Role of Scavenger Receptor Class B Type I in Hepatitis C Virus Entry: Kinetics and Molecular Determinants ^▿

Cell lines and antibodies.

Human hepatoma Huh-7.5, HEK-293, HEK-293T, and mouse neuronal N2a (ATCC) cells were grown in Dulbecco's modified essential medium (Invitrogen) supplemented with 10% fetal bovine serum.

Anti-SR-BI MAbs were generated and produced as previously described (15). Anti-SR-BI (ab396) polyclonal antibody was purchased from Abcam. Monoclonal anti-c-Myc or anti-V5 antibodies were obtained from Invitrogen. Anti-CD81 MAb was purchased from Santa Cruz Biotechnology (clone 1.3.3.22). Negative control mouse immunoglobulin G1 (IgG1) was obtained from Serotec, and matched isotype control human IgG was purchased from the Binding Site.

HCVcc production and synchronized infection.

In vitro-transcribed genomic J6/JFH RNA was delivered to Huh-7.5 cells by electroporation (34). Infectious HCV particles (HCVcc) were recovered 72 h postelectroporation, and the virus-containing supernatant was clarified by centrifugation and stored at −80°C. For synchronized infections, 10⁵ cells were seeded in poly-l-lysine-coated 24-well tissue culture plates 24 h prior to infection. Medium was changed to 4°C with or without antibody 1 h prior to infection, and cultures were placed at 4°C. Medium was then replaced with 250 μl HCVcc-containing supernatant with or without antibody (anti-CD81 was used at 2 μg/ml, and anti-SR-BI was used at 10 μg/ml) for 1.5 h, and cultures were again placed at 4°C. Cultures were washed twice with cold phosphate-buffered saline; fresh 37°C medium, with or without antibodies, was then added, and cultures were placed in 37°C tissue culture incubators. At various time points, antibodies were added to the medium. At 120 min after the shift to 37°C, the medium was changed to fresh medium without antibodies. RNA was extracted from cellular lysates 3 days postinfection, and the number of intracellular HCV genomes was determined by reverse transcription (RT)-quantitative PCR (qPCR). Briefly, we performed a 384-well plate-based assay and used 20 ng total RNA per well. To quantify HCV in RNA samples, the following oligonucleotides and probe were used: HCV sense primer GCGAAAGGCCTTGTGGTACT, HCV antisense primer CACGGTCTACGAGACCTCCC, and probe CCTGATAGGGTGCTTGCGAGTGCC (5′ 6-carboxyfluorescein-3′ 6-carboxytetramethylrhodamine. HCV copies were normalized to rRNA amounts by using a commercially available 18S rRNA mix (Applied Biosystems).

Cloning of SR-BI coding sequences.

Cloning strategies for human and mouse SR-BI were previously described (50). Tupaia SR-BI cDNA was obtained by RT-PCR (Superscript II kit; Invitrogen) of purified primary tupaia hepatocyte RNA (RNeasy; Qiagen) with human SR-BI-specific primers (forward primer 5′-ATG GGG CCC CAG GCG CGCAGA CAT GGG C-3′ and reverse primer 5′-AGC GGG GTG TAG GGG CTG GGGGGC CGG-3′). The PCR products from two independent reactions were cloned (pcRZero Blunt kit; Invitrogen) and sequenced. Full-length tupaia SR-BI cDNA was cloned into expression vector pcDNA3 (Invitrogen) (4). Tamarin SR-BI cDNA was obtained by RT-PCR (Superscript II; Invitrogen) of purified RNA from tamarin liver with SR-BI-specific primers taSenseATG (5′-GAC ATG GGC TGC TCC TCC AGA GCG CGC-3′) and tamAS230 (5′-TAG AAG GGG ATG GGG ATC TCC CG-3′). Full-length tamarin SR-BI cDNA was cloned into the vector pCR-Blunt II (Invitrogen), sequenced, and then cloned into the expression vector pcDNA3 by HindIII-XbaI digestion.

Production of sE2 glycoproteins.

Expression plasmids encoding HCV E2 (aa 384 to 661) protein genotype 1a (strain H77), 1b (strain BK), or 6 (isolate 6.540) and containing a His₆ tag were transfected into HEK-293T cells by using a calcium phosphate transfection kit (Clontech). At 48 h posttransfection, cell supernatants were clarified by centrifugation at 4,000 rpm for 30 min at 4°C and then concentrated 100-fold by using Centricon Plus 80 filters (Amicon) supplemented with 5% glycerol, 25 mM HEPES, and 1× protease inhibitors (Boehringer) and stored in aliquots at −80°C.

