Stability and Dynamics of Polycomb Target Sites in Drosophila Development

In Vivo Pc and Pho Target Genes

We performed genome-wide mapping of binding sites for Pc and Pho in chromatin from two in vivo sources; Drosophila embryos and imaginal discs. We studied Pc as a representative of the four core PRC1 components, Pc, Polyhomeotic, Posterior sex combs and dRing [14]. We investigated Pho since this is a sequence-specific DNA-binding protein known to be associated with several PcG Response Elements (PREs). Pho binding sites have been shown to be required for PcG-mediated silencing at these PREs [15]–[19] and although Pho is not a component of purified PRC complexes, it interacts biochemically with both PRC1 and PRC2 [13],[20],[21]. Pho co-localises with PRC1 proteins at many sites on polytene chromosomes [16] and, by ChIP (Chromatin Immunoprecipitation) analysis, it is associated with PRC1 binding sites in Hox genes [22],[23].

The 0–16 hr embryonic chromatin provides a base-line for our analysis identifying a set of in vivo targets in a mixture of developmental time-points and tissues. In contrast, the imaginal disc chromatin provides a more focussed sampling of targets within a single tissue (epidermal imaginal), at a particular developmental time (wandering third larval instar) and at a specific position along the body axis (T3 segment). At a gross level, comparison of the binding profiles, e.g. across chromosome 3R as illustrated in Figure 1, reveals considerable similarity, suggesting that Pc and Pho are generally bound at the same locations and that their binding sites appear relatively constant with little change between embryo and imaginal disc.

To analyse these data in more detail, we defined upper and lower binding thresholds for each profile, allowing us to categorise binding over each Drosophila gene as positive, intermediate or negative (see Table S1). As well as counting binding events directly over transcription units, intergenic events were separately ascribed to the nearest transcript. Validation of the ChIP-array data by ChIP followed by specific PCR confirmed that thresholds were appropriate (Figure S1).

Using conservative thresholds, we find 386 genes with Pc binding over the transcription unit. 179 (46%) of these are also associated with Pho binding, which rises to 229 (59%) when we include intergenic Pho binding, supporting the idea that Pho has a general role as a DNA-binding protein targeting the assembly of Polycomb complexes.

Interestingly, we find a substantial number of genes (212) that exhibit Pho binding in the absence of Pc (Figure 2). The majority (85%) of these Pho-only binding sites are specific to embryo chromatin. Examination of the GO classifications that are enriched in this subset reveals a markedly different profile from the set of genes that bind both Pc and Pho (Figure 2C). In particular, we find significant overrepresentation (p<0.05) of genes involved in oogenesis, mitosis and mRNA splicing. In addition, we also note that several genes whose products are involved in chromatin regulation (e.g. brahma, Polycomblike, Cp190 and su(Hw)) are associated with Pho but not Pc. These observations indicate a role for Pho in the embryo that is independent from its association with Pc.

Binding Site Analysis

As illustrated in Figure 2D the local profiles of Pc and Pho binding are very different. Pc is often associated with a broad binding domain extending over tens of kilobases whereas Pho binding is characterised by much narrower isolated peaks. Since the sharp Pho peaks identify relatively short regions associated with Pho binding we searched for enriched sequence motifs underlying these peaks. In addition to Pho, several other DNA-binding proteins, including GAGA factor and Zeste, are associated with PREs [24]–[29]. We were interested to see if Pho-bound sequences exhibited the canonical Pho binding motif, as well as putative binding sites for these other factors.

We learned motif dictionaries from the central areas of 150 strong Pc-associated Pho peaks using various search parameters. The searches identified more than 70 partially redundant sequence motifs and we selected 18 of these for further analysis, based on their length, information content and/or similarity to known binding sites of Pho, GAGA and Zeste (Figure 3, see also Table S2 and Dataset S1). Binding sites of additional factors known to be involved in Pc recruitment (e.g. Grainy head) could not be identified. We found Pho-type motifs comprising a core GCCAT sequence with a more or less pronounced tail of four Ts. In addition, we found a novel TGGCC motif that may be related to the Pho-type as it has a GCC core (and GCCA on the reverse strand) but which lacks the tail of Ts. We also found a frequently occurring GTT repeat and a CGCACT sequence motif. The GAGA- and Zeste-type motifs differ in that Zeste-like motifs have a pronounced “GAG”, however we recognise that this classification is somewhat arbitrary.

