A Human Cytomegalovirus gO-Null Mutant Fails To Incorporate gH/gL into the Virion Envelope and Is Unable To Enter Fibroblasts and Epithelial and Endothelial Cells^▿

Cells and viruses.

MRC-5 fibroblasts were obtained from the American Type Culture Collection (ATCC CCL-171), neonatal normal human dermal fibroblasts (NHDF) were obtained from Cascade Biologics (Portland, OR), and they were grown in minimum essential medium (MEM; Invitrogen) and Dulbecco's minimum essential medium (DMEM, Invitrogen), respectively, that was supplemented with 5% fetal bovine serum (FBS; HyClone) and 5% bovine growth supplement (BGS; HyClone). The retinal pigment epithelial cell line ARPE-19 was obtained from the ATCC and was grown in a 1:1 dilution mix of DMEM and Ham's F-12 medium (Invitrogen) supplemented with 10% FBS. Human papillomavirus (HPV) E6/E7-transformed aortic endothelial cells (HPV-AEC) were provided by Ashlee Moses (Oregon Health & Science University) and were grown in Medium 200 (Cascade M-200-500) supplemented with a low-serum-growth supplement (Cascade). HCMV strain TR was derived from the ocular vitreous fluid sample from an AIDS patient (45) and was stabilized in the form of a bacterial artificial chromosome (BAC) (34). Wild-type TR was propagated on NHDF cells by infection at a multiplicity of less than 0.1 in DMEM plus 5% FBS for 10 to 16 days. Virus particles were concentrated from infected cell supernatants by centrifugation at 50,000 × g for 1 h through a 20% sorbitol cushion.

Construction of recombinant HCMV TRΔgO.

The UL74 gene of BAC-TR was mutated by using lambda phage linear recombination as previously described (5, 29, 51). Briefly, a 1.5-kb PCR product containing a kanamycin resistance (Kan^r) gene cassette flanked by Flp recombination target (FRT) sites and with HCMV sequences near the 5′ end of the UL74 gene (60 nucleotides [nt], corresponding to nt 144593 to 144534 of the published TR sequence; GenBank accession no. AC146906) and sequences near the 3′ end of the UL74 gene (61 nt, corresponding to nt 143393 to 143333) was generated with the following primers using a PCR template from pCP015: GTACACGCAGGCAAGCCAAACCACAAGGCAGACGGACGGTGCGGGGTCTCCTCCTCTGTCGTAAAACGACGGCCAGT and TAGGTGTAGTTTCGGAAGCCGTTTTGTTTTCCACGAACATGGTTTCGTTGTAATATAAGGATTACAGGAAACAGCTATGAC (11). Following transformation of EL250 bacteria containing BAC-TR with the Kan^r PCR product, bacteria were selected for growth on kanamycin. Kan^r clones were analyzed by Southern blot analyses using probes specific for the UL74 gene and for the Kan^r sequences following EcoRI restriction. Clones were also confirmed by direct DNA sequence analysis. The Kan^r cassette was removed from BAC-TRΔgO Kan^r clones by inducing Flp recombinase expression in EL250 host bacteria (29). Colonies were replica plated on chloramphenicol- and kanamycin-containing plates to screen for BAC lacking Kan^r sequences, and clones were confirmed by Southern blotting. Infectious HCMV TRΔgO was derived by electroporation of BAC DNA (2 μg) into MRC-5 cells (5 × 10⁶ cells). Following electroporation, the MRC-5 cells were washed, plated in 100-mm dishes in DMEM containing 10% serum, and allowed to spread on the plastic, and fresh medium was added after 24 h. When these cells became confluent, the cells were trypsinized and replated at a lower cell density, until TRΔgO produced a cytopathic effect (CPE) in ∼20% of the cells after 42 days.

Production of TRΔgO virus stocks and PEG treatment to enhance entry.

