Shp-1 mediates the anti-proliferative activity of TIMP-2 in human microvascular endothelial cells

Cell Lines, Growth Factors, and Antibodies

Human microvascular endothelial cells (hMVECs) and growth factors were purchased from commercial sources and used as previously described (6). The following antibodies were also purchased from commercial sources; anti-PTP1C/Shp-1 and anti-p27^Kip1 (BD transduction laboratories); anti-Cdk2, cyclin E, p16^INK4a, Cdk4 and cyclin D (Upstate Biotechnology); anti-p27^Kip1 (T187) and p27^Kip1 (S10) (Zymed laboratories); anti-p21^WAF1/CiP1, Shp-2, Skp2, α3, and lamin B, actin antibodies, mouse and rabbit IgG-horseradish peroxidase conjugate (Santa Cruz Biotechnology). Rb-C fusion protein and polyclonal antibodies against phospho-pRb (S780), phospho-pRb (S807/811) and pRb were from Cell Signaling. TIMP-2 and Ala+TIMP-2 were prepared and characterized as described previously (10).

Immunoprecipitation and Western Blot Analysis

Subconfluent cells in gelatin-coated 100 mm dishes were serum-starved for 24 h in endothelial cell basal medium and replaced with fresh media, at 37 °C. Cells were then pretreated with or without TIMP-2 or Ala+TIMP-2 (50 nM) for 15 min prior to growth factor (FGF-2 or VEGF-A, 50 ng/mL) stimulation for 24 h, unless otherwise noted. After treatment with growth factors and/or TIMP-2, cell lysates were prepared, clarified and the supernatants subjected to immunoprecipitation and Western blot as described previously (6).

Cell Cycle Assay by Flow Cytometry

For cell cycle analysis, hMVECs following FGF-2 stimulation in the presence or absence of TIMP-2 were harvested with trypsin-EDTA and washed in phosphate-buffered saline (PBS), and then fixed with ice-cold 70% ethanol for at least 1 h. After cells were treated with RNase, DNA was stained with propidium iodide. The profile of cells in the G₀/G₁, S, and G₂/M phases of the cell cycle were analyzed with a FACScan flow cytometer.

Cell Growth Assays

The p27^+/+ and p27^−/− immortalized MEFs, plated on 96-well plates (4×10³ cells/well) were serumstarved for 36 to 48 h prior to treatment with TIMP-2 or Ala+TIMP-2. Following subsequent growth factor stimulation and culture for 48 h, the cell numbers were quantified as previously described (6).

Northern Blot Analysis

Northern blots analysis was performed using standard techniques. Blots were sequentially hybridized with [³²P]-labeled cDNA probes (p27^Kip1 and GAPDH) for 14 h at 42°C in prehybridization/hybridization buffer (Quality Biologicals). The probes for p27^Kip1 and GAPDH were prepared using PCR products by High Prime DNA labeling kit (Roche Diagnostics Corp.). After hybridization, the blots were washed in 2X SSC, 0.1% SDS at room temperature and in 0.2X SSC, 0.1% SDS at 42°C before autoradiography at −80°C.

In Vitro Cyclin-Dependent Kinase Assays

For pRb kinase assays, anti-Cdk4 and anti-Cdk2 immunoprecipitates were rinsed three times with lysis buffer, and once with kinase buffer (20 mM Tris-HCl, pH 7.4, 10 mM MgCl₂, 1 mM DTT, 0.1 mM EDTA, 10 μg/ml 4-(2-aminoethyl) benzene sulfonyl fluoride, 1 μg/ml aprotinin, 0.1 μg/ml pepstatin A, 0.05 μg/ml leupeptin, 8 mM β-glycerophosphate, 2.5 mM NaF and 0.1 mM sodium orthovanadate) and re-suspended in 40 μl of kinase buffer containing 20 μg/ml Rb-C fusion protein (Cell Signaling), 50 μM ATP, and 10 μCi of [γ-³²P]ATP (ICN Biomedical Inc., 6000 Ci/mmol) and incubated for 20 min at 30 °C. The reaction was terminated with 10 μl of 5X SDS-sample loading buffer, boiled for 5 min, and resolved by SDS-PAGE. Phosphorylation of substrate was visualized by autoradiography and quantified by the use of National Institutes of Health (NIH) Image 1.6 software.

siRNA Preparation and Transfection

For design of siRNA inserts, a cDNA sequence of integrin α3 AGCAACACAGACTACCTGGAG was selected according to the InvivoGen’s siRNA Wizard program based on a BLAST search. As a control we used the following scrambled oligonucleotide sequence AGCATATGTGCGTACCTAGCT available pre-packaged in the psiRNA-hH1zeo vector (InvivoGen).

