Allogeneic Transplantation Induces Expression of Cytomegalovirus Immediate-Early Genes In Vivo: a Model for Reactivation from Latency

Animals.

Three-week-old female, specific-pathogen-free BALB/c mice and adult male BALB/c (H-2^d), C57BL/6 (H-2^b), and C3H/HeSnJ (H-2^k) mice were purchased from Jackson Laboratory (Bar Harbor, Maine). Breeding pairs of MIEP-lacZ transgenic mice from the TG1JB line (4) carrying the β-galactosidase gene under the control of the HCMV ie promoter were obtained from Jay Nelson at Oregon Health Sciences University. Mice were maintained in isolation cages and were fed and watered ad libitum. This study protocol was reviewed and approved by the Northwestern University Institutional Animal Care and Use Committee.

Virus infection and establishment of MCMV latency.

Three- to 4-week-old mice were injected intraperitoneally with 10⁵ PFU of MCMV (Smith strain) and maintained for 6 months to establish latent infection as previously described (34).

Transplants and organ processing.

Mouse kidney transplants were performed as previously described (80). The right donor kidney from latently infected mice was removed for use as a control, and the left donor kidney was transplanted into syngeneic BALB/c (H-2^d) or allogeneic C57BL/6 (H-2^b) adult males and removed at 1, 2, 5, 8, or 15 days after transplant. Kidneys from MIEP-lacZ transgenic mice were transplanted into allogeneic C3H/HeSnJ (H-2^k) mice and were removed 2 days after transplant. All organs were frozen in liquid nitrogen immediately after removal.

Cytokine injections.

For RNA analysis, mice were injected intraperitoneally with 10 μg of TNF (R & D Systems, Minneapolis, Minn.) or in the tail vein with 2.5 μg of TNF and were sacrificed at various times after injection. No difference in MCMV RNA expression was observed with intraperitoneal or intravenous injections. For gel shifts or analysis of β-galactosidase expression, mice were injected intravenously with 2.5 μg of TNF and were sacrificed after 2 or 24 h, respectively.

RT-PCR analysis.

Mice were anesthetized with Metofane (Schering-Plough) and were sacrificed by cervical dislocation. For RNA extraction, frozen tissues were sonicated in TriReagent (Molecular Systems, Cinncinati, Ohio) to disrupt the tissue and the RNA was purified according to the directions of the manufacturer. Reverse transcriptase PCRs (RT-PCRs) were performed with an RNA PCR kit (Perkin-Elmer Cetus) according to the directions of the manufacturer. RNA (1.5 μg) was reverse transcribed using random hexamer primers, and the cDNA was amplified in 40 cycles of 94°C, 30 s; 58°C, 30 s; and 72°C, 30 s, followed by a 7-min incubation at 72°C. PCR products were electrophoretically separated on 1.5% agarose gels, transferred to nitrocellulose, and hybridized to oligonucleotide probes at 42°C for 2 h. Probes were labeled with fluorescein-dUTP and terminal transferase using an enhanced chemiluminescence 3′ oligonucleotide labeling kit (Amersham) and were detected according to the directions of the manufacturer. The following primers and probes were used to amplify and detect RT-PCR products: for ie1, primer 1, primer 2 (1), 179 bp, probe, CH15 (30); for ie3, CH17 (30), IE3-RT/R (38), 229 bp, probe, CH15 (30); for E-1, forward, reverse (5), 266 bp, probe, GGCAGCGGCAGCGGAGGCAGCAGCGGCCTCAGTACAAAGC; for gB, forward, reverse (5), 400 bp, probe, AACAGAAACCATGTTCTCCGTCTCGTTCACGAAGGGAAC; for TNF, sens, antisens (33), 678 bp, probe, CAGTAGACAGAAGAGCGTGGTGGCCCCTGCCACAAGCAGG; for IL-2, 5′, 3′ (57), 247 bp, probe, GAGCTCCTGAGCAGGATGGAGAATTACAGGAACCTGAAAC; for IFN-γ, sens, antisens (33), 401 bp, probe, GAGCCAGATTATCTCTTTCTACCTCAGACTCTTTGAAGTC; for IL-1β, 5′ AAGCTCTCCACCTCAATGGACAG and 3′ CTCAAACTCCACTTTGCTCTTGA, 260 bp; for β-actin, 5′ TGAGAGGGAAATCGTGCGTG and 3′ ATCTGCTGGAAGGTGGACAGTGAG, 453 bp.

Analysis of lacZ transgene expression.

Histochemical staining of tissue sections from MIEP-lacZ transgenic mice for β-galactosidase activity was performed as previously described (4). β-Galactosidase activity in tissues from MIEP-lacZ transgenic mice was assayed with a Galacto-Star chemiluminescent reporter gene assay system (Tropix PE Biosystems, Bedford, Mass.) in triplicate as described by the manufacturer and was quantitated with a Monolight 2010 luminometer. Protein concentration in the extract was determined by Bio-Rad protein assay, and values were expressed as average light units of β-galactosidase per nanogram of protein.

Electrophoretic mobility shift assay.