Mutagenesis of human SR-BI.

Twelve synthetic genes coding for SR-BI mutant receptors were generated by Geneart GmbH from synthetic oligonucleotides. The fragments were cloned into pcDNA3-human SR-BI using HindIII and SfiI restriction sites, and the final constructs were verified by sequencing. Wild-type SR-BI and E210A mutant receptors fused to either c-Myc or V5 tags were also generated by Geneart GmbH from synthetic oligonucleotides. The fragments were cloned into the pcDNA3 vector by using HindIII and XmaI restriction sites, and the final constructs were verified by sequencing.

Measurement of E2 and MAb binding to SR-BI and flow cytometric analysis.

A total of 4 × 10⁵ N2a cells were transfected with wild-type or mutant receptors by using Lipofectamine 2000 (Invitrogen). At 48 h posttransfection, cells were lysed in a solution containing 1% Triton X-100, 50 mM Tris-HCl (pH 8), and 150 mM NaCl in the presence of protease inhibitor cocktail (Roche). Cell lysates were analyzed by immunoblotting with an SR-BI rabbit antiserum (ab396; Abcam), probed with peroxidase-labeled anti-rabbit IgG (Pierce), and visualized by using an enhanced chemiluminescence system to confirm the expression of each mutant receptor. N2a cells were assayed 48 h posttransfection, and sE2 binding (genotype 1a, strain H77; genotype 1b, strain BK; or genotype 6, isolate 6.540) to SR-BI mutant receptors was measured by flow cytometry as previously described (47). A saturating amount of the soluble recombinant E2 glycoproteins was added to N2a cells transfected with the different SR-BI molecules for 1 h at room temperature, and binding was quantified by flow cytometry after incubation with anti-His mouse MAb (Qiagen) and anti-mouse IgG1-phycoerythrin (PE) (Serotec). As a control, an isotype-matched IgG was preincubated on cells before sE2 binding. Background was defined as the E2 binding to N2a cells transfected with empty vector. Mean fluorescence intensity (MFI) values subtracted of background MFI were expressed as a percentage of wild-type receptor binding after normalization for the expression level determined by Western blotting (WB).

Transfected N2a cells were also assayed for binding to MAb C11 and MAb C167 by flow cytometry. Forty-eight hours after transfection, MAbs (0.5 μg/ml) were added to cells for 45 min at room temperature in fluorescence-activated cell sorter (FACS) buffer. C11 and C167 binding was revealed by incubating cells with biotinylated anti-human IgG4 mouse MAb (BD Pharmingen) followed by streptavidin-PE (Serotec). As a control, isotype-matched human IgG4 was used, and the resulting MFI values were subtracted of MFI values obtained with anti-SR-BI MAbs. FACS acquisitions and analysis were performed by use of a FACSCalibur system (Becton Dickinson) and CellQuest software.

Immunoprecipitation of SR-BI oligomers.

HEK-293 cells were transiently transfected with expression plasmids encoding wild-type SR-BI fused to either c-Myc or V5 tags and a mutated (E210A) SR-BI construct fused to the c-Myc tag. Forty-eight hours posttransfection, 5 × 10⁶ cells were lysed in 1 ml of immunoprecipitation buffer (20 mM HEPES [pH 7.5], 1 mM EGTA [pH 8.0], 1 mM EDTA [pH 8.0], 150 mM NaCl, 1% Triton X-100, protease inhibitor cocktail). Lysates were incubated overnight with monoclonal anti-c-Myc or anti-V5 antibodies coupled to protein G-Sepharose 4 Fast Flow columns. After several washings, bound proteins were eluted and separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Protein blots were incubated with antibody to the alternative tag used for immunoprecipitation, probed with peroxidase-labeled anti-mouse IgG (Promega), and visualized by using an enhanced chemiluminescence system.

Generation of an SR-BI-negative Huh-7.5 cell line.

