A Soluble Form of the Triggering Receptor Expressed on Myeloid Cells-1 Modulates the Inflammatory Response in Murine Sepsis

Preparation of Monocytes from Peripheral Blood.

10 ml of peripheral blood samples were collected on EDTA-K from five healthy volunteer donors originating from laboratory staff. After dilution in RPMI (Life Technologies) vol/vol, blood was centrifuged for 30 min at room temperature over a Ficoll gradient (Amersham Biosciences) to isolate PBMCs. The cells recovered above the gradient were washed and counted. To deplete the suspensions of lymphocytes, cells were then plated in 24-well flat-bottom tissue culture plates (Corning) at a concentration of 5 × 10⁶/ml and allowed to adhere during 2 h at 37°C. The resulting lymphocyte suspension was discarded, and the adhering monocytic cells were maintained in a 5% CO₂ incubator at 37°C in complete medium (RPMI 1640, 0.1 mM sodium pyruvate, 2 mM penicillin, 50 μg/ml streptomycin; Life Technologies) supplemented with 10% FCS (Invitrogen).

TREM-1 Peptide.

Based on the TREM-1 sequence in GenBank/EMBL/DDBJ (under accession nos. AF287008 and AF241219), a domain highly conserved in mouse and man was found in the extracellular portion of the protein. The corresponding conserved domain (LQVTDSGLYRCVIYHPP) was chemically synthesized as a COOH terminally amidated peptide (Pepscan Systems). The correct peptide was obtained in >99% yield and with measured mass of 1,961 D versus a calculated mass of 1,962 D and was homogeneous after preparative purification, as confirmed by mass spectrometry and analytic reversed phase-high performance liquid chromatography. This peptide was called LP17. A peptide containing the same amino acids as LP17 but in a different sequence order (TDSRCVIGLYHPPLQVY) was similarly synthesized and served as control peptide.

In Vitro Stimulation of Monocytes.

For activation, monocytes were cultured in the presence of Escherichia coli LPS (O111:B4, 1 μg/ml; Sigma-Aldrich). Cell viability was assessed by trypan blue exclusion and by measuring lactate dehydrogenase release. In some experiments, this stimulus was given in combination with TNF-α (5–100 ng/ml; R&D Systems), IL-1β (5–100 ng/ml; R&D Systems), rIFN-γ (up to 100 U/ml; R&D Systems), rIL-10 (500 U/ml; R&D Systems), or up to 100 ng/ml of LP17 or control peptide.

To activate monocytes through TREM-1, an anti–TREM-1 agonist monoclonal antibody (R&D Systems) was added as follows. Flat-bottom plates were precoated with 10 μg/ml anti–TREM-1 per well. After thorough washing in PBS, the monocyte suspensions were added at a similar concentration as above. Some experiments were performed in the presence of protease inhibitors (PMSF and Protease Cocktail Inhibitor; Invitrogen). Cell-free supernatants were assayed for the production of TNF-α and IL-1β by ELISA according to the recommendations of the manufacturer (BD Biosciences). To address the effect of LP17 on NF-κB activity in monocytes, an ELISA-based assay was performed (BD Mercury Transfactor kit; BD Biosciences). Monocytes were cultured for 24 h in the presence of E. coli LPS (O111:B4, 1 μg/ml), and/or an agonist anti–TREM-1 monoclonal antibody (10 μg/ml), and/or LP17 (100 ng/ml). Whole cell extracts were then prepared, and levels of NF-κB p50 and p65 were determined according to the recommendations of the manufacturer. All experiments were performed in triplicate, and data are expressed as means (SEM).

Identification and Quantitation of sTREM-1 Release.

Primary monocytes suspensions were cultured as described above. The cells were treated with E. coli LPS (O111:B4, 1 μg/ml) for 24 h at 37°C. Cell-conditioned medium was submitted to Western blotting using an anti–TREM-1 monoclonal antibody (R&D Systems) in order to confirm the presence of 27 kD material recognized by anti–TREM-1. Soluble TREM-1 levels were measured by assessing the optical intensity of bands on immunodots by means of a reflectance scanner and the Quantity One Quantitation Software (Bio-Rad Laboratories, Inc.) as reported elsewhere (18). Soluble TREM-1 concentration from each sample was determined by comparing the optical densities of the samples with reference to standard curves generated with purified TREM-1. All measurements were performed in triplicate. The sensitivity of this technique allows the detection of sTREM-1 levels as low as 5 pg/ml.

TREM-1 RT-PCR.