The selected motifs were significantly over-represented when we compared their occurrence in all Pho peaks to random sets of sequences that were not occupied by Pho (Figure 3B). While longer motifs with positions of low information content are mostly over-represented when allowing for mismatches, short sequence motifs are only over-represented when considering perfect matches or small sub-optimal bit scores. This over-representation approach also enabled us to derive informed cutoff values for further analyses; for each motif we identified the sub-optimal bit score for which the motif shows the strongest evidence for over-representation. Using these cutoff values, we determined the presence of the different motif types in all 628 embryonic Pho peaks (Figure 3C). The short motifs (clustered to the right of the diagram) are well represented in the Pho peak sequences; 85% of the sequences contain Pho_6, 63% contain GAGA_6 and 64% contain Zeste_7. Longer Pho and TGGCC motifs occur in 51% of the peaks and have an interesting antagonistic clustering to the longer GAGA and Zeste-type motifs; i.e. peaks containing longer Pho/TGGCC-type motifs (region A in Figure 3C) cluster separately from peaks containing longer GAGA/Zeste-type (region B). Overall, the general association of Pho, GAGA and Zeste binding motifs with Pho binding is consistent with the clustering of these motifs previously used to predict PREs in the Drosophila genome [29] and we add novel enriched sequences that may improve such approaches. However, we emphasise that there is considerable variability in the motif occurrence at Pho peaks as we illustrate for representative peaks in Figure S2.

We were interested to determine if there was any qualitative difference in motif composition between Pc-associated and Pho-only peaks. We compared the number of peaks containing particular motifs for both these peak classes and tested for significance using chi-square statistics. Interestingly, we find significant differences with TGGCC_7 (34.7% vs 53.6%, p<3×10⁻⁶) and Zeste_7 (31% vs 46.8%, p<8×10⁻⁵) under-represented in the Pho-peaks that are not associated with Pc. In contrast, the Pho_12a (43.9% vs 26.2%, p<3×10⁻⁶) and Pho_14b (35.2% vs 20.4%, p<3×10⁻⁵) motifs are over-represented in the Pho-only group. This observation highlights the potential importance of a long Pho motif at the Pho-only sites. There is no compositional bias for the longer GAGA- and Zeste-type motifs.

Pc and Pho Are Bound at Both Inactive and Active Hox Genes

What differentiates a silenced from an active Hox gene? Although the PcG and TrxG genes have antagonistic effects on gene expression they can nevertheless be present at the same gene. PcG proteins and TrxG proteins were found to co-localise at targets on salivary gland polytene chromosomes [30],[31] and at PREs in the Bithorax Complex (BX-C) [32]. In addition, Pc-binding does not correlate with gene expression in S2 cells [33]. Recently, Papp and Mueller have analysed the binding of PcG and TrxG at the Ubx gene in active and repressed states in vivo [22]. Sampling the occupancy of these complexes at 17 sites across 115 kb of the Ubx region, encompassing the transcription unit and regulatory sequences, they found that PcG proteins of both the PRC1 and PRC2 complexes as well as Trx protein are bound to Ubx PREs in both the ON and the OFF states. Similarly, Trx and PcG were found to co-localise at binding sites in both active and inactive Hox genes in tissue-culture cells [23].

Our ChIP-array data allows a more extensive assessment of Pc and Pho occupancy across the Drosophila Hox complexes in vivo. Chromatin derived from embryos represents a mix of active and inactive states for the different Hox genes, however, for the T3 imaginal discs we can compare silenced and active Hox genes. Focusing on the BX-C: Ubx is active in the T3 discs, where it is required in the haltere disc to specify haltere in contrast to wing development, and in the T3 leg disc to specify T3 characteristics. In contrast, both abdominal-A (abd-A) and Abdominal-B (Abd-B) are silenced in T3 discs.