Both the siRNA-targeting integrin α3 gene and control sequences were cloned into psiRNA-hH1zeo vector (InvivoGen), and these vectors are designated psiRNA-hH1zeo-α3 and psiRNA-hH1zeo-scr, respectively. These vector constructs were transfected into A549 lung carcinoma cells using LyoVec (InvivoGen) according to the manufacturer’s protocol. After 48 h the cells were selected with zeocin in DMEM containing 10% FBS for 1-2 weeks until colony formation.

Dominant Negative Shp-1 Adenovirus

The role of Shp-1 on TIMP-2-mediated cell growth arrest was investigated using dominant negative Shp-1 adenovirus as previously described (6). Briefly, the pcDNA3.1 vector containing wild type human Shp-1 (PTPN6) cDNA was first constructed and the Shp-1 dominant-negative mutant was constructed by using the QuikChange site-directed mutagenesis kit (Stratagene) to convert the active site cysteine to a serine residue (C453S). Replication defective, human adenovirus (Ad5ΔE1ΔE3) with both wild type (wtShp-1) and the C453S mutation (dnShp-1) sequences of Shp-1 were generated using the AdEasy Vector System (Qbiogene). Expression of dn Shp-1 in adenovirus-infected cells was verified by Western blotting using anti-PTP1C/Shp-1 antibody (BD biosciences) and PTP assay (Upstate Biotechnology) of whole cell lysates.

Subcellular Fractionation

Following treatments as indicated, hMVECs were rinsed twice with ice-cold PBS and cytoplasmic and nuclear extracts were prepared using NE-PER nuclear and cytoplasmic extraction reagents (Pierce) following manufacturer’s instructions.

Immunofluorescence Analysis

For p27^Kip1 immunofluorescence, the hMVECs were grown on glass cover slips in 6-well plates, following FGF-2 stimulation in the presence or absence of Ala+TIMP-2, were fixed with 4% paraformaldehyde for 20 min, washed with PBS, and incubated with PBS containing 10% normal goat serum (NGS) and 0.2% Triton X-100 for 30 min. Primary antibody diluted 1:500 in 1% NGS-PBS was incubated for overnight at 4°C followed by Alexa 488-conjugated anti-mouse antibody (Molecular Probes). The slides were sealed using Vectashield mounting medium with DAPI (Vectashield) for nuclei counterstaining. Images were obtained with a SPOT digital camera (Model 1.3.0, Diagnostic Instruments, Inc.) attached to Zeiss Axioskop microscope (Zeiss Plan-neofluor 100X/1, 30 oil objective lenses, Carl Zeiss Inc.).

Directed In Vivo Angiogenesis assays

Wild type and homozygous motheaten viable (me^v/me^v) mice were generated from the intercrosses of me^v/+ mice and genotyped by PCR detection of wild type and mutant Shp-1 loci from the tail genomic DNA as previously reported (15). Quantification of the angiogenic responses in both wild type and motheaten viable mice were performed using the directed in vivo angiogenesis assay (DIVAA) as previously described (6,16). Briefly, angioreactors were filled with cold matrigel alone (negative controls), or matrigel containing 500 ng/mL of either FGF-2 or VEGF-A. To test for in vivo antiangiogenic activity, angioreactors were filled with matrigel containing FGF-2 or VEGF-A plus either TIMP-2 or Ala+TIMP-2 (200 nM). Filled angioreactors were implanted subcutaneously in the dorsal flank of wt or me^v/me^v mice. Angioreactors were recovered at day 11 following tail vein injection of 100 μL of 25 mg/mL FITC-dextran (MW 150 kDa). All data are obtained using a single angioreactor per mouse with experiments performed in quadruplicate. Negative controls show slight background fluorescence but contain no vessels or endothelial cells upon histological examination (16).