Total mRNA was extracted from primary monocytes cultured in the presence of LPS using a TRIzol reagent (Invitrogen) and reverse transcribed using Superscript RT II (Invitrogen) to generate cDNA. RT-PCR conditions then used for all reactions were 94°C, 30 s/65°C, 30 s/68°C, and 1 min for 30 cycles. Amplification was performed with 2.5 mM MgCl₂, 0.2 mM dNTP, 2.0 U Taq polymerase, and 20 pM 5′ and 3′ oligonucleotide primers (Proligos). The sequences of the 5′ and 3′ primer pairs used were the following: TTGTCTCAGAACTCCGAGCTGC and GAGACATCGGCAGTTGACTTGG for TREM-1 (17); GGACGGAGAGATGCCCAAGACC and ACCAGCCAGGAGAATGACAATG for TREM-1 splice variant (TREM-1sv) (19); and GGACGACATGGAGAAGATCTGG and ATAGTAATGTCACGCACGATTTCC for β-actin used as housekeeping amplicon. PCR products were run on agarose gels and visualized by ethidium bromide staining.

LPS-induced Endotoxinemia in Mice.

After approval by the local ethical committee, male Balb/c mice (20–23 g) were randomly grouped and treated with E. coli LPS i.p. in combination with LP17 (in 500 μl normal saline) or control vector before or after LPS challenge. In some experiments, 5 μg of an anti–TREM-1 monoclonal antibody was administered i.p. 1 h after LPS injection. The viability of mice was examined every hour, or animals were killed at regular intervals. Serum samples were collected by cardiac puncture and assayed for TNF-α and IL-1β by ELISA (BD Biosciences) and for sTREM-1 levels by immunodot.

Cecal Ligation and Puncture Polymicrobial Sepsis Model.

Male Balb/c mice (7–9 wk, 20–23 g) were anesthetized by i.p. administration of ketamine and xylazine in 0.2 ml sterile pyrogen-free saline. The cecum was exposed through a 1.0-cm abdominal midline incision and subjected to a ligation of the distal half followed by two punctures with a G21 needle. A small amount of stool was expelled from the punctures to ensure patency. The cecum was replaced into the peritoneal cavity and the abdominal incision closed in two layers. After surgery, all mice were injected s.c. with 0.5 ml of physiologic saline solution for fluid resuscitation and s.c. every 12 h with 1.25 mg (i.e., 50 μg/g) of imipenem. The animals were randomly grouped and treated with normal saline (n = 14), the control peptide (n = 14, 100 μg) or LP17 (100 μg) in a single injection at H0 (n = 18), H+4 (n = 18), or H+24 (n = 18). The last group of mice (n = 18) was treated with repeated injections of LP17 (100 μg) at H+4, H+8, and H+24. All treatments were diluted into 500 μl of normal saline and administered i.p. We next sought to determine the effect of various doses of LP17. For this purpose, mice (n = 15 per group) were treated with a single injection of normal saline or 10, 20, 50, 100, or 200 of LP17 at H0 after the cecal ligation and puncture (CLP) and monitored for survival. Five additional animals per group were killed under anesthesia at 24 h after CLP for the determination of bacterial count and cytokines levels. Peritoneal lavage fluid was obtained using 2 mL RPMI 1640 (Life Technologies), and blood was collected by cardiac puncture. Concentrations of TNF-α and IL-1β in the serum were determined by ELISA (BD Biosciences). For the assessment of bacterial counts, blood and peritoneal lavage fluid were plated in serial log dilutions on tryptic soy supplemented with 5% sheep blood agar plates. After plating, tryptic soy agar plates were incubated at 37°C aerobically for 24 h and anaerobically for 48 h. Results are expressed as CFU per ml of blood and CFU per mouse for the peritoneal lavage.

Statistical Analyses.

Serum sTREM-1 and cytokines levels were expressed as mean (± SD). The protection against LPS lethality by LP17 was assessed by comparison of survival curves using the Log-Rank test. All statistical analyses were completed with Statview software (Abacus Concepts) and a two-tailed P < 0.05 was considered significant.

A Soluble Form of TREM-1 Is Released from Cultured Human Monocytes after Stimulation with E. coli LPS.