The Pc binding profile shows an extensive domain of binding that covers the approximately 300 kb BX-C region (Figure 4A). Characterised PREs tend to be represented as regions of relatively higher binding within the overall domain. As with other regions of the genome, the Pho binding profile is very different with much sharper, more isolated peaks several of which coincide with characterised PREs. In chromatin from the T3 imaginal discs both Pc and Pho are associated, as expected, with the silenced genes, abd-A and Abd-B. However, we also find significant association with the active Ubx gene. The T3 disc Pc profile over Ubx is similar to the embryo chromatin profile with an extensive domain and significant binding at both the bx and bxd PREs as well as a peak close to the start of Ubx transcription. The Pho profile in T3 discs also shows clear peaks at these PREs and binding close to the Ubx 5′ end. These data show clear evidence of Pc and Pho association with an active gene and confirm and extend the results of Papp and Mueller [22].

There are, however, differences between the embryo and T3 disc profiles. For example, several strong Pho binding peaks in embryo chromatin are only weakly represented in the T3 disc chromatin. In addition, there is a generally lower level of Pc and Pho binding across the active Ubx gene in comparison to the inactive abd-A and Abd-B genes. The average enrichments (log₂ binding ratios) across the three transcription units in disc chromatin for Pc are: Ubx 0.33, abd-A 1.03 and Abd-B 1.01 and in the case of Pho: Ubx 0.07, abd-A 0.31 and Abd-B 0.34.

Significant Pc and Pho binding associated with an active Hox gene is also found in the Antennapedia Hox cluster (ANT-C). This cluster contains the Hox genes lab, pb, Dfd, Scr and Antp, and all these genes are associated with widespread Pc binding and distinct Pho peaks in the embryo (Figure 4B). It is striking that peaks in the Pc distribution as well as strong Pho peaks are found close to the 5′-ends of lab, pb, Dfd and Scr. The longer Antp gene is covered by a domain of Pc binding and is associated with several Pho peaks. As with Ubx, Antp is active in T3 discs since it is expressed from the labial segment posteriorly. Indeed, Antp may be a better gene than Ubx for the analysis of the active state in T3 because it is expressed in both the ectoderm and mesoderm of the T3 segment [34],[35], whereas Ubx is only active in the ectodermal imaginal cells of the T3 disc and may be silenced in the small population of mesodermal adepithelial cells [36]. Despite this difference we find a similar situation with Antp as we observe with Ubx. Although it is active, Antp is nevertheless associated with a significant domain of Pc binding, which encompasses the Antp transcription unit, as well as strong peaks of Pho binding close to the 5′ and 3′ ends of the gene. Other Pho peaks over Antp that are prominent in embryo chromatin are less apparent in T3 discs.

As shown in Figure 4 we find many more Pho binding peaks across the Hox complexes than there are characterised PREs. As all these Pho sites may not be functionally equivalent we examined the motif composition in the 36 Pho peaks in the BX-C. We find a high variability of motif counts but characterised PREs do not appear as a distinct motif-rich group (Figure S3).

Tissue-Specific Differences in Pho and Pc Binding

While our analysis of the Hox clusters demonstrates significant Pc and Pho binding associated with both active and inactive genes, a genome-wide comparison of the embryo and T3 imaginal disc profiles shows that PcG proteins are not constitutively associated with target genes. The binding profiles of embryo and T3 disc chromatin are similar, with 65% (252/386) of the genes significantly associated with Pc in the embryo also above threshold in the disc chromatin. This rises to 81% (314/386) if we include the genes with intermediate binding in discs. When we include the data from the genome-wide S2 tissue culture study [10] we also find considerable overlap. For genes with direct binding over transcription units there is a 42% (161/386) overlap across all three data sets rising to 58% (224/386) if we include intermediate binding in discs and S2 cells. A gene-by-gene comparison is provided in Table S1.

Comparison with other previously published datasets also reveals considerable overlap. For the analysis of Pc targets by the DamID method in Kc tissue culture cells [11] we find that our set of Pc targets in the embryo (386 targets) contains 136 targets from the Kc cell data. As the genome coverage of the Kc cell analysis is approximately 60%, this extrapolates to an estimated 60% overlap. This comparison is detailed in Table S1. There is also good correspondence with the in vivo data from Negre et al. [12] where, for example, 5 out of the 7 targets they identify in the 3 Mb Adh region in embryo chromatin are also present in our set of Pc targets in the embryo. A detailed comparison is presented in Figure S4.