Initially, TRΔgO was propagated using BAC-TRΔgO-transfected MRC-5 cells by trypsinizing the cells and plating infected cells with other, uninfected MRC-5 cells. Cell culture supernatants were harvested, and viruses were concentrated either by centrifugation at 50,000 × g for 1 h or through 20% sorbitol at 50,000 × g for 1 h. Later, TRΔgO virus stocks were produced using NHDF infected with extracellular TRΔgO virus particles by enhancing virus entry using a combination of low-speed centrifugation and PEG treatment. Briefly, cells and virus were mixed and immediately centrifuged at 800 × g for 1 h at 15°C. Cells were washed once with warm phosphate-buffered saline (PBS), then treated with 44% (wt/wt) PEG (Fluka) in PBS at 37°C for 30 s, and then washed immediately four times with warm PBS.

Quantitative PCR (qPCR) of HCMV DNA.

Cell culture supernatants from HCMV-infected cells were treated with DNase I (Roche) to remove any DNA not protected within viral capsids. Capsids were disrupted by using the detergents and proteinase K in the QIAamp MinElute virus spin kit (Qiagen). DNA was resuspended in 50 μl nuclease-free water, and genomes were quantified by real-time qPCR using the following UL115 primers and TaqMan probes (Applied Biosystems): forward primer, GTAGCCATAACCTGTCAATCATCCTGTA; reverse primer, GTATTGTAGCGTGTAATTTAGGTTGCACT; and probe, 6-carboxyflu-orescein-TTGCGGTGGATGAAGAAGAGCCAGAACTG. PCR samples were made to a total volume of 25 μl with a 2× TaqMan Universal PCR master mix (Applied Biosystems), 10 μl of 1:100, 1:1,000, or 1:10,000 dilutions of cDNA, 600 nM forward and reverse primers, 150 nM probe, and nuclease-free water. Sequences were detected using an ABI Prism 7700 sequence detection system. Samples were compared to a plasmid pcDNA3.1(+)gLSP standard.

Antibodies.

Mouse monoclonal antibodies (MAb) specific for the HCMV major capsid protein (28-4), tegument protein pp65 (28-19), and glycoproteins gB (27-156) and gN (14-16A) were kindly provided by Bill Britt (University of Alabama, Birmingham, AL) (7, 8, 10). Rabbit polyclonal anti-IE86 antibody (R683) has been described previously (25). Rabbit polyclonal antisera directed against HCMV gH, gL, and UL130 were previously described (41). Polyclonal antisera directed against a peptide (KRKQAPVKEQSEKKSKKSC) derived from HCMV TR gO was produced by coupling the peptide to keyhole limpet hemocyanin using m-maleimidobenzoyl-N-hydroxysuccinimide ester (Sigma, St. Louis, MO) and by vaccinating rabbits as described previously (41).

Immunofluorescence.

HCMV-infected cells were fixed with a 50:50 dilution of methanol-acetone for 10 min, washed three times with phosphate-buffered saline (PBS), and then permeabilized using IF buffer (0.5% Triton X-100, 0.5% deoxycholate, 1% bovine serum albumin [BSA], 0.05% sodium azide in PBS). The cells were stained with anti-IE86 rabbit sera diluted in IF buffer, washed with IF buffer, and then incubated with Alexa 594-conjugated goat anti-rabbit secondary antibody obtained from Molecular Probes (Eugene, OR). In some experiments, cells were also stained with Syto 13 green fluorescent nucleic acid stain (Invitrogen) in PBS for 10 min. The cells were analyzed using a Nikon Eclipse TS100 fluorescent microscope.

HCMV cell-to-cell spread assay.

NHDF, MRC-5, and ARPE-19 cells were grown to near confluence and infected with 100 to 200 PFU of wild-type TR or TRΔgO using centrifugation (800 × g for 1 h at 15°C) and PEG treatment. Cells were maintained in media containing 0.3% pooled human immunoglobulin (a source of HCMV neutralizing antibodies) for 10 and 20 days and then fixed and analyzed by immunofluorescence for IE86.

HCMV release assay.

NHDF cultured in 12-well dishes (Falcon) were infected with wild-type TR and TRΔgO using doses of virus that resulted in 20% infection by using PEG treatment. Cell culture medium was changed 1 day postinfection with 1 ml fresh DMEM containing 10% serum. Cell culture supernatants were collected after 2, 4, 6, and 8 days. Cell debris was removed from supernatants by centrifugation at 20,000 × g for 10 min. A total of 200 μl of each sample was DNase I treated, and then viral DNA was subsequently harvested with the QIAamp MinElute virus spin kit (Qiagen). Genomes were measured by qPCR (as described above). At these same times, the cells were fixed and analyzed by immunofluorescence for IE86 expression.