TIMP-2 treatment results in pRb hypo-phosphorylation and inhibits G₁ to S phase transition

In previous studies we demonstrate that TIMP-2 treatment of hMVECs prior to stimulation with angiogenic growth factors, such as FGF-2 or VEGF-A, inhibits both ³H-thymidine incorporation and cell growth (6,17). These studies suggest that TIMP-2 prevents entry of cells into the S phase of the cell cycle, which is usually associated with mitogenic growth factor stimulation. In the G₁ phase of the cell cycle, retinoblastoma protein (pRb) is sequentially phosphorylated by cyclin-dependent kinase (Cdk) activities, and this hyper-phosphorylation of pRb controls the transition from G₁ to S phase of the cell cycle (18). We examined the effect of TIMP-2 pretreatment on the pRb phosphorylation status in hMVECs. Specifically, we analyzed the phosphorylation of pRb on residues S780 and S807/811, sites specific for Cdk4 and Cdk2 phosphorylation, respectively (19). As anticipated, FGF-2 stimulation for 24 h significantly increases pRb phosphorylation at both sites when compared with quiescent hMVECs. However, pretreatment with TIMP-2 or the Ala+TIMP-2 mutant, lacking MMP inhibitory activity, completely blocks FGF-2-induced pRb phosphorylation to levels observed in untreated cells, Figure 1A. This finding is consistent with TIMP-2 preventing S phase entry, possibly through inhibition of Cdk activities.

In addition, we studied the effects of TIMP-2 or Ala+TIMP-2 pretreatment on cell cycle by DNA content flow cytometry. Cell cycle analysis of hMVECs following FGF-2 stimulation for 24 h increases the percentage of cells in S phase approximately two-fold compared with untreated cells (6.6 % vs. 12.2%), along with a concomitant reduction of cells in G₁ phase (70 % vs. 62 %), Figure 1B. This twofold increase in S phase is consistent with our previous cell growth experiments (6). However, pretreatment with TIMP-2 or Ala+TIMP-2 prior to FGF-2 stimulation prevents the anticipated increase in S phase associated with FGF-2 mitogenic stimulation and leads to a corresponding increase in cells in G₁ phase (70%) compared to hMVECs treated with FGF-2 alone (62 % in G₁). Pretreatment with either TIMP-2 or Ala+TIMP-2 alone did not alter the cell cycle pattern of hMVECs when compared with untreated cells (data not shown). These data are consistent with the pRb phosphorylation studies (Figure 1A), as well as previous reports demonstrating that TIMP-2 inhibits ³H-thymidine incorporation upon FGF-2 stimulation (17). Collectively, these data suggest that TIMP-2 pretreatment inhibits the G₁ to S phase transition of the cell cycle, resulting in G₁ arrest.

TIMP-2 enhances de novo synthesis of p27^Kip1

It is currently appreciated that transition of cells from G₁ to S phase specifically requires activation of Cdks, such as Cdk4 and Cdk2 through complex formation with their cognate regulatory subunits, cyclin D and cyclin E, respectively (18). The kinase activity of these complexes is regulated by Cdk inhibitors (CKIs), such as p21^WAF1/Cip1 and p27^Kip1, which inhibit a wide range of Cdks, as well as p15 and p16 members of the INK family that selectively inhibit cyclin D/Cdk4/6 complexes (20). Enhanced expression of these inhibitors attenuates proliferative responses in a variety of cells, whereas reduced levels of the CKIs are associated with S phase entry and increased cellular proliferation. Thus, we analyzed the expression of CKIs associated with the G₁ to S phase transition. Following FGF-2 stimulation for 24 h the levels of p27^Kip1 expression are markedly reduced to ~20 % of levels observed in untreated cells. In contrast the levels of p16^INK4A and p21^WAF1/Cip1 show little or no change following FGF-2 stimulation alone. This decrease in p27^Kip1 following mitogenic stimulation is expected, as previous studies have demonstrated increased proteasomal degradation of this protein prior to S phase entry (21).

Ala+TIMP-2 prevented the FGF-2-mediated decrease in p27^Kip1 protein levels, Figure 2A. Ala+TIMP-2 pretreatment also slightly reduced the levels of p21^WAF1/Cip1, but no change in p21^WAF1/Cip1 levels was observed following FGF-2 treatment alone. These findings suggest that TIMP-2 may suppress FGF-2-stimulated hMVEC proliferation by augmenting expression of the Cdk inhibitor p27^Kip1. Increased cellular levels of p27^Kip1 are indicative of G₁ cell cycle arrest, as previously demonstrated (22), and are consistent with the G₁ arrest of endothelial cell growth following TIMP-2 treatment.