For examining differential Pc binding, we focus on the most comparable datasets, the two chromatin samples in our dataset and the Schwartz et al. S2 data [10], as these three datasets are genome-wide and use the same Affymetrix array platform. Despite the overall similarity comparing the embryo, T3 disc and S2 cell chromatin samples, there are clear differences in Pc occupancy for some genes indicating potential sites of differential Pc activity. To reduce the level of artificially selected differential Pc targets resulting from automatic selection of peaks in the high-throughput analysis, we visually screened the binding profiles of all differentially bound regions and restricted our further analysis to differential gene sets that show significant enrichment of GO categories. We identify three robust sets of differentially occupied genes. We find 49 genes that are bound by Pc in the embryo but are not Pc-associated in imaginal discs, 107 genes that are bound by Pc in the embryo but not in S2 cells and 119 genes that are bound by Pc in imaginal disc but not in S2 cells.

By examining the genes in these differentially-bound sets we anticipated that we might identify cell fate-determining genes for cell fate decisions in particular developmental pathways. For example, genes bound by Pc in the embryo but not in imaginal discs might represent genes released from Pc silencing on the pathway of disc development and hence might represent key cell-fate determining genes for that pathway. However, the GO analysis of these gene sets (summarised in Figure 5 (also see Table S3)) presents a striking observation. The Pc target genes that are unoccupied by Pc in a particular tissue appear to have little to do with cell fate decisions that are relevant for that tissue. For example, the genes occupied by Pc in the embryo but not in the imaginal discs are enriched in genes involved in fate decisions in neuroblasts of the central nervous system. Similarly the genes that are occupied in embryos but not in S2 cells, which are mesodermally–derived cells of the haemocyte lineage, are genes required for ectodermal and neural fate decisions. The genes that are occupied in imaginal discs but not in S2 cells are relevant for fate decisions occurring in discs but not in S2 cells (e.g. sensory organ development, eye development, ectoderm development).

We further investigated the group of 49 genes which are associated with Pc in the embryo but not in T3 discs. Figure 6A lists these genes and shows their pattern of binding of Pc and Pho across the five data sets. Representative binding profiles are shown in Figure 6B.

As the plot in Figure 6A demonstrates, approximately half of the Pc targets also show Pho binding in the embryo (49%) and, as with Pc, Pho binding is absent in the T3 discs. For this gene set, target occupancy in the S2 cells is similar to that observed in imaginal discs with only a few targets (14%) showing Pc binding. The set of 49 genes specifically bound in the embryo contains several well-characterised genes; notably run, hb and tll that are involved in early embryonic patterning and in neuroblast specification as well as two genes, ind and vnd involved in the specification of the nervous system and in neuroblast fate. As mentioned above, this class of genes has a strong GO signature and is highly enriched in transcription factors (Figure 5). Some individual classes of transcription factor are particularly strongly enriched. For example, 3 out of the 19 forkhead domain proteins present in the Drosophila genome are represented (hypergeometric probability 3.5E-05) and 3 putative hormone-receptor C4-zinc finger genes of the 21 in the genome (4.7E-05).

The GO analysis and the individual gene functions suggest that this set of genes may be involved in early embryonic fate decisions but not in fate decisions that are relevant for the imaginal disc cells, where these targets are unoccupied. To explore this we asked whether these genes are actually expressed in imaginal discs. All of the six genes tested for expression by RT-PCR are expressed the embryo but show little or no expression in imaginal discs (Figure 6C). Thus, as with the Hox genes, we find Pc occupancy is not linked to expression state in a simple fashion.

Pc and Cell Fate Genes in the Haemocyte Lineage

Drosophila S2 cells are an embryo-derived cell line that appear to be related to haemocytes since they are phagocytic and express haemocyte markers [37]. We were interested to relate the Pc binding profile in these cells to the genes involved in cell fate decisions in the haemocyte lineage (reviewed in [38]). The embryonic haemocytes are derived from a head mesoderm primordium defined by the GATA transcription factor, Serpent (Srp), and differentiate into crystal cells or plasmatocytes. Lozenge (Lz), a Runx family transcription factor, is required for crystal cell development whereas U-shaped (Ush) antagonises crystal cell development and Glial cells missing (Gcm) promotes plasmatocyte development. The closely related Gcm2 acts redundantly with Gcm in plasmatocyte differentiation. Full maturation of plasmatocytes requires the PDGF/VEGF Receptor (Pvr). S2 cells express srp together with the plasmatocyte markers ush and pvr and do not express the crystal cell marker lz (FLIGHT database: http://flight.licr.org/, [37]). The expression status of gcm and gcm2 is less clear; they are not scored as expressed in S2 cells in the FLIGHT database but are reported to be detectable by RT-PCR [37].