Immunoblotting.

Cell culture supernatants derived from HCMV-infected cells were clarified by centrifugation at 6,000 × g for 15 min, and then virus particles were pelleted at 50,000 × g for 1 h through 20% sorbitol cushions (40). Virus pellets or HCMV-infected cells were lysed in 50 mM Tris-HCl buffer, pH 6.8, containing 2% sodium dodecyl sulfate (SDS) and 2% β-mercaptoethanol, and then proteins were separated using SDS-polyacrylamide gels. Proteins were electrophoretically transferred to Immobilon membranes (Millipore) in a buffer containing 25 mM Tris, 192 mM glycine, and 20% methanol. HCMV proteins were detected with rabbit polyclonal antibodies or MAb, followed by horseradish peroxidase-conjugated secondary antibodies, and chemiluminescence imaging as described previously (23, 50).

Electron microscopy.

NHDF were infected with wild-type TR or TRΔgO by using centrifugation and PEG enhancement. After 7 days, the cells were washed with 0.1 M sodium cacodylate buffer, pH 7.2, and fixed in Ito and Karnovsky's fixative (1.6% paraformaldehyde, 2.5% glutaraldehyde, and 0.5% picric acid in 0.1 M sodium cacodylate; pH 7.2) for 30 min at 23°C. The samples were postfixed in 1.5% osmium tetroxide, rinsed, postfixed in 4% paraformaldehyde, dehydrated in a graded acetone series, and embedded in epoxy resin, and ultrathin sections were double stained in uranyl acetate and lead citrate and viewed with a Philips EM 300 electron microscope.

Construction of a HCMV TR mutant unable to express gO.

The previous evidence that HCMV gH/gL/UL128-131 promotes virus entry (40) suggested the possibility that gH/gL/gO might also participate in entry. This point has not been studied for any HCMV strain, neither AD169 nor the endotheliotropic TB40/E strain (26). We routinely use HCMV strain TR, which can infect fibroblasts and epithelial and endothelial cells well (34, 40, 45). To construct a gO-null mutant, a BAC containing TR sequences was used in conjunction with homologous recombination targeting the UL74 (gO) gene, as described previously (5, 40). First, the N-terminal 1,141 nucleotides of the UL74 (gO) gene beginning with the start codon were replaced with a kanamycin resistance (Kan^r) cassette flanked by FRT sites (Fig. 1A). The gO sequences targeted were carefully designed to avoid disruption of the promoters and polyadenylation sites for flanking genes (gH and gN). Bacterial clones were selected for resistance to kanamycin, and then the Kan^r cassette was removed by induction of Flp recombinase. Southern blot analysis revealed that the Kan^r cassette replaced the UL74 gene in two BAC-TRΔgO Kan^r clones, clones 2 and 3, and the Kan^r cassette was removed in BAC-TRΔgO clones 2.1 and 3.1 (Fig. 1B).

BAC-TRΔgO clones 2.1 and 3.1 were separately introduced into MRC-5 fibroblasts using electroporation. After 5 days, there was a visible cytopathic effect (CPE) in a small number of cells, and there was limited virus spread of both TRΔgO clones over the subsequent 5 to 7 days. This spread of the CPE was substantially (2 to 10%) less than that found in other dishes of MRC-5 cells that had been transfected with BAC-TR (wild type). Since the majority of MRC-5 cells transfected with both clones of BAC-TRΔgO did not display a CPE, we replated these cells with other, uninfected MRC-5 cells for several rounds to amplify virus. Over the course of 6 weeks, infections with both clones spread to ∼20% of the cells. Other attempts to transfect BAC-TRΔgO using NHDF (foreskin) produced virus, but the CPE was observed even later. Virus derived from one of these BAC clones, BAC-TRΔgO clone 3.1, was denoted HCMV TRΔgO and studied further by Western blot analysis and most other analyses. However, a second virus derived from BAC-TRΔgO clone 2.1 was also characterized in a more limited number of experiments described below. TRΔgO expressed gB, gH, gL, and gN, but not gO (Fig. 1C). There were reduced quantities of all HCMV proteins in TRΔgO-infected fibroblasts compared with those of wild-type TR, but these reductions in HCMV proteins were in line with reduced numbers of infected cells (not shown). Importantly, the reduced expression of gH and gN could be explained by these reduced numbers of cells and was similar to expression of gB, demonstrating that the adjacent (UL73 and UL75) genes were not negatively affected by mutation of the gO (UL74) gene.