To generate the construct pLVTHM/shSR-BI, a short hairpin RNA (shRNA) duplex sequence (5′-CGCGTCCCCAGAGGCTCGTCAACAAGCATTCAAGAGATGCTTGTTGACGAGCCTCTTTTTTGGAAAT-3′) targeting the 3′ untranslated region of SR-BI mRNA was cloned into vector pLVTHM downstream of the H1 promoter. Lentiviral vectors pLVTHM, pLV-tTRKRAB-Red, pCMV-DR8.74, and pMD2G-VSVG were provided by D. Trono (Addgene) (61). For the production of the lentiviral particles, HEK-293T cells were cotransfected by calcium phosphate precipitation with pLVTHM/shSR-BI or pLV-tTRKRAB-Red, pCMV-DR8.74, and pMD2G-VSVG. Concentrated lentiviral stocks were obtained by ultracentrifugation through a 20% sucrose cushion. Huh-7.5 cells were cotransduced with two different lentiviruses carrying the transgenes pLVTHM/shSR-BI and pLV/tTRKRAB with a multiplicity of infection (MOI) of 50. Dually transduced Huh-7.5 cells were sorted by FACS (green fluorescent protein positive/dsRED positive) after 4 days of induction with 100 ng/ml doxycycline (Sigma) to generate Huh-7.5/shSR-BIkd cells.

Complementation of an SR-BI-negative Huh-7.5 cell line with wild-type and mutant SR-BI receptors and HCVcc infection.

cDNAs coding for human SR-BI, mouse SR-BI, the SW0 or E210A mutant, or empty vector were cloned into pTRIP lentiviral vectors and used to transduce Huh-7.5/shSR-BIkd cells. Cells were maintained in medium containing 100 ng/ml doxycycline for 96 h before transduction with SR-BI-expressing lentivirus. Four days after transduction, HCVcc was added to cells (about 0.1 MOI) for 6 h. Virus-containing medium was then removed and replaced with fresh medium containing doxycycline. The infection was allowed to occur for 32 h, RNA was then extracted, and the number of HCV copies in each well was evaluated by RT-qPCR.

HDL binding and cholesterol efflux assays.

HDL lipoproteins were isolated from plasma of fasting, healthy, normolipidemic individuals by sequential ultracentrifugal flotation. Purified HDL were biotinylated by using the FluoReporter MiniBiotin-XX labeling kit (Invitrogen). CHO-K1 (ATCC) cells were transfected by Nucleofector technology using the Cell Line Nucleofector Kit T (Amaxa) and plasmids encoding either wild-type human or mouse SR-BI receptors, the SW0 or E210A mutant receptors, or the empty pcDNA3 vector. Transfected cells were analyzed for the level of SR-BI expression at the plasma membrane, their capacity to bind HDL particles by flow cytometry, and cholesterol efflux efficiency in the presence of HDL. HDL binding to SR-BI was evaluated 24 h posttransfection by incubating 5 × 10⁵ transfected CHO cells in suspension with biotinylated HDL (20 μg protein/ml) for 30 min at 4°C in phosphate-buffered saline-0.2% bovine serum albumin. The cells were then washed and fixed with 5% formalin neutral buffered solution (Sigma), and streptavidin-PE (eBiosiences) was added before FACS acquisitions on an FC 500 flow cytometer (CXP software; Beckman Coulter). The level of SR-BI expression at the plasma membrane was evaluated by incubating the transfected cells in suspension with MAb C11 (2 μg/ml) for 30 min at room temperature, followed by an incubation with a fluorescein-labeled anti-human IgG antibody (Vector Laboratories). Fluorescein isothiocyanate fluorescence was then measured by flow cytometry. Cellular cholesterol efflux was measured 48 h posttransfection as described previously (15).

Statistical analysis.

Results are presented as means ± standard errors. The statistical significance of the differences between the means of the experimental groups was tested by the Student t test for unpaired data. A difference was considered statistically significant when the P value was <0.05.

SR-BI is involved in an early step of HCV infection.

We previously showed that SR-BI is involved in sE2 binding and that antibodies against the extracellular domain of SR-BI can block sE2 interactions and virus infection (15, 50). Similar data were obtained with CD81 (8, 16, 24, 29, 41, 42). To characterize the sequence of events during HCV entry with respect to binding to these two receptors, we investigated the inhibitory capacities of antibodies to CD81 (clone 1.3.3.22; Santa Cruz Biotechnology) and to SR-BI (MAb C167) (15) when administered at different times during the early phase of infection. HCVcc (J6/JFH) was incubated for 90 min at 4°C with Huh-7.5 human hepatoma cells to allow virus attachment and synchronous infection after a shift to 37°C. Anti-receptor MAbs were added at different times to the virus-containing medium before and after the shift to 37°C, as indicated in Fig. 1. Neither antibody could block virus entry after the temperature shift. However, the anti-CD81 MAb inhibited infection with a similar potency irrespective of whether it was added before, during, or immediately after virus binding, while MAb C167 could no longer be effective if it was added after virus binding (Fig. 1). This indicates that SR-BI is involved in an early step of virus/cell recognition, while CD81 acts subsequent to initial virus binding.

