDNA3.1(+); 500 ng/well pGL3 or ORF50P (nucleotides 68,509–71,593; KSHV genome sequence NC_003409)/pGL3; and an internal control pRL-TK (Promega). Transfections were performed using the Nucleofector II device as per the recommendations of the manufacturer (Amaxa Inc., Gaithersburg, MD). At 48 h post-transfection, cells were harvested, and firefly and Renilla luciferase activities in cell extracts were recorded using the dual luciferase system. Luciferase activity was monitored using a Turner Systems Luminometer (Sunnyvale, CA) as in earlier studies (32). The relative luciferase activity was then calculated by normalizing ORF50P luciferase activity to control Renilla luciferase activity. The results were plotted as a percentage of the activity of the full-length promoter. In another set of experiments, 4 h prior to harvesting cells, the monolayers were incubated with 30% effector cells that were positive for gB expression or were transfected with empty vector. This was conducted to demonstrate the role of membrane-bound gB in regulating ORF50 activity.

KSHV-soluble gB Lowers Egr-1 Expression

To determine the effect of KSHV gB on target cells, soluble gB protein lacking the transmembrane domain (gBΔTM) was first used. Coomassie staining of reduced gBΔTM protein yielded the expected three distinct bands at 36, 68, and 104 kDa, respectively (Fig. 1A). As suggested in the earlier studies (21), the 104-kDa protein probably represents the uncleaved gB precursor, and the 68-and 36-kDa proteins represent the cleaved and processed amino and carboxyl domains of the gBΔTM protein, respectively. Additional bands were not detected, indicating purity of the soluble protein. Treatment using rabbit anti-gB antibodies also led to the detection of three bands of the same molecular weight (Fig. 1A). The specificity of our antibodies was demonstrated by the lack of reactivity of normal rabbit sera and anti-gL antibodies (data not shown).

HMVEC-d cells that were treated with gBΔTM at concentrations of 1 μg/ml and below did not significantly induce cell death as monitored by the lactate dehydrogenase assay (Fig. 1B). These results were confirmed by the conventional trypan blue test. More than 95% of the target cells were found to be viable when the target cells were treated with gBΔTM at concentrations of 1 μg/ml or below (data not shown). Such non-toxic doses were used in this study. Comparable results were observed in 293, HFF, and primary effusion lymphoma cells (data not shown). Doses of about 1–4 μg/ml gBΔTM have been successfully used in functional assays (21, 33).

The manner by which gB could possibly alter NFκB signaling in KSHV-infected endothelial cells was analyzed using NFκB signaling pathway PCR arrays. When comparing untreated cells to cells that were treated with gBΔTM, the most significant changes observed were in the genes egr-1, MCP-1 (monocyte chemotactic protein-1), and caspase 8 (Fig. 1C). KSHV gBΔTM lowered expression of Egr-1 and caspase 8 mRNA in target cells. Incidentally, expression of MCP-1 was elevated in cells treated specifically with gBΔTM (Fig. 1C). Expression of IRAK-2 (Fig. 1C), β2-microglobulin, glyceraldehyde-3-phosphate dehydrogenase, and β-actin (data not shown) were not altered in response to treatment of cells with gBΔTM or in cells expressing gB on their cell surface, demonstrating the specificity of the data from the use of these arrays. These results were further confirmed by performing qRT-PCR using specific primers (data not shown).

Cell cycle plays a major role in allowing KSHV reactivation to occur (11, 34). Therefore, we performed the above experiment in KSHV-infected cells derived from G₀/1 and S phases of cell cycle by the serum starvation method (18). Interestingly, egr-1 was significantly lowered in cells derived from both G₀/1 and S phases (supplemental Figs. 1 and 2). The cells cultured in growth medium (Fig. 1C) responded in a manner similar to those in G_0/1 phase compared with those in S phase. This could partly be because the majority of the HMVEC-d cells cultured in growth medium are in G_0/1 phase (70–75%) followed by G₂/M (13–16%) and S (5–8%) phase, respectively (supplemental Fig. 3).

The array data were confirmed by performing conventional Western blotting experiments. A dose-dependent inhibition of Egr-1 by gBΔTM in KSHV-infected target cells was observed (Fig. 1D). gBΔTM inhibited expression of Egr-1 when used at a concentration of ≥10 ng/ml. It did not alter the expression of β-actin at the concentrations tested (Fig. 1D). Nonspecific proteins GST and BSA (data not shown) did not have such an effect on Egr-1, confirming the specificity of the effect of gB. A similar effect on Egr-1 expression was noticed in BCBL-1 cells treated with increasing concentrations of soluble gBΔTM (data not shown). These results provide support for the ability of KSHV gB to inhibit the expression of Egr-1 at the transcriptional and translational levels in target cells.

