Cell Surface of Lactococcus lactis Is Covered by a Protective Polysaccharide Pellicle^*

Bacterial Strains and Growth Conditions

Bacterial strains used in this study are listed in Table 1. L. lactis was grown at 30 °C in M17 medium (BD Biosciences) supplemented with 0.5% glucose (GM17). For long-chain mutant selection, overnight cultures were diluted and inoculated into 40-ml flasks of GM17 medium, containing 0.03% of agar (Difco), to produce ∼10–50 colonies per flask and incubated for 12 days. The nonsedimenting mutants were then removed from the top of the colonies and purified by re-streaking to single colonies, and the ability to form chains was observed microscopically.

Mapping of Mutations in a Polysaccharide Synthesis Gene Cluster in MG1363 Chromosome

Two parts of the 24.27-kb cluster of the VES5748 chromosome were PCR-amplified using two couples of primers: rpmB (5′-TAGACATTATATTTACCTCCC), rgpF (5′-AGTATCATTCATAATTGTCACC) and rgpeF (5′-AAAGTGATACATCCCTTAGG); and 229 (5′- GAATTTGATTGATTACTTTAGG) and the Expand Long Template PCR System (Roche Diagnostics) according to manufacturer's instructions. The DNA nucleotide sequence of the amplified fragments (11.8 and 12.7 kb, respectively) was determined by GATC Biotech AG, using several internal primers, located approximately every 600 bp. Comparison of the obtained DNA sequence with the corresponding one of the MG1363 genome sequence (9) allowed the identification of a mutation in the llmg_0226 gene. To map other mutations, a 3175-bp fragment containing llmg_0226 gene was amplified by PCR with Phusion TM DNA Polymerase (Ozyme), using primers 226 (5′-GTTACTTCTTCAGGAGATCC) and 229. The DNA sequence of the obtained fragments was determined by using internal primers.

Microscopy

Microscopy images were taken with a phase contrast microscope (Leica Microsystems) equipped with an image analysis system Induscam (Andersa). Transmission electron microscopy was performed as described previously (10).

AFM Imaging

AFM images were obtained in acetate buffer, at room temperature, using a Nanoscope IV Multimode AFM and MCST tips (Veeco Metrology Group). Cells were immobilized by mechanical trapping into porous polycarbonate membranes (Millipore) with a pore size similar to the bacterial cell size. After filtering a concentrated cell suspension, the filter was gently rinsed with the adapted buffer, carefully cut (1 × 1 cm), and attached to a steel sample puck (Veeco Metrology Group) using a small piece of double-face adhesive tape, and the mounted sample was transferred into the AFM liquid cell while avoiding dewetting (11).

Polysaccharide Preparation and Structural Analysis

Bacterial cells were collected by centrifugation and washed with 20 mm ammonium acetate buffer, pH 4.7 (12). Cell wall PS were then prepared using a method developed previously (13). Bacteria were suspended in 4% SDS in ammonium acetate buffer and boiled with intensive stirring for 1 h. Cells were collected by centrifugation, and the pellet was washed six times with ammonium acetate buffer to remove SDS and stirred with 5% trichloroacetic acid in the presence of glass beads for 48 h at 4 °C. Insoluble material was removed by centrifugation (12,000 × g, 10 min), and the supernatant was dialyzed and freeze-dried. The resulting product was further purified on a Sephadex G-50 column. The major fraction, positive for neutral sugars, amino sugars, and phosphate (average yield ∼12 mg/liter of culture), was used for further chemical analysis and NMR analysis.

For the estimation of relative quantities of PS in L. lactis MG1363 and its mutant VES5748, cells were washed with buffer and freeze-dried. Equal amounts (200 mg) of dry WT and mutant cells were treated with SDS and trichloroacetic acid as described above, and after dialysis of trichloroacetic acid, 1 μm inositol was added to each preparation. The lyophilized product was depolymerized with 48% hydrofluoric acid (Acros Organic) for 48 h at 4 °C, hydrolyzed with 4 m trifluoroacetic acid for 3 h at 110 °C, converted into alditol acetates by conventional methods, and analyzed by gas chromatography.

For the preparation of oligosaccharides OS1, OS2, and OS3, PS (20 mg) was treated with 48% hydrofluoric acid (10 °C, 48 h), dried under a stream of air, and reduced with NaBH₄. The resulting mixture of oligosaccharides was separated by high-performance anion-exchange chromatography, to give the reduced hexasaccharide OS1 as a major product.

General and Analytical Methods

Monosaccharides were identified as alditol acetates by gas chromatography on a Shimatzu GC-14 gas chromatograph equipped with a flame ionization detector and a Zebron ZB-5 capillary column (30 m × 0.25 mm), with hydrogen as carrier gas, using the following temperature gradient: 170 °C (3 min) and 260 °C at 5 °C/min. Gel permeation chromatography was carried out on a Sephadex G-50 column (1.6 × 90 cm) and irrigated with water. Fractions (5 ml) were assayed colorimetrically for aldose (14), amino sugars (15), and phosphate (16).