The key cell fate-determining genes in the haemocyte lineage, srp, lz, gcm, gcm2 and ush, are all Pc targets. Figure 7 compares the Pc and Pho occupancy at srp, ush and lz in S2 cells with the occupancy in embryos and imaginal discs. Strikingly, the cell fate genes associated with the plasmatocyte fate, srp and ush, show strongly reduced Pc occupancy in S2 cells compared to embryos and imaginal discs whereas the crystal cell determining gene, lz, shows clear Pc binding. The comparative binding at srp is dramatic as there is a highly specific reduction in Pc binding in a specific domain over the srp gene in S2 cells, whereas the neighbouring gene GATAe is strongly associated with Pc binding.

Overall, this analysis of Pc binding at cell fate-determining genes in the haematocyte lineage shows clear differential binding in S2 cells that correlates with gene expression and the requirement for gene activity in the plasmatocyte pathway.

Pc Target Gene Expression and Specific Cell Fates

The Pc maintenance machinery functions to stably propagate states of gene activity through cell division and, for the Hox genes, stable expression patterns are preserved throughout development. We were interested to examine if this is also true for other Pc target genes. If Pc targets in general are stably expressed once activated, then differentiated cells may express the set of Pc target genes that have been activated along the developmental pathway they have followed. We used the FlyAtlas data set (http://www.flyatlas.org/) of gene expression profiles from selected adult and larval tissues to examine the pattern of deployment of Pc target genes in specific tissues [39]. Out of the 386 Pc target genes we identified with embryo chromatin, we obtained tissue-specific expression data for 373 genes from FlyAtlas. The cluster analysis of the expression data is presented in Figure 8 (and Figure S5). We find that the data for this small sample of genes out of the 18,770 transcripts in the data set nevertheless clusters according to tissue type. For example, the two neural samples, brain and thoracic/abdominal ganglia cluster together, as do the crop and hindgut samples representing ectodermal-derived gut ensheathed in visceral mesoderm. Thus the Pc target gene expression profile provides a tissue-type signature. The cluster diagram, in addition to the block of genes that are present in all samples, also provides several blocks of genes whose expression is related to particular tissues. For example, the block illustrated in Figure 8B includes genes expressed in foregut (crop) and in hindgut and contains the two key genes bin and bap that are required for the specification of the visceral mesoderm in mid-embryogenesis. This analysis indicates that not only the Hox genes but also other Pc target genes remain stably expressed through to adulthood, providing a basis for the stable specification of cell type.

Fly Stocks and Antibodies

The wild type strain used was OregonR. The Pc-GFP transgenic fly line was generated by Dietzel et al. [52]. The antibodies used were affinity purified rabbit anti-GFP [53], rabbit anti-Pho [18] and affinity-purified anti-Pc [54].

Chromatin Isolation and Immunopurification

Chromatin from embryos aged between 0 to 16 h after egg laying was purified as described previously [55]. For the preparation of chromatin from T3 imaginal discs (haltere and third leg) late 3rd instar larvae were dissected in ice-cold Schneider's Medium. Dissected discs were washed with PBS, fixed in PBS/1.5% formaldehyde for 20 min and washed with PBS. Batches of material were snap-frozen in liquid N₂ and stored at −80°C. Chromatin was prepared from a minimum of 100 discs. For Pc target analysis the specific reaction used chromatin from the Pc-GFP fly line immunopurified using anti-GFP, and the control reaction used wild type chromatin immunopurified using anti-GFP. The Pc-GFP protein binds to the same polytene chromosome loci as wild-type Pc [41] and we validated a selection of targets by ChIP using anti-Pc antiserum (Figure S1). For Pho analysis wild type chromatin was used with anti-Pho for the specific reaction and pre-immune antiserum for the control. For validation reactions anti-Pc and anti-Pho were used for the ChIP and enrichment was assayed using PCR with specific primers as described previously [55]. The primer sequences are given in Table S4.