TRΔgO particles are defective for entry into human fibroblasts.

We attempted to characterize the entry of TRΔgO virus particles into fibroblasts by using particles derived from cell culture supernatants. Because infection and spread of TRΔgO in fibroblast monolayers were markedly reduced, compared with those of wild-type TR, many fewer cells were infected, and fewer virus particles were produced into cell culture supernatants. However, virus particles in supernatants could be concentrated by centrifugation and quantified by measuring HCMV DNA by quantitative PCR. Thus, by using the content of viral DNA, we could apply similar quantities of virus particles to cells. Wild-type TR and TRΔ131, a mutant unable to assemble gH/gL/UL128-131 complexes (41), were applied to NHDF, representing 1 PFU/cell of each virus. A similar quantity of TRΔgO particles (normalized using genome copies) was also incubated with fibroblasts. Infection of these fibroblasts was measured by staining cells using IE86-specific antibodies. Wild-type TR and TRΔ131 infected 78.4% and 52.6% of fibroblasts, respectively (Fig. 2). In contrast, we did not detect any IE86⁺ fibroblasts following inoculation with a comparable amount of TRΔgO particles (1× TRΔgO) (Fig. 2). When the TRΔgO inoculum was increased by 10-fold, we observed infection of 5 to 10 cells/well, representing 0.025 to 0.04% of the total cells in the dish (10× TRΔgO) (Fig. 2). Thus, extracellular TRΔgO virus particles cannot initiate infection of fibroblasts well. It is important to note that these infections involved extracellular TRΔgO particles and are different from our propagation of TRΔgO, which involved plating TRΔgO-infected fibroblasts with uninfected fibroblasts.

We previously showed that HCMV UL128-131 mutants failed to enter epithelial and endothelial cells, but this defect was reversed by treating cells and virus with the chemical fusogen PEG (40). PEG promotes entry of mutant viruses that are bound onto cell surfaces but unable to enter because the virus particles are blocked in the capacity to fuse with cellular membranes. Fibroblasts were inoculated with TRΔgO using quantities of virus particles corresponding to 1 PFU/cell of wild-type TR and then treated with PEG, and ∼7% of the cells were IE86⁺ (1× TRΔgO) (Fig. 2). Using 10-fold more TRΔgO and PEG, 26% of the fibroblasts expressed IE86 (10× TRΔgO) (Fig. 2). In separate experiments using concentrated stocks of TRΔgO, we were able to obtain 5 to 40% infection of fibroblasts using PEG treatment (not shown). Therefore, the markedly enhanced expression of IE86 following PEG treatment demonstrated that TRΔgO was severely defective for entry into human fibroblasts. However, the low levels of infection observed even with 10-fold more TRΔgO virions and PEG treatment suggested that many of the TRΔgO particles were defective in processes that preceded or followed fusion. This phenotype was different from that of the UL128-131 mutants (41).

A very similar phenotype was observed with HCMV derived from the second BAC clone, BAC-TRΔgO clone 2.1, described above, i.e., very few or no IE86⁺ fibroblasts were detected without PEG, and 5 to 40% IE86⁺ cells were detected with PEG (not shown). This provided evidence that this phenotype was not due to secondary mutations.

TRΔgO particles are defective for entry into epithelial and endothelial cells.