The regulation of cellular p27^Kip1 levels is complex, involving both de novo protein synthesis and/or protein degradation via the proteasomal pathway (23). To examine possible mechanisms via which TIMP-2 increases cellular p27^Kip1 levels we examined the time course of p27^Kip1 expression during the growth inhibition experiments. FGF-2 stimulation of hMVECs results in a slight increase (< 30%) in p27^Kip1 mRNA expression over 24 h, Figure 2B, whereas FGF-2 decreased p27^Kip1 total protein levels below those observed in controlcells, Figure 2C. These findings are consistent with the patterns of p27^Kip1 mRNA and total cellular protein levels observed following stimulation by a variety of mitogenic factors (21).

In contrast, pretreatment with Ala+TIMP-2 prior to FGF-2 stimulation results in statistically significant increases in both p27^Kip1 transcripts and protein levels, Figure 2B and 2C. This increase is detectable as early as 3 h, with maximal p27^Kip1 transcript levels increased ~2-fold over untreated cells. Treatment of hMVECs with Ala+TIMP-2 prior to FGF-2 stimulation results in a > 60 % increase in p27^Kip1 protein levels as early as 3 h that gradually decreased over the time course of this experiment. hMVECs treated only with TIMP-2 show increased levels of p27^Kip1 protein that remain elevated throughout the time course of these experiments. These findings suggest that treatment with FGF-2 and Ala+TIMP-2 stimulates de novo protein synthesis as evidenced by the increase in total cellular p27^Kip1 protein and transcript levels at the early (3-6 h) time points. However, the cellular levels of p27^Kip1 present at 24 h (Figure 2A) are the result of balance between de novo synthesis and protein turnover.

To directly examine the contribution of de novo synthesis of p27^Kip1 to the TIMP-2-mediated growth arrest of hMVECs we studied TIMP-2-mediated changes in p27^Kip1 levels in the presence of the protein synthesis inhibitor cycloheximide (CHX, 10 μM). CHX treatment completely abrogated the TIMP-2-mediated induction of p27^Kip1 expression in FGF-2 stimulated hMVECs, Figure 2D. In contrast, the proteasome inhibitor lysyl-lysyl-norleucine (LLnL) prevented the marked decrease in p27^Kip1 protein levels normally associated with FGF-2 stimulation, but had little effect on p27^Kip1 protein levels in Ala+TIMP-2 treated cells. These findings are entirely consistent with previous reports demonstrating that mitogenic signaling and S phase entry require reduced cellular p27^Kip1 levels (21) and that agents that block mitogenic responses enhance p27^Kip1 levels either through transcriptional activation and/or inhibition of protein degradation (24). Our findings suggest that the TIMP-2-mediated increase of p27^Kip1 levels is predominantly due to de novo protein synthesis, as evidenced by the CHX effect. Furthermore, inhibition of proteasomal processing in cells treated with Ala+TIMP-2 had no detectable effect of p27^Kip1 levels. This is in contrast to the effect of the proteasome inhibitor, LLnL, following FGF-2 in which the levels of p27^Kip1 protein are markedly increased. These findings suggest that the levels of p27^Kip1 in Ala+TIMP-2 treated cells are the result of a balance of de novo protein synthesis and protein turnover by a non-proteasome-dependent pathway.

TIMP-2 increases p27^Kip1 association with Cdk complexes and inhibits Cdk activity

To investigate if the increase in p27^Kip1 expression observed following Ala+TIMP-2 treatment is involved in cell cycle regulation, we performed p27^Kip1 immunoprecipitation and Western blot analysis for Cdks. We also examined the functional consequence of p27^Kip1 association with these Cdks. Ala+TIMP-2 treatment enhanced the association of p27^Kip1 with both Cdk4 and Cdk2 compared with control and growth factor treated cells, Figure 3A. Furthermore, the kinase activity of both Cdk4 and Cdk2 complexes are reduced in Ala+TIMP-2 treated cells, again compared with both control and growth factor treated cells. Figure 3B. The association of p27^Kip1 with Cdk4 and Cdk2 complexes results in a 26 % and 37 % reduction in pRb-C phosphorylation, respectively, when compared with untreated control cells. However, the actual decreases in the kinase activity of these complexes is much greater when compared with FGF-2 stimulation alone, resulting in a 33% and 52 % decrease in activity for the Cdk4 and Cdk2 complexes, respectively. Collectively, these findings demonstrate that TIMP-2-mediated inhibition of hMVEC cell proliferation in response to FGF-2 is due to the loss of Cdk activity that occurs through increased de novo synthesis of the CKI p27^Kip1. These findings are consistent with pRb hypo-phosphorylation and decrease in S phase observed in our prior experiments. These observations show that the formation of p27^Kip1-inhibitory complexes with specific Cdk/cyclin complexes involved in the G₁ to S phase transition are important in TIMP-2-mediated growth inhibition.