Identification of SR-BI regions essential for sE2 recognition.

We compared the efficiencies of binding of sE2 to SR-BI molecules from species with different susceptibilities to HCV infection, human and tupaia, which can be infected by HCV, and tamarin and mouse that are resistant to HCV infection. The transient transfection of expression plasmids encoding SR-BI molecules from these four species into mouse neuronal N2a cells led to high and comparable levels of cell surface receptor expression, which was evaluated with conformational antibodies against the extracellular domain (see Materials and Methods). The binding of sE2 from the H77 strain to the different receptors was measured by cytofluorimetric analysis of transfected cells.

Tupaia SR-BI binds sE2 although with a reduced efficiency (about 50%) compared to that of the human ortholog (Fig. 2). Conversely, mouse SR-BI and tamarin SR-BI were unable to recognize sE2 (Fig. 2). Thus, the profile of sE2 binding to SR-BI molecules from different species correlates with their susceptibility to HCV infection.

On the basis of the amino acid sequence alignment of the mouse and human SR-BI molecules, we designed a number of interspecies chimeras (Fig. 3). Swapping mutants SW0 (aa 70 to aa 87), SW1 (aa 114 to aa 124), and SW2 (aa 187 to aa 195) contained highly divergent regions of the mouse sequence in the context of the human receptor. The other mutant proteins contained a single alanine substitution of residues different in the mouse sequence but conserved in tupaia SR-BI (Fig. 3A).

The expression plasmids encoding the SR-BI mutant receptors were transfected into the recipient mouse N2a cell line. All mutants and wild-type proteins showed comparable levels of expression (Fig. 3B, middle). N2a cells transfected with expression plasmids encoding wild-type and mutant receptors were also equally recognized by conformational MAbs C11 and C167 in a cell surface FACS assay, indicating that mutagenesis had not resulted in drastic changes in the overall display and conformation of the SR-BI molecule (Fig. 4 and data not shown). E2 binding of these mutants, expressed as a percentage of binding with respect to the wild-type human receptor, is shown in Fig. 3B (top). Swapping mutant SW0 showed a 60% reduction in E2 binding, while the SW1 and SW2 mutants were less impaired (40% reduction of ligand binding). Mutant E210A showed a 90% reduction of E2 binding, while the remaining point mutants did not significantly affect E2 recognition (Fig. 4).

We also observed that the impaired-binding phenotype of the E210A mutant receptor was not limited to E2 from HCV genotype 1a but was also found for other genotypes (genotype 1b, strain BK, and genotype 6, isolate 6.540), thus confirming the crucial role of E210 in the recognition of the viral ligand (data not shown).

SR-BI mutants with reduced sE2 binding are impaired for HCVcc infection.

Human hepatoma Huh-7.5 cells support efficient infection and replication by HCV (10, 34). Therefore, to assess whether SR-BI regions that mediate sE2 interactions are indeed important for HCV infection, we generated an Huh-7.5 derivative cell line where endogenous SR-BI expression could be reversibly downregulated. A doxycycline-inducible SR-BI-specific shRNA sequence was cloned into a lentiviral vector and stably transduced in Huh-7.5 cells (see Materials and Methods). The resulting cell line (Huh-7.5/SR-BIkd) showed a significant reduction in the level of SR-BI expression upon the induction of the transduced shRNA with doxycycline (Fig. 5A, middle). The silencing of SR-BI resulted in a significantly lower susceptibility to HCVcc infection, to about 20% of the uninduced Huh-7.5/SR-BIkd cells (Fig. 5A, top), confirming that SR-BI is important for HCV infection of human hepatic cells.