To identify the potential release of sTREM-1 in vitro, we stimulated human monocytes with LPS and analyzed the conditioned culture medium by SDS–PAGE. LPS stimulation induced the appearance of a 27-kD protein in a time-dependent manner (Fig. 1 A). Western blotting analysis revealed that this protein was specifically recognized by a monoclonal antibody directed against the extracellular domain of TREM-1 (Fig. 1 A). Cell viability was unaffected at LPS concentrations that induced the presence of sTREM-1 in conditioned medium, indicating that TREM-1 release was not due to cell death. Similarly, treatment of monocytes with protease inhibitors did not affect TREM-1 release (Fig. 1 A). TREM-1 mRNA levels were increased upon LPS treatment (Fig. 1 B), whereas TREM-1sv mRNA levels remained undetectable. This suggests that TREM-1 release is likely to be linked to an increased transcription of the gene and unrelated to TREM-1sv expression.

Stimulation of monocytes for 16 h with TNF-α (5–100 ng/ml) or IL-1β (5–100 ng/ml) induced very small TREM-1 release in a cytokine dose-dependent manner. Stimulation with IFN-γ did not induce TREM-1 release, even at concentrations of up to 100 U/ml.

LPS-associated Release of Proinflammatory Cytokines Is Attenuated by LP17.

Significant TNF-α and IL-1β production was observed in the supernatant of monocytes cultured with LPS. TNF-α and IL-1β production was even higher for cells cultured with both TREM-1 mAb and LPS compared with those cultured with mAb or LPS alone (Fig. 2 A).

The inducible release of proinflammatory cytokines was significantly lower after LPS stimulation when the medium was supplemented with LP17 or IL-10. LP17 reduced, in a concentration-dependent manner, the TNF-α and IL-1β production from cells cultured with LPS or with LPS and mAb and simultaneously increased the release of sTREM-1 from cells cultured with LPS. The control peptide displayed no action on cytokines or sTREM-1 release (not depicted). In striking contrast, IL-10 totally inhibited the release of both TREM-1 and inflammatory cytokines (Fig. 2 A). Both LPS and TREM-1 mAb induced a strong activation of monocytic NF-κB p50 and p65, and combined administration of LPS and TREM-1 mAb lead to a synergistic effect. LP17 inhibited the NF-κB activation induced by the engagement of TREM-1 but did not alter the effect of LPS (Fig. 2 B).

Serum sTREM-1 Levels of LPS-treated Mice Are Increased.

To determine whether sTREM-1 was released systemically during endotoxemia in mice, we measured serum sTREM-1 levels after LPS administration. Serum sTREM-1 was readily detectable 1 h after administration of an LD₅₀ dose of LPS and was maintained at peak plateau levels from 4 to 6 h after LPS treatment (Fig. 3).

LP17 Protects Endotoxemic Mice from Lethality.

Mice treated by a single dose of LP17 60 min before a lethal dose (LD₁₀₀) of LPS were prevented from death in a dose-dependent manner (Fig. 4 A). To investigate whether LP17 treatment could be delayed until after the administration of LPS, we injected LP17 beginning 4 or 6 h after LPS injection. This delayed treatment up to 4 h conferred significant protection against an LD₁₀₀ dose of LPS (Fig. 4 B). No late death occurred over 1 wk, indicating that LP17 did not merely delay the onset of LPS lethality but provided lasting protection. Control mice all developed lethargy, piloerection, and diarrhea before death. By contrast, LP17-treated mice remained well groomed and active, had no diarrhea, and were lively. To clarify the mechanism by which LP17 protected mice from LPS lethality, we determined the serum levels of TNF-α, IL-1β, and sTREM-1 of endotoxemic mice at 2 and 4 h. Compared with controls, pretreatment by 100 μg of LP17 reduced cytokines levels by 30% and increased sTREM-1 levels by twofold (Table I).

Engagement of TREM-1 Is Lethal to Mice.

To further highlight the role of TREM-1 engagement in LPS-mediated mortality, mice were treated with agonist anti–TREM-1 mAb in combination with the administration of an LD₅₀ dose of LPS. This induced a significant increase in mortality rate from 50 to 100% (Fig. 4 C).

LP17 Protects Mice from CLP-induced Lethality.

To investigate the role of LP17 in a more relevant model of septic shock, we performed CLP experiments (Fig. 5 A). The control groups comprised mice injected with normal saline or with the control peptide. In this model of polymicrobial sepsis, LP17 still conferred a significant protection against lethality even when administered as late as 24 h after the onset of sepsis. Interestingly, repeated injections of LP17 had the more favorable effect on survival (P < 0.01). There was a dose–response effect of LP17 on survival (Fig. 5 b) and cytokines production (Table II). LP17 had no effect on bacterial clearance (Fig. 6).