TIMP-2 inhibition of cell growth is impaired in cells lacking p27^Kip1

To demonstrate the absolute requirement for p27^Kip1 in the mechanism of TIMP-2-mediated growth arrest, we examined TIMP-2 effects on growth of p27^+/+ and p27^−/− immortalized murine embryonic fibroblasts (MEFs), Figure 3C. Both of these cells are Shp-1 positive by Western blot analysis of whole cell lysates (data not shown). TIMP-2 and Ala+TIMP-2 treatment completely inhibits FGF-2-stimulated proliferation in p27^+/+ cells. However, p27^−/− cells are unresponsive to TIMP-2 growth inhibitory effect. The suppressive effect of TIMP-2 on cell growth in p27^+/+, and loss in p27^−/− cells are also observed following PDGFs-timulated growth of these MEFs (data not shown). We next performed Western blot analysis of p27^Kip1 expression in both p27^+/+ and p27^−/− cells. The levels of p27^Kip1 expression following FGF-2 stimulation in p27^+/+ cells are markedly reduced (~80%) compared to levels in untreated cells. Ala+TIMP-2 pretreatment of p27^+/+ MEFs induced p27^Kip1 expression and prevented the FGF-2-induced reduction, Figure 3D. These findings are identical to previous results using hMVECs and confirm that p27^Kip1 is a critical regulator of TIMP-2-mediated cell growth arrest.

TIMP-2 induction of p27^Kip1 expression requires α3β1 integrin and PTP activity

We have previously demonstrated that TIMP-2 binding to α3β1 integrin receptor is required for hMVEC growth inhibition (6). To investigate whether α3β1was required for TIMP-2 induction of p27^Kip1, we examine the effects of TIMP-2 on p27^Kip1 expression levels in β1-null MEFs (GD25 cells) and following siRNA disruption of α3 integrin subunit expression in A549 human tumor cells. A549 cells were utilized in these siRNA experiments because of difficulty transfecting primary endothelial cell cultures. Again, both of these cell lines are Shp-1 positive (data not shown).

First we examined the expression of p27^Kip1 following mitogenic stimulation of integrin β1-null MEFs (GD25 cells). We have previously demonstrated that these GD25 cells respond in vitro to PDGF as a mitogen and that PDGF-stimulated growth of these cells is resistant to TIMP-2 inhibition, whereas cells with reconstituted β1 expression (GD25-ß1A cells) are responsive to TIMP-2 inhibition of PDGF-stimulated growth (6). Treatment of β1-null MEFs (GD25 cells) with TIMP-2 prior to PDGF, not only failed to increase, but actually shows a decrease in p27^Kip1 expression, Figure 4A. This is in contrast to the >50% increase in p27^Kip1 levels observed in MEFs with reconstituted β1 integrin subunit expression (GD25-b1A cells), Figure 4A. Targeted disruption of α3 expression by RNA silencing successfully reduced expression of total α3 subunit > 85% as evidenced by Western blot analysis, Figure 4B. This reduction in integrin α3 subunit expression is sufficient to block Ala+TIMP-2-mediated induction of p27^Kip1 expression in A549 human tumor cells, Figure 4B. However, reduced expression of α3 did not prevent the expected FGF-2 reduction in p27^Kip1 expression that occurs through enhanced proteasome processing. Together these findings from the β1-null and α3 siRNA-transduced cells clearly demonstrate that α3β1 integrin signaling events are upstream of p27^Kip1.