High-performance anion-exchange chromatography was performed on a CarboPac PA1 column (9 × 250 mm) with pulsed amperometric detection, with an isocratic flow of 0.1% NaOH. Fractions were collected and analyzed using Dionex system with an analytical CarboPac PA1 column (4 × 250 mm) at 1 ml/min. Products were desalted on a Sephadex G-15 column.

¹H and ¹³C NMR spectra were recorded using a Varian Inova 500 MHz spectrometer for samples in D₂O at 45 °C with acetone internal reference (δ_H = 2.23 ppm and δ_C = 31.5 ppm), using standard pulse sequences DQCOSY, TOCSY (mixing time 120 ms), nuclear Overhauser effect spectroscopy (mixing time 400 ms), and HSQC and HMBC (100-ms long range transfer delay). ¹H-³¹P HMQC and HMQC-TOCSY were run with ¹H-³¹P coupling set to 11 Hz, TOCSY mixing time of 100 ms.

L. lactis Phagocytosis Assay

Bacteria were grown to stationary phase (16–18 h; 1 × 10⁹ colony-forming unit/ml) in GM17 at 37 °C without shaking. Bacterial cells were harvested by centrifugation at 3000 × g for 5 min and washed twice in phosphate-buffered saline solution before resuspension in RPMI 1640 medium (Invitrogen) to a final density of 1 × 10⁹ colony-forming units/ml. The murine macrophage cell lines RAW 264.7 and J774 were propagated in RPMI 1640 medium supplemented with 10% fetal bovine serum (Invitrogen) in the presence of penicillin and streptomycin. Infections were performed at a multiplicity of infection of 20:1 by centrifuging bacteria onto macrophages at 500 × g for 5 min. The plates were then incubated for 30 min at 37 °C under 10% CO₂ atmosphere. Macrophages were extensively washed with RPMI 1640 medium and incubated for an additional hour in medium supplemented with 100 mg/ml streptomycin and 100 units/ml penicillin to kill extracellular bacteria. To monitor L. lactis phagocytosis, macrophages were washed with phosphate-buffered saline and lysed with 0.1% Triton X-100 in H₂O. Serial dilution were immediately plated on M17-Glc agar plates for colony count.

For microscopic observation, macrophages cultivated on glass coverslips were infected as described above and extensively washed with phosphate-buffered saline. Monolayers were washed three times with phosphate-buffered saline, fixed with MeOH 100% for 2 min, and colored with May-Grünwald stain (Sigma). Specimens were observed with a Nikon Eclipse E600 microscope equipped with a Nikon DXM1200 FCCD camera.

Isolation of Spontaneous Mutations in the Chromosomal Gene Cluster, Encoding Polysaccharide Biosynthesis of L. lactis

To isolate long-chain L. lactis mutants as nonsedimenting derivatives, semi-liquid growth conditions were used (17, 18). Long-chain derivatives of L. lactis MG1363 (Fig. 1A), exemplified here by mutant strains VES5748 and VES5751 (Fig. 1, B and C), were obtained in these conditions. In most cases, lactococci form long chains when cell separation is affected by reduced activity of autolytic enzymes (17, 19) or by increased PG resistance to hydrolysis (20, 21). Surprisingly, the activity of the main lactococcal autolysin AcmA was unaffected in more than 100 of such mutants (data not shown), albeit the long-chain phenotype of the acmA mutant allows us to expect the isolation of such mutants in the screen that we used (19).

After different phenotypical tests, we found that part of these mutants appeared to be resistant to the lactococcal virulent small isometric headed phage sk1, specific to MG1363 (22). The phage resistance phenotype was due to a phage adsorption defect and not to an inhibition of intracellular development (data not shown). It was previously established that genes important for the adsorption of phages belonging to this group are located within a 24.2-kb chromosomal gene cluster, which is putatively involved in cell wall polysaccharide (PS) biosynthesis in L. lactis strain IL1403 (5). We therefore determined the nucleotide sequence of the corresponding cluster in one of the mutants, VES5748 (Table 1), and found that it carries a C to T transition in the llmg_0226 gene (gene annotation as in Ref. 9), resulting in the appearance of a stop codon. Other long-chain sk1-resistant (sk1-r) mutants carried point mutations or insertions of IS981 in llmg_0226, probably because of the intrachromosomal transposition event. Similar mutants were also isolated based on phage sk1 resistance. In total, 20 sk1-r long-chain derivatives were selected, all of which carried mutations in the gene llmg_0226 (4 point mutations and 16 IS insertions). Although gene cluster, harboring all isolated mutations, putatively encodes cell wall PS (23), this compound was never isolated or characterized.

Isolation and Structural Characterization of the Cell Wall Polysaccharide of L. lactis

To gain further molecular insights into the PS produced by WT L. lactis MG1363, the carbohydrate-containing polymers of its cell wall were analyzed. The cell wall PS was prepared by trichloroacetic acid extraction, followed by purification by gel filtration chromatography. The purified material was positive in colorimetric reactions for neutral sugars, amino sugars, and phosphate. Monosaccharide analysis revealed the presence of Rha, Glc, Gal, and GlcN in an approximate molar ratio of 0.8:2:1.4:2.