Egr-1 Is Required for ORF50 Expression

KSHV Rta (replication and transcription factor) is encoded by ORF50, an immediate early gene that is responsible for the activation of several lytic genes (35). To date, a direct relationship between KSHV ORF50 and egr-1 has not been established. HMVEC-d cells supporting a latent KSHV infection were used to determine a possible association between the two. A significant increase in egr-1 expression was observed in KSHV-infected cells up to 12 h post-TPA treatment (Fig. 2A). Additionally, activation of ORF50 followed a similar increasing trend, indicating that TPA induced KSHV reactivation in these cells (Fig. 2A). In order to determine the necessity for Egr-1 in ORF50 expression, we monitored ORF50 expression in cells that were silenced for Egr-1 expression using specific double-stranded siRNA (36). The level of Egr-1 mRNA was significantly suppressed in HMVEC-d cells by siRNA specific to Egr-1 when compared with NS siRNA (Fig. 2B). An inhibition of 65 ± 8, 80 ± 4, and 55 ± 8% of Egr-1 mRNA was observed at 12, 24, and 48 h post-transfection.

KSHV replication follows a unique pattern in HMVEC-d cells (25). The lytic gene ORF50 is expressed as early as 2 h post-infection (PI), declining sharply by 24 h PI. This early expression of Rta is not sufficient to activate a lytic infection. KSHV is said to establish a latent infection 48 h PI. TPA treatment of KSHV-infected HMVEC-d cells 48 h PI led to expression of the full range of lytic genes (25). Thus, there are actually two distinct phases when ORF50 may be expressed in HMVEC-d cells: (i) during early stages of primary infection (TPA-independent) and (ii) when TPA is added to cells that are harboring virus DNA in a predominantly latent phase (TPA-dependent). Hence, we infected the above siRNA-transfected cells with KSHV (multiplicity of infection of 10 ORF73 units). After 6 h PI, ORF50 expression in the cells was monitored by qRT-PCR. This study monitored the expression of ORF50 during the early phase of primary infection. Cells transfected with siRNA specific to Egr-1 expressed reduced levels of ORF50 when compared with cells transfected with siRNA specific to VEGF or with NS siRNA or those left untransfected (Fig. 2C). This siRNA-specific decrease in the expression of ORF50 was significantly reversed when the cells were co-transfected with siRNA specific to egr-1 and 500 ng of egr-1/pCDNA3.1(+) plasmid compared with transfecting cells with siRNA specific to Egr-1 and 500 ng of pCDNA3.1(+) (Fig. 2C). Co-transfecting cells with gL/pCDNA3.1(+) did not reverse the inhibitory effect of siRNA specific to Egr-1 on ORF50 (data not shown). These results demonstrate the specific and crucial role for Egr-1 in the expression of Rta, the initiator of KSHV reactivation (37).

TPA-induced KSHV-infected cells that were transfected with siRNA specific to Egr-1 expressed reduced levels of ORF50 when compared with cells transfected with siRNA specific to VEGF or nonspecific NS siRNA or those left untransfected (Fig. 2D). These results suggest a key role for Egr-1 in KSHV reactivation.

In our analysis of KSHV-infected BCBL-1 cells (another cell type that inherently carries KSHV DNA) under both uninduced and TPA-induced conditions, we determined that both Egr-1 and Rta are expressed in the nucleus of cells during virus reactivation (Fig. 2E). Egr-1 is a protein expressed only at a basal level under physiological conditions (38). The expression of both Egr-1 and Rta under natural (uninduced) or TPA-induced conditions could be reversed by treating with either soluble gB (Fig. 2E) or MAPK signaling inhibitor (U0126) but not by DMSO, the solvent for U0126 (data not shown). Similar results were observed in HMVEC-d and 293 cells (data not shown). In all (Figs. 1 and 2), these results demonstrate a direct link between the expression of egr-1 and ORF50 transcription and a possible role for KSHV gB to prolong the onset of a lytic infection by blocking egr-1 and ORF50 expression.