We next determined if TIMP-2-mediated induction of p27^Kip1 also requires PTP activity. Initially, we examined the effect of the PTP inhibitor orthovanadate on p27^Kip1 expression following TIMP-2 treatment of hMVECs. Pretreatment of cells with 1 μM orthovanadate completely abrogates the TIMP-2-mediated increase in p27^Kip1 expression, Figure 4C, left panel, but has little effect on cells treated with FGF-2 alone. Previously we have demonstrated that TIMP-2 and Ala+TIMP-2 also inhibit hMVEC proliferation in response to VEGF-A mitogenic stimulation (6). In hMVECs stimulated with VEGF-A, Ala+TIMP-2 pretreatment did increase p27^Kip1 expression, which was also abrogated by orthovanadate, Figure 4C. These findings are in agreement with our prior observations that TIMP-2-induced suppression of FGFR-1- and VEGFR-2-induced mitogenic responses in hMVECs is PTP-dependent (6). Furthermore, these findings also implicate enhanced p27^Kip1 expression in TIMP-2-mediated growth arrest of hMVECs following VEGF-A stimulation. In contrast to observed changes in p27^Kip1, no significant changes in expression of Cdk4, cyclin D, cyclin D3, p53 tumor suppressor protein, or p21^WAF1/Cip1 are observed following orthovanadate pretreatment (data not shown), suggesting that induction of p27^Kip1 levels by TIMP-2 is selectively controlled by PTP activity.

TIMP-2 induction of p27^Kip1 is mediated by Shp-1 activity

Shp-1 is an Src-homology 2 (SH2)-containing PTP that is recruited to multiple receptor complexes as a negative regulator of cell growth in many cell types (25). To examine the requirement for Shp-1 in TIMP-2-mediated induction of p27^Kip1 and hMVEC growth arrest in vitro we analyzed the effects of a dominant-negative (dn), catalytically inactive Shp-1 mutant on the TIMP-2-mediated increase in p27^Kip1 levels. Endogenous Shp-1 protein is expressed in vector control hMVECs, and the transduced dn Shp-1 gene was evaluated by the enhancement in immunoreactive Shp-1 protein that is not associated with an increase in total PTP activity (6). Western blot analysis of control and dn Shp-1 transduced cells demonstrates that expression of dn-Shp-1 did not alter expression of Shp-2, a related PTP that is associated with positive growth regulation, Figure 4D. FGF-2 or VEGF-A stimulation did not alter the expression of Shp-1 or Shp-2 in vector control hMVECs, Figure 4D. The p27^Kip1 protein levels in the presence of FGF-2 or VEGF-A alone in vector control hMVECs were reduced to similar levels observed in previous experiments. In control cells, 24 h treatment with Ala+TIMP-2 and FGF-2 results in similar levels of p27^Kip1 (Figure 4D, left panel) as observed in wild type hMVECs (Figure 2A). However, in dn Shp-1 transduced hMVECs, Ala+TIMP-2 failed to significantly induce p27^Kip1 protein expression levels in either FGF-2 (Figure 4D, left panel) or VEGF-A (Figure 4D, right panel) –stimulated hMVECs. This finding implies that Shp-1 activity is specifically required for TIMP-2-mediated p27^Kip1 up-regulation.

TIMP-2 fails to inhibit angiogenesis in Shp-1-deficient mice

The requirements for α3β1 and the putative involvement of Shp-1 in mediating TIMP-2-enhanced de novo expression of p27^Kip1 are identical to our previous characterization of the mechanism for TIMP-2 inhibition of angiogenesis in vivo. These findings suggest that Shp-1 is a critical mediator of the anti-angiogenic effects of TIMP-2. To test the requirement for Shp-1 in mediating TIMP-2 inhibition of angiogenesis in vivo we utilized the motheaten viable (me^v/me^v) mouse model (26). The me^v/me^v mouse is the result of a spontaneous mutation in the Shp-1 gene that results in severe immunologic defects and autoimmune disorder. These mice express two forms of Shp-1 that have only 20 % of normal Shp-1 activity, but survive to 12 weeks of age in contrast with the motheaten mice which have no detectable levels of Shp-1 activity and a lifespan of only 3 weeks (26).