Our model suggested that gH/gL/gO might mediate infection of fibroblasts (12, 40). To test this model, we investigated whether TRΔgO could enter ARPE-19 retinal epithelial cells. Infection of ARPE-19 cells requires higher inputs of HCMV (12, 40), and consequently, cells were infected using 10 PFU/cell of wild-type TR and an equal quantity of TRΔgO particles (based on the quantities of viral DNA). All the epithelial cells were infected with wild-type TR (Fig. 3). In contrast, very few of the ARPE-19 cells were infected with TRΔgO. In this particular experiment, no IE86⁺ cells were detected in several wells infected with TRΔgO, although in other experiments, 1 to 10 IE86⁺ cells per well (0.005 to 0.04% of the cells) were detected. PEG treatment increased the number of IE86⁺ epithelial cells infected by TRΔgO to 7% (Fig. 3).

To determine whether TRΔgO could infect endothelial cells, HPV E6/E7-transformed aortic endothelial cells (HPV-AEC) were also infected with wild-type TR, TRΔ131, or TRΔgO. Again, similar quantities of TRΔgO particles were applied to cells using PCR to quantify viral genomes in preparations of supernatant virus particles. Wild-type TR infected 54.7% of the endothelial cells using 1 PFU/cell, whereas no cells were infected with either TRΔgO or TRΔ131 at this dose of virus (Fig. 4). Using 10-fold more TRΔgO (10× TRΔgO) (Fig. 4), less than 0.1% of the endothelial cells were infected in this experiment (Fig. 4), and no cells were infected in other experiments (not shown). PEG treatment increased TRΔ131 infection at the lower dose of virus (1 PFU/cell) to 43.3%. TRΔgO at the lower dose (1× TRΔgO) infected ∼1% of endothelial cells following PEG treatment, and 10-fold more TRΔgO particles infected 4.8% of the cells (10× TRΔgO) (Fig. 4). These observations suggested that TR gO is important for HCMV entry into both epithelial and endothelial cells. This conclusion was surprising given our model that showed gH/gL/gO functions primarily in fibroblasts and not in epithelial and endothelial cells. However, in contrast to TRΔ131, there were defects beyond entry fusion, because PEG enhancement did not restore infection to wild-type levels.

TRΔgO cell-to-cell spread.

Cell-to-cell spread of TRΔgO between fibroblasts and between epithelial cells was measured by using PEG to enhance virus entry into cells and then monitoring infected cells for IE86 expression over 20 days. TRΔgO produced plaques on NHDF and MRC-5 fibroblasts that included reduced numbers of infected cells per plaque, as follows: 40 to 65% infected compared with the numbers of infected cells per wild-type TR plaques (Fig. 5). In contrast, on ARPE-19 epithelial cells, TRΔgO formed larger plaques that included 350 to 440% of the number of infected cells per plaque compared with that per wild-type TR plaque (Fig. 5). We were unable to obtain plaques with several types of endothelial cells, as the cells did not remain attached to plastic dishes over the course of these long experiments. Given previous results (14, 19, 26), it was not unexpected that TRΔgO spread poorly on fibroblasts However, it was surprising that TRΔgO can spread between epithelial cells better than wild-type TR, especially given that the mutant largely failed to enter these epithelial cells as cell-free virus.

Quantification of TRΔgO virus particles in cell culture supernatants.