Probe Preparation and Microarray Hybridisation on Drosophila Tiled Genomic Microarrays

Three biological replicates were used for each condition and enrichment profiles were generated by comparison of specific and control ChIP DNA samples. In order to identify regions bound by Pho or Pc, 10–20 ng of ChIP and control DNA samples were amplified using a random-primed PCR method according to Affymetrix recommendations (Affymetrix Chromatin Immunoprecipitation Assay Protocol; http://www.affymetrix.com/support/technical/manuals.affx). Purified DNAs were then fragmented, TdT labeled, and hybridized to the Affymetrix Drosophila genome Tiling Array 1.0 (reverse part no. 520,054) as described previously [56]. ChIP–array data have been deposited in the GEO database under accession code GSE11006.

Affymetrix CEL File Analysis

Affymetrix CEL files were converted into chromosomal enrichment profiles using the TiMAT2 package (http://bdtnp.lbl.gov/TiMAT/TiMAT2/). Probe mapping information (“bpmap”) to D. melanogaster genome release 4 was obtained from David Nix. Each CEL file was visualised for manual inspection and artefacts were masked using CelMasker. Normalisation was subsequently performed with CelProcessor using default parameters. Enrichment profiles were generated using ScanChip, outputting windowed enrichment signals and Wilcoxon Rank Sum scores. The .sgr files are provided in Datasets S2–5).

Identification of Bound Regions

We classified enrichment events into positive, intermediate and negative based on visual inspection in the Integrated Genome Browser (http://www.affymetrix.com/support/ developer/tools/download_igb.affx). We found that our manual classification could be automated using basic descriptive statistics. Positive bound regions (“peaks”) were characterised by enrichment values greater than an experiment-specific cutoff as well as a Wilcoxon Rank Sum score greater than 55. Intermediate regions were score-independent but showed an enrichment value greater than 50% of the experiment-specific cutoff. Negative regions accounted for all regions that did not fulfil these criteria. The experiment-specific cutoffs were empirically determined as the signal average plus three standard deviations for Pc (log2 enrichment ratio of 0.39 for the embryo and 0.77 for the T3 disc material) or five standard deviations for Pho (log2 enrichment ratio of 0.62 for the embryo and 0.80 for the T3 disc material). For the S2 Pc data of [10], we followed a similar classification with positive regions having enrichments greater than the signal average plus three standard deviations and negative regions showing ratios of less than 50% of this value.

Target Gene Assignment

We assigned each binding event to a target gene, based on complete or partial overlap with a gene model. Binding events that did not overlap with a gene model were assigned to the nearest gene. In most cases for Pc, this concerned bound regions that represented extensions of larger domains overlapping with the gene.

Motif Searches

We selected the 150 strongest Pho peaks that overlapped with Pc binding and generated two different search sets comprising 200 nt or 700 nt of sequence around the centre of the peaks. We used NestedMICA [57] to search for statistically overrepresented sequence motifs in the search set. A first round of searches was performed with NestedMICA v0.72, specifying expected motif length and usage frequency. A second search was performed with NestedMICA v0.8 using default usage frequency and dynamic motif length. Both searches aimed to identify 10–15 overrepresented motifs. Candidate motifs were visually inspected in MotifExplorer and a set of promising candidates resembling Pho-, GAGA- or Zeste-like motifs as well as some with high information content were chosen for further analysis.

Statistical overrepresentation of motifs was determined by comparing the set of all Pho peak sequences to 1,000 sets of random sequences of the same length, representing regions of the Drosophila genome that are not bound by Pc. A Z-score was derived, incorporating the number of occurrences in real peaks and the numbers observed for the 1,000 random sets.

All downstream analyses were performed with custom-made Perl scripts. Clustering and visualisation was performed with Genesis v1.6 [58]. Binding sites in the sequence context were visualised in BioSAVE [59].

Gene Ontology and Tissue Expression Analysis

Enrichment of Gene Ontology terms was determined with the GeneMerge 1.2 software tool, comparing enrichment in specific lists with all Drosophila genes. Gene Association files used were March 2007 release of the Gene Ontology. The enrichments quoted in the text are corrected for multiple testing by applying a modified Bonferroni method within the Gene Merge algorithm. Enrichments with e-scores better than 0.05 are called significant. Tissue expression analysis used the data from FlyAtlas [39] with clustering and visualisation using Cluster [60] and Java Treeview [61].