Angiogenic responses to both FGF-2 and VEGF-A, as well as the ability of TIMP-2 or Ala+TIMP-2 to inhibit these responses were examined in both wild type and m e^v/me^v strains using the DIVAA system as previously described (6,16). The results of these experiments show that in wild type mice both FGF-2 and VEGF-A induce typical angiogenic responses that are both significantly inhibited (~60%-100% inhibition) by inclusion of either TIMP-2 or Ala+TIMP-2, Figure 5. In homozygous m e^v/me^v mice the angiogenic response to FGF-2 is similar to that in wild type animals, although this angiogenic response is now resistant to inhibition with TIMP-2 or Ala+TIMP-2, and is actually enhanced by these reagents. This is in contrast to the angiogenic response to VEGF-A in me^v/me^v which is exaggerated compared with that observed in the wild type animals, but is also resistant to inhibition by Ala+TIMP-2, Figure 5. The lack of sensitivity to the angio-inhibitory activity of TIMP-2 or Ala+TIMP-2 in the me^v/me^v mice is consistent with our proposed role for Shp-1 as a mediator of negative growth regulation in endothelial cells.

TIMP-2 induces p27^Kip1 nuclear localization

The regulation of p27^Kip1 protein expression and localization are complex, but p27^Kip1 must be present in the cell nucleus to inhibit the G₁ to S phase transition. The levels of p27^Kip1 are regulated via transcriptional activation, post-translational modifications (selective phosphorylation) and proteolytic turnover via a proteasome-dependent pathway (21). Nuclear localization of p27^Kip1 is controlled by phosphorylation at either residue S10 or T187. Phosphorylation at either site facilitates nuclear export of p27^Kip1 to the cytoplasm, resulting in a low level of nuclear p27^Kip1. This facilitates the G₁ to S phase transition by releasing Cdk activity from p27^Kip1 inhibition (27,28). Phosphorylation of p27^Kip1 on T187 generates a binding site for Skp2-containing E3 ubiquitin-protein ligase (SCF) that results in subsequent proteasome-dependent degradation (29).

To investigate TIMP-2-mediated regulation of p27^Kip1 localization, we first analyzed the phosphorylation levels of total cellular p27^Kip1. Following FGF-2 treatment alone there is approximately a 2-3-fold increase in phosphorylation of p27^Kip1 on T187 over basal levels, as demonstrated by the increase in the ratio of T187-phospho-p27^Kip1 to total p27^Kip1, Figure 6A. TIMP-2 pretreatment prior to FGF-2 decreased p27^Kip1 phosphorylation levels below those observed in control hMVECs, Figure 6A. Decreased T187 phosphorylation of p27^Kip1 following TIMP-2 pretreatment is consistent with enhanced nuclear localization of p27^Kip1, as phosphorylation at this site results in increased association with Skp2 and subsequent proteasome-dependent turnover (29).

p27^Kip1 localization in the nuclear compartment was also examined directly by Western blot analysis of nuclear and cytosolic extracts of FGF-2-stimulated hMVECs with and without Ala+TIMP-2 pretreatment. As anticipated, phospho-T187- or phospho-S10-p27^Kip1 were not readily detected in the nuclear compartment, Figure 6B, following FGF-2 with or without Ala+TIMP-2 pretreatment. In contrast, Ala+TIMP-2 pretreatment prior to FGF-2 results in a slight decrease in phospho-T187- and phospho-S10-p27^Kip1 localization in the cytosolic compartments, Figure 6B. Total p27^Kip1 was decreased in the nuclear compartment following FGF-2 alone, but increased with Ala+TIMP-2 pretreatment prior to FGF-2 stimulation, Figure 6B. The increase in nuclear localization of p27^Kip1 induced by TIMP-2 pretreatment is abrogated by inclusion of the PTP inhibitor orthovanadate, Figure 6B.

To confirm the changes in nuclear localization of p27^Kip1 observed in these experiments we also examined p27^Kip1 localization by immunofluorescence staining. In quiescent, untreated hMVECs, anti-p27^Kip1 staining reveals strong nuclear localization with weak but detectable cytoplasmic staining at both the 4 and 24 h time points, Figure 6C. In contrast FGF-2 alone shows a slight decrease in the nuclear localization of p27^Kip1 at the 4 h time point that is further accentuated at 24 h, Figure 6C. Ala+TIMP-2 pretreatment prior to FGF-2 results in enhanced nuclear localization of the p27^Kip1 signal, with weak staining of the cytoplasm at both the 4 and 24 h time points. These data confirm the shift from cytoplasmic to nuclear localization of p27^Kip1 following Ala+TIMP-2 treatment observed by Western blotting of cytosolic and nuclear extracts, Figure 6B. Collectively, these findings demonstrate that in addition to inducing de novo synthesis of p27^Kip1 protein, TIMP-2 also enhances nuclear localization of p27^Kip1.