KSHV gB Expressed on a Minimal Number of Cells Is Sufficient to Regulate ORF50 and Egr-1 Expression

In order to test the ability of gB to promote virus latency under conditions similar to what may be observed in KS lesions, we developed an assay based on co-culturing cells. This involved the use of two different cell populations: target cells and effector cells. Effector cells expressing gB (gB+; Fig. 3A) on their surfaces significantly lowered ORF50 levels in KSHV-infected cells (Fig. 3B). ORF50 expression in KSHV-infected cells reached almost undetectable levels by 120 h. We found 2% effector cells expressing gB to reduce ORF50 to undetectable levels by 72 h (Fig. 3B). The results from using effector cells transfected with either empty vector (pCDNA) (Fig. 3B) or gL/pCDNA (data not shown) were comparable with the control (KSHV-infected target cells). ORF50 expression was inhibited to undetectable levels by 48 h itself when 30% gB+ effector cells were used compared with effector cells transfected with empty vector (data not shown). In this case, a sharp decline (up to 65%) in ORF50 expression was observed as early as 8–12 h postmixing. Our results also demonstrate that gB expressed on as few as 2% (Fig. 3C), 5%, 10%, or 30% (data not shown) of cells significantly lowered egr-1 expression compared with empty vector (Fig. 3C). There seems to be a direct correlation between the expression of egr-1 and ORF50 in response to signaling induced by membrane-bound gB in KSHV-infected cells. Silencing Egr-1 using specific siRNA lowers ORF50 expression (Fig. 2, C and D). We did not observe an additive effect by cell membrane-bound gB in lowering ORF50 expression in Egr-1-specific siRNA-transfected KSHV-infected target cells (data not shown). This further implicates gB in specifically lowering ORF50 expression via altering egr-1 expression. Our results also implicate a crucial role for the cell-cell contact to efficiently inhibit ORF50 and egr-1 expression. This is based on the fact that the supernatant obtained exclusively from the cultures of effector cells expressing gB on the cell surfaces failed to inhibit egr-1 or ORF50 expression levels in KSHV-infected target cells. Overall, we concluded that gB expressed on the cell surface of 1–2% of cells to significantly promote virus latency.

Membrane-bound gB Blocks ORF50 Activity via the MAPK Signaling

MAPK signaling is crucial for KSHV reactivation from latency (20, 39–41). Hence, we tested the effect of KSHV-encoded membrane-bound gB on ERK1/2 activity as measured by phosphorylation. We used the co-culture experiments as suggested in Fig. 3B to monitor the expression of phosphorylated ERK1/2. The level of ERK1/2 activity was significantly reduced in monolayer of HMVEC-d cells that were incubated with effector cells expressing gB on their cell surface (Fig. 4A, lanes 4–6) compared with effector cells expressing gL (Fig. 4, lane 2). Treating target cells with the MAPK inhibitor, U0126, for 24 h significantly lowered expression of the phosphorylated form of ERK1/2 (Fig. 4, lane 7). These results demonstrated the ability of KSHV membrane-bound gB expressed on a minimal number of cells to lower the MAPK signaling cascade that is crucial for the virus reactivation. Identical results were observed when KSHV-infected endothelial cells were treated with gBΔTM in the absence or in the presence of TPA (data not shown).

Additionally, we tested the effect of transient transfection of HMVEC-d cells with a vector encoding MEK1 on the ability of membrane-bound gB to lower ORF50 activity by co-culture experiments. A 4-fold-enhanced ERK1/2 activity in cells transfected with pCMV-MEK1 was noted when compared with both untransfected cells and those that were transfected with empty vector (Fig. 4B). We observed a significant drop in the ability of membrane-bound gB expressed on the 2% effector cells to lower ORF50 (Fig. 4C) and egr-1 (Fig. 4D) activity in cells overexpressing ERK1/2 activity. As expected, comparable results were observed when the cells were treated with U0126 (data not shown). Based on these results, we concluded that membrane-bound gB mediates its ultimate effect on egr-1 > ORF50 activity via the MAPK signaling pathway.

Effect of gB on ORF50 and Egr-1 Expression is Arg-Gly-Asp (RGD)-independent

KSHV gB has been demonstrated to mediate virus attachment and entry of target cells in an RGD-dependent manner (9, 21, 42). Therefore, we performed studies to determine if the RGD domain in gB had a role in regulating egr-1 and ORF50 expression. Accordingly, we analyzed the ability of antibodies to the RGD domain (anti-RGDgB-N1) in gB to block gB-mediated ORF50 suppression in KSHV-infected target cells. Earlier studies have documented anti-RGDgB-N1 to block the function of gB that assists in the entry of KSHV into target cells (9). For this purpose, we used 30% gB+ effector cells because they lowered ORF50 expression in a short period (4–8 h postmixing) of time (data not shown). Treatment of the effector cells expressing gB on their surface with antibodies to gB blocked the ability of gB to inhibit ORF50 expression (Fig. 5A). However, anti-RGDgB-N1 and anti-gB-C (antibodies developed against a non-RGD-containing peptide sequence) failed to significantly lower the ability of membrane-bound gB to inhibit ORF50 expression in target cells (Fig. 5A). Also, treatment of KSHV-infected target cells with gBΔTM-RGA (soluble form of gB with an RGA domain instead of an RGD) lowered ORF50 expression in cells (data not shown).