NMR analysis of the preparation indicated a homogeneous phosphate-containing PS. To elucidate its detailed chemical structure, the ¹H and ¹³C spectra of the PS were fully assigned using two-dimensional homo- and heteronuclear correlation techniques (Table 2 and Fig. 2A). The structure of the PS is schematically shown in Fig. 3. The PS is composed of the hexasaccharide repeating units, containing two Glc (A and C), two GlcNAc (E and F), one Rha (D), and one Galf (B) residues, linked via a phosphodiester bond (Table 2 and Fig. 2A and Fig. 3). To confirm this structure, the PS was depolymerized with hydrofluoric acid and reduced, and the generated oligosaccharide fragments were purified by preparative high-performance anion-exchange chromatography and analyzed by two-dimensional NMR. One main product, the hexasaccharide OS1, was formed by cleavage of the phosphodiester bonds; two other oligosaccharides were produced by additional cleavage of galactofuranosyl (OS2) or rhamnosyl (OS3) linkages (Fig. 3). ¹H and ¹³C NMR spectra of all oligosaccharides were fully assigned (Table 2; Fig. 2B, and data not shown). Altogether, our data unambiguously establish the structure of the PS of L. lactis MG1363 as presented in Fig. 3.

To confirm that llmg_0226 mutation in sk1-r long-chain derivatives indeed affected the PS biosynthesis, the quantities of PS synthesized by MG1363 and VES5748 mutant were compared. The relative quantities of Glc and GlcNAc, which are characteristic for the PS of L. lactis MG1363, were measured using gas chromatography analysis with inositol as internal standard. We found that the VES5748 mutant contained about 20-fold less Glc per mg of dry cells than MG1363, and no detectable GlcNAc. We therefore conclude that the VES5748 mutant lacks the PS that is present in the wild type L. lactis MG1363.

Detection of an Outer Polysaccharide Pellicle by Transmission Electron Microscopy (TEM) and AFM

We chose two long-chain mutants VES5748 and VES5751 (Table 1) for microscopy studies. As observed from TEM micrographs, an outer pellicle is present in WT L. lactis MG1363 (Fig. 1D), which is absent in the two long-chain mutants (Fig. 1, E and F). This pellicle is clearly visible around the cells and intercalated between the peptidoglycan of two dividing cells (Fig. 1D). We therefore conclude that WT lactococci contain an outer layer made of PS.

Because TEM micrographs could be biased by the fixation and staining procedures, the presence of the polysaccharide pellicle was examined by live cell AFM imaging (24), a microscopy technique that was reportedly used for EPS and CPS visualization (25, 26). For this purpose, living bacterial cells were immobilized in porous membranes for noninvasive imaging. Fig. 4 shows AFM deflection images of single L. lactis NZ3900 (WT) and VES5748 mutant cells. The surface of WT cells showed well defined division septum and ring-like structures presumably reflecting “equatorial rings” of newly synthesized PG (27). Besides these structures, the cell surface was featureless and very smooth, the root mean square roughness (R_r.m.s.) on 200 × 200 nm height images being 0.6 ± 0.1 nm. By contrast, mutant VES5748 exhibited a much rougher surface, with an R_r.m.s. of 2.9 ± 0.7 nm. The rough surface may reflect another cell wall constituent, such as peptidoglycan, lying underneath the pellicle. The increased surface roughness in PS-negative mutants correlates with TEM observations revealing that mutations lead to the disappearance of an outer layer.

Antiphagocytic Properties of the L. lactis Polysaccharide Pellicle

The CPS of Gram-positive pathogens play important roles during bacterial infection and survival in the blood stream and thus affect their virulence (3). In these bacteria, the presence of a capsule is often associated with antiphagocytic properties (28). We hypothesized that the outer PS pellicle of L. lactis MG1363 could display a similar property. A murine macrophage phagocytosis assay, which is routinely used for pathogenic bacteria, was thus performed using lactococcal cells (29, 30). The obtained results showed that PS-negative bacteria (strain VES5748) are more efficiently trapped inside the murine phagocyte lines RAW 264.7 and J774 than the WT strain (Fig. 5). The yield of internalized mutant bacteria was about 10-fold higher than that of WT, indicating a capacity of the lactococcal PS pellicle (PSP) to provide antiphagocytic properties (Fig. 5). Analysis of phagocyte micrographs confirmed the increased susceptibility of the PS-negative mutant to phagocytosis by showing large clusters of bacteria accumulating inside macrophages, whereas WT bacteria were essentially located at the macrophage surface (Fig. 5, A and B). Similar results were obtained using different bacteria/macrophage ratios (data not shown). These results indicate that the PSP can protect L. lactis against host phagocytosis by macrophages and in this way plays, at least in vitro, a role similar to CPS of pathogenic bacteria.