RT-PCR

OregonR embryos (0–20 hr) were dechorionated with bleach, then divided into aliquots, placed directly in Trizol and stored at –80°C. Homogenisation and RNA extraction were carried out according to the following protocol: http://www.flychip.org.uk/protocols/gene_expression/standard_extraction.php. T3 leg and haltere discs were dissected from wandering 3rd instar OregonR larvae in PBS. Each pair was transferred in a small drop of PBS directly into 100 µl Trizol and frozen immediately. For RNA extraction, 7 disc pairs were randomly pooled for each of 3 samples and RNA extracted as above. RNA samples were treated with RQ1 DNase to remove any genomic DNA. cDNA synthesis was performed by combining 10 µg DNase treated RNA with 500 ng anchored oligo(dT)23 primer (Sigma; Cat. No. 04387), 1 µl of 10 mM dNTPs, DEPC treated H2O to 13 µl. The reaction was heated to 65°C for 5 min then chilled on ice for 1 min. 4 µl of 5x First Strand Buffer (Invitrogen), 1 µl 0.1 M DTT (Invitrogen), 1 µl RNAsin (Promega; Cat. No. 18064-014) and 1 µl Superscript III Reverse Transcriptase (Invitrogen; Cat. No. 18080-044) were added. Reactions were incubated at 50°C for 60 min and inactivated at 70°C for 15 min.

0.5 µl of the resulting cDNA was used in PCR reactions with the following primers: hb-F ggcctcttcgttcacatgg, hb-R agcggcttaattggcttatg, ind-F aacgattatgccgattccag, ind-R gattgaaggtgggactttcg, vnd-F cgacgagatgtcctcgtacc, vnd-R ctcttgtaatcgccggaaag, fd59A-F ttcagtcaccgcacaagaag, fd59A-R gtccagaagttgccctttcc, run-F agtccttcacgctgaccatc, run-R gtagtccgcatagccgtagg, tll-F tacaacagcgtgcgtctttc, tll-R ttgtccaccacacagagtcc, Rp49_F catacaggcccaagatcg, Rp49_R tgggcatcagatactgtcc.

Accession Numbers

The Flybase (http://flybase.bio.indiana.edu) accession numbers of the genes and gene products discussed in this paper are: abdominal-A (abd-A), FBgn0000014; Abdominal-B (Abd-B), FBgn0000015; Antennapedia (Antp), FBgn0000095; bagpipe (bap), FBgn0004862; biniou (bin), FBgn0045759; brahma (brm), FBgn0000212; Centrosomal protein 190kD (Cp190), FBgn0000283; Cyclin A (CycA), FBgn0000404; Deformed (Dfd), FBgn0000439; Distal-less (Dll), FBgn0000157; dRing (Sce), FBgn0003330; GAGA factor (Trl), FBgn0013263; GATAe, FBgn0038391; gcm2, FBgn0019809; glial cells missing (gcm), FBgn0014179; grainy head (grh), FBgn0004586; hedgehog (hh), FBgn0004644; hunchback (hb), FBgn0001180; intermediate neuroblasts defective (ind), FBgn0025776; labial (lab), FBgn0002522; lozenge (lz), FBgn0002576; PDGF- and VEGF-receptor related (Pvr), FBgn0032006; pleiohomeotic (pho), FBgn0002521; pleiohomeotic like (phol), FBgn0035997; Polycomb (Pc), FBgn0003042; polyhomeotic distal (ph-d), FBgn0004860; polyhomeotic proximal (ph-p), FBgn0004861; Posterior sex combs (Psc), FBgn0005624; proboscipedia (pb), FBgn0051481; runt (run), FBgn0003300; Scm-related gene containing four mbt domains (Sfmbt), FBgn0032475; serpent (srp), FBgn0003507; Sex combs reduced (Scr), FBgn0003339; suppressor of Hairy wing (su(Hw)), FBgn0003567; tailless (tll), FBgn0003720; teashirt (tsh), FBgn0003866; trithorax (trx), FBgn0003862; Ultrabithorax (Ubx), FBgn0003944; u-shaped (ush), FBgn0003963; ventral nervous system defective (vnd), FBgn0003986; vestigial (vg), FBgn0003975; and zeste (z), FBgn0004050.