To further confirm the above results, we performed the co-culture experiments using 2% gB+ effector cells. In this experiment, we tested the effect of expressing wild type gB (gB-RGD) over gB carrying a mutation to the RGD domain (gB-RGA) on ORF50 and egr-1 expression in KSHV-infected target cells. gB-RGA expressed on the cell surface of 2% of effector cells was able to lower expression of both ORF50 and egr-1 in KSHV-infected cells in a manner similar to gB-RGD (Fig. 5, B and C). These results suggest that membrane-bound gB alters the expression of ORF50 in an RGD-independent manner.

KSHV gB Inhibits Egr-1 Binding to the ORF50P

Our results implicate gB in suppressing ORF50 expression by modulating Egr-1 expression (Figs. 1–5). Egr-1 protein is a transcription factor capable of regulating the transcription of several genes (13, 43). Egr-1 is said to bind a GC-rich DNA template (such as GCGC(G/T)GGGCG, GCGGGGGCG, and CGCCCATGC) on the promoter and initiate gene transcription (43). Such GC-rich Egr-1 binding sequences have been identified by us in the promoter region of KSHV ORF50. Hence, we conducted experiments to determine if Egr-1 bound ORF50P sequences. EMSAs were performed using DIG-labeled specific probes and in vitro transcribed and translated Egr-1 proteins. The IVT of egr-1/pCDNA3.1 plasmid resulted in the generation of [³⁵S]methionine-labeled specific protein of about ∼78 kDa (Fig. 6A, lane 2). IVT of empty vector did not produce any protein of the predicted molecular size (Fig. 6A, lane 1). These results were further confirmed by immunoprecipitation using specific rabbit monoclonal antibodies (15F7) to Egr-1 (Cell Signaling, Danvers, MA). Rabbit anti-Egr-1 antibodies specifically immunoprecipitated the IVT product of egr-1/pCDNA3.1(+) (Fig. 6A, lane 3). Rabbit anti-gB antibodies did not immunoprecipitate Egr-1 (Fig. 6A, lane 4). These results confirmed the authenticity of the clone. We tested if this IVT synthesized Egr-1-bound ORF50P. Our results demonstrated that the IVT-synthesized Egr-1 bound the ORF50P probes specifically and formed a discrete band (Fig. 6B, lane 3) compared with IVT gL (Fig. 6B, lane 2). This band (Egr-1/ORF50P probe) was supershifted to higher molecular weights by antibodies to Egr-1 (Fig. 6B, lane 5) but not by control IgGs (Fig. 6B, lane 4), indicating that this complex was indeed specifically formed by Egr-1 interacting with ORF50P probe. Similar results were obtained using IP Egr-1 proteins from nuclear lysates of KSHV-infected cells (Fig. 6C, lane 2). Furthermore, excess unlabeled ORF50P probes were able to restrict binding of IP Egr-1 proteins to labeled probes, demonstrating the specificity of this binding (Fig. 6C, lane 3). Finally, we performed gel shift assays to demonstrate the ability of Egr-1 obtained from within the nucleus (whole nucleus extract) of KSHV-infected cells to bind ORF50P (Fig. 6D). Nuclear extracts from KSHV-infected cells (obtained 6 h PI) had a strong ORF50P probe-protein complex band (Fig. 6D, lane 2). This ORF50P probe-protein complex band was specifically supershifted when incubated with antibodies to Egr-1 (Fig. 6D, lanes 4–6) compared with nonspecific IgGs (Fig. 6D, lane 3). There was a dose response in supershift with increasing concentrations of the antibodies to Egr-1 (Fig. 6D, lanes 4–6). Also, there was no binding of the Egr-1 protein to the ORF50P(m) probe, which has a mutation in the putative Egr-1 binding site (Fig. 6D, lane 7), further demonstrating the specificity of this interaction. The above results confirm the ability of Egr-1 to specifically bind ORF50P.

To further authenticate the role of gB in inhibiting Egr-1-mediated transcription of ORF50, transient transfection assays were performed. We observed an enhanced ORF50P (nucleotides 68,509–71,593) activity (as measured by the luciferase activity) when the cells were transfected with plasmid encoding Egr-1 (egr-1/pCDNA3.1) compared with an empty vector (pCDNA3.1) or gL/pCDNA3.1 (Fig. 6E). However, incubating the above cells with 30% gB+ effector cells (Fig. 6E) or 30% gB-RGA effector cells (data not shown) led to a dramatic reduction in Egr-1-mediated ORF50P activity. We also observed a similar response in ORF50P (nucleotides 68,674–71,596) (44) activity due to endogenously overexpressing Egr-1 (data not shown). Taken together, these results further implicate a role for Egr-1 in gB-mediated repression of ORF50 expression (promoting virus latency).