To determine whether the defects in TRΔgO virus particle entry and subsequent IE86 expression might be related to defects in assembly or release of virus particles, we quantified the numbers of viral genomes in cell culture supernatants. From the studies described above, it was clear that some TRΔgO particles were released from cells, and it was possible to concentrate these particles and enhance their entry by using PEG. However, these studies did not compare the numbers of particles released. In one set of experiments designed to quantify the numbers of particles present in cell culture supernatants, MRC-5 cells that had been transfected with BAC-TRΔgO or BAC-TR were trypsinized and plated with uninfected MRC-5. After two rounds of expansion of TRΔgO-infected fibroblasts, the numbers of infected cells were measured by IE86⁺ staining. In the experiment shown in Fig. 6A, ∼10% of the MRC-5 cells were infected with TRΔgO, and 100% of the cells were infected with wild-type TR. Cell culture supernatants were harvested from these cells, and following DNase treatment to remove DNA not protected by capsids, HCMV DNA was measured by quantitative PCR. In line with the numbers of infected cells, there was also ∼10% of the number of TRΔgO genomes compared with the number of wild-type TR genomes in these supernatants (Fig. 6A). To further determine whether there were defects in assembly or egress of HCMV with loss of gO, we attempted to increase the number of TRΔgO-infected cells by concentrating TRΔgO extracellular particles and used these in conjunction with PEG to enhance entry into cells. We also used fewer wild-type TR virions, so that after 2 days, ∼20% of the fibroblasts were infected by both TRΔgO and wild-type TR, as assessed by staining with IE86-specific antibodies. Cell culture supernatants were harvested after various times, and the quantities of HCMV genomes were measured by quantitative PCR. Given that there were higher input doses of TRΔgO particles, we observed larger quantities of extracellular virus particles (genomes) in TRΔgO supernatants after day 2 (Fig. 6B). This was related to the larger quantities of TRΔgO particles that stuck on cell surfaces (resisting washes) but failed to enter even with PEG enhancement. However, by day 8, differences between the amounts of viral DNA in cell culture supernatants comparing TRΔgO and wild-type TR narrowed so that there were comparable amounts of wild-type TR and TRΔgO DNA in supernatants. We concluded that TRΔgO assembles particles and that these particles are released into cell culture supernatants in relatively normal numbers.

Electron microscopic analyses of TRΔgO-infected fibroblasts.

To further examine TRΔgO assembly and egress, we infected fibroblasts with wild-type TR or TRΔgO using PEG enhancement. Only 10 to 20% of the cells were infected with TRΔgO, whereas all cells were infected with wild-type TR. We harvested infected cells after 7 days and then fixed and stained the cells for electron microscopy. Enveloped virions were observed in the cytoplasm and on the surfaces of both wild-type TR- and TRΔgO-infected NHDF (Fig. 7). Due to the differences in the numbers of infected cells, it was difficult to compare (count) the absolute numbers of enveloped virions. However, among the TRΔgO-infected cells, cells that possessed capsids in the nucleus, there was no apparent reduction in the numbers of enveloped versus unenveloped capsids in the cytoplasm, and numerous TRΔgO virus particles were observed on cell surfaces. Together with the results described above involving quantification of viral DNA (Fig. 6), we concluded that TR gO is not required for assembly of enveloped virions or egress to cell surfaces.

Loss of gO reduces incorporation of gH/gL complexes into the virion envelope but increases quantities of UL130.

In the accompanying paper (42), we showed that gO promotes ER export of gH/gL. Thus, it was of special interest to determine whether loss of gO altered the quantities of the gH/gL complexes present in extracellular virus particles. Fibroblasts were infected with wild-type TR or TRΔgO using PEG enhancement, and cell culture supernatants were harvested and concentrated by pelleting the particles through 20% sorbitol cushions. Viral proteins in these particles were analyzed by Western blotting. Again, we attempted to equalize the quantities of wild-type TR versus those of TRΔgO particles by using quantitative PCR to determine virus genomes. Several of the major structural proteins of HCMV particles, including the major capsid protein (MCP), tegument protein pp65, and glycoproteins gB and gN, were present in wild-type TR particles, as expected (Fig. 8). TRΔgO exhibited reduced quantities of gB, MCP, and pp65, although these proteins were reduced by 2-fold or less, likely reflecting differences in measuring viral DNA and proteins (Fig. 8). gO was detected in TR-infected cells, but not in wild-type TR particles, consistent with observations in the accompanying paper (42). Surprisingly, TRΔgO virions contained little gH and gL, despite being present in infected cell lysates at a level comparable to that of gB (Fig. 1). In lighter exposures, no gH or gL was observed, but darker exposures revealed a small quantity of gH and gL in TRΔgO particles. Even taking into account the reduced quantities of gB and MCP in TRΔgO particles, we estimate that gH and gL were reduced by ∼90 to 95% in TRΔgO particles compared with those levels in TR particles. Despite this decreased quantity of gH/gL, UL130 was increased in TRΔgO virions by 2- to 3-fold compared with that in wild-type TR. These studies were further confirmation that virus particles were released from TRΔgO-infected cells. We concluded that loss of TR gO leads to the production of virions with much less gH/gL, although the small quantities of gH/gL that are present contain more UL130 and, likely, gH/gL/UL128-131.