We then constructed lentiviral vectors encoding wild-type human and mouse SR-BI molecules and the two mutants SW0 and E210A. None of the SR-BI sequences cloned in the lentiviral vectors included the target of the SR-BI shRNA used to silence the endogenous gene. Huh-7.5/SR-BIkd cells were kept in culture in the presence of doxycycline 4 days prior to infecting them with the lentiviral vectors encoding the different SR-BI constructs at an MOI of 0.5. An empty lentiviral vector was used as a negative control. Four days posttransduction, cells were infected with HCVcc at an MOI of 0.1. All SR-BI lentiviral vectors expressed comparable levels of wild-type and mutant receptors, as measured by WB with whole-cell extracts of transduced cells (Fig. 5B, middle). Thirty-two hours after HCVcc infection, Huh-7.5/SR-BIkd cells transduced with the different vectors were lysed, and total RNA was extracted for HCV RNA quantification by RT-qPCR. Lentivirus-mediated transduction with wild-type human SR-BI resulted in a sixfold increase in the relative permissiveness to HCVcc infection with respect to SR-BI-knocked-down cells transduced with the control lentiviral vector (Fig. 5B, top). In contrast, murine SR-BI and derivatives of human SR-BI only partially rescued the infectivity of silenced Huh-7.5/SR-BIkd cells, with the E210A mutant showing almost a 60% reduction in HCVcc infection compared to cells complemented with wild-type human SR-BI. At present, we cannot explain why mouse SR-BI can partially rescue HCV infection upon transduction in Huh-7.5/SR-BIkd cells while showing a strong reduction in the binding of the sE2 glycoprotein. Such a discrepancy could be due to a partially different conformation between sE2 and the full-length protein on the viral particles or the presence of other structural elements of the HCV envelope like the E1 protein.

SR-BI determinants necessary for sE2 recognition are not involved in receptor oligomerization.

Since human SR-BI forms oligomers on the cell surface (48, 49), we wanted to investigate whether the impaired-sE2-binding phenotype of the E210A mutant could be due to a defect in receptor oligomerization. Therefore, we generated C terminus tagged versions of wild-type and mutant receptors, adding two different tag sequences: V5 or c-Myc.

We first cotransfected HEK-293 cells with expression plasmids encoding the two tagged forms of the wild-type receptor. Cell lysates were then immunoprecipitated with the anti-c-Myc antibody and revealed by WB analysis with anti-V5 antibody or vice versa. Coimmunoprecipitation of the two tagged proteins was observed in both experiments (Fig. 6, lanes 2 and 4). We then cotransfected HEK-293 cells with expression plasmids encoding V5-tagged wild-type SR-BI and c-Myc-tagged E210A mutant SR-BI. Also, in this case, cell lysates were immunoprecipitated with the anti-c-Myc antibody and revealed by WB analysis with anti-V5 antibody or vice versa (Fig. 6, lanes 3 and 6). After immunoprecipitation with the anti-V5 antibody recognizing the wild-type protein, the coexpressed E210A mutant was quantitatively recovered. Similarly, efficient coimmunoprecipitation of the wild-type protein was observed with an antibody recognizing the c-Myc-tagged E210A mutant. These data suggested that the capacity to form oligomers is not impaired in the E210A mutant.

Different regions of SR-BI mediate binding to sE2 and HDL.

We previously showed that expressing human SR-BI in CHO cells correlated with a marked increase in HDL binding to the cell membrane compared to untransfected cells (15). To verify whether the SR-BI protein elements involved in HCV recognition are different from those responsible for binding to the physiological ligand HDL, we performed HDL binding assays with CHO cells transiently transfected with expression plasmids encoding mutant SR-BI or the empty control plasmid. Cell surface expression levels of the different SR-BI molecules were measured by FACS analysis with conformational antibody C11 (data not shown). Both SW0 and E210A mutants showed HDL binding levels similar to those of wild-type human and mouse SR-BI proteins (Fig. 7A). A number of studies have shown that when cells express SR-BI, the bidirectional flux of free cholesterol (FC) between cells and HDL particles is accelerated (30, 38, 53-56). Thus, we further assessed whether the SW0 and E210A mutants were functional in facilitating cellular FC efflux to HDL. The transient overexpression of either human or mouse SR-BI in [³H]cholesterol-labeled CHO cells led to a major increase in FC efflux to HDL. Similar results were obtained with SW0 and E210A mutants (Fig. 7B).

Thus, our data support the notion that the human SR-BI residues mutated in the SW0 and E210A variants are necessary for HCV interactions but are not involved in SR-BI-mediated HDL metabolism.