Nuclear extracts were prepared from renal and lung tissue as previously described (18), assayed for protein concentration (9), and stored at −80°C. NF-κB and AP-1 consensus oligonucleotides (Promega Co., Madison, Wis.) were labeled with [γ-32]ATP (3,000 Ci/mmol, 10 mCi/ml; Amersham, Arlington Heights, Ill.) using T4 polynucleotide kinase. Extract (3.5 μg) in 10 μl was preincubated with 4 μl of gel shift binding buffer (18) at 25°C for 15 min and was then incubated with 1 μl of probe for 20 min at 25°C and analyzed as previously described (17, 18). Competition experiments were performed by incubation of extracts with a 100-fold excess of unlabeled oligonucleotide containing consensus or mutant NF-κB binding sites (Santa Cruz Biotechnology, Santa Cruz, Calif.) for 20 min prior to addition of the probe. Supershift experiments were performed by incubating extracts, oligonucleotides, and 1 μg of p50, p65, p52, RelB, or c-Rel antibody (Santa Cruz Biotechnology) for 20 min prior to electrophoresis.

Allogeneic transplantation induces ie1 gene expression.

In order to investigate the role of allogeneic stimulation in inducing MCMV lytic cycle gene expression, kidneys from latently infected BALB/c mice were transplanted into uninfected syngeneic BALB/c (H-2^d) or allogeneic C57BL/6 (H-2^b) recipients and were analyzed for expression of MCMV RNAs at various times after transplant. The contralateral donor kidneys were removed at the time of transplant and were analyzed as controls. Representative results of allogeneic and syngeneic transplants removed at days 1, 2, and 5 are shown in Fig. 1. IE1 transcripts were not detectable in most of the control kidneys removed from latently infected donors at the time of transplant, although some expression was observed in some of the controls (e.g., Fig. 1A, lane 8). Expression of IE1 RNA was induced by allogeneic transplantation, with a peak of induction at 2 days posttransplant. On the basis of these results, additional transplants were analyzed at 2 days posttransplant. Expression of IE1 RNA was induced in five of five kidneys transplanted into allogeneic recipients and in zero of four syngeneic transplants harvested 48 h after transplant. Thus, expression of MCMV IE1 RNA was induced by allogeneic transplantation, and this induction was due to the allogeneic response rather than ischemia/reperfusion injury.

RNAs isolated from control and transplanted kidneys were also examined for expression of IE3, an alternatively spliced transcript initiated at the ie promoter; E-1, an early gene product; and gB, a late gene product. No expression of these transcripts was observed, indicating that although the initial phase of viral replication was induced by allogeneic stimulation, full reactivation with lytic replication was not induced (data not shown). The lack of expression of IE1 at later times after transplant and the lack of expression of other genes associated with productive infection are likely to be due to destruction of cells expressing foreign antigens by immune surveillance in these immunocompetent recipients.

NF-κB is activated by allogeneic transplantation.

Regulation of HCMV and MCMV ie gene expression is controlled by the CMV ie promoter/enhancer (8, 20, 68, 72). Both the MCMV and HCMV ie promoter/enhancer regions contain multiple binding sites for NF-κB, as well as other transcription factors (Fig. 2). The NF-κB sites and the ATF(CREB) sites have been shown to be important in regulation of the HCMV promoter (32, 41, 60, 68). The factors important in regulation of the MCMV promoter have not been studied. In order to investigate the effect of transplantation on activation of transcription factors that are likely to be important in controlling MCMV ie gene expression, we performed gel shift analysis on nuclear extracts of kidneys of latently infected mice transplanted into syngeneic or allogeneic recipients (Fig. 3). The contralateral kidney from each donor was removed at the time of transplant and was analyzed as a control. Two NF-κB complexes were observed in extracts of control and transplanted kidneys. Both complexes bound specifically to the consensus NF-κB binding site, since an unlabeled NF-κB oligonucleotide competitively abolished binding, but an oligonucleotide with a mutated NF-κB binding site did not (data not shown). The more slowly migrating complex is a classical NF-κB complex, since it was supershifted by antibodies specific for the p65 and p50 subunits of NF-κB (data not shown). The faster-migrating complex was not supershifted with antibodies to any of the known NF-κB subunits, including p65, p50, p52, c-Rel, and RelB, and its composition is therefore unknown. A slight activation of NF-κB was observed in syngeneic transplants (Fig. 3, left panel, compare lanes 1 and 2 and lanes 5 and 6). This is likely to be due to ischemia/reperfusion injury, which has been previously reported to activate NF-κB. However, much greater induction was observed at day 2 in the allogeneic transplants than in syngeneic transplants (Fig. 3, left panel, compare lanes 7 and 8 with lanes 5 and 6). This coincides with the peak of IE1 RNA expression previously observed in latently infected kidneys transplanted into allogeneic recipients (Fig. 1). Activation of AP-1 was observed in both allogeneic and syngeneic transplants and was therefore due to ischemia/reperfusion injury. Previous reports have demonstrated activation of AP-1 and NF-κB due to ischemia/reperfusion injury and activation of NF-κB due to allogeneic transplantation (10, 14, 81).

Expression of inflammatory cytokines is induced by allogeneic transplantation.

NF-κB is activated by several different mediators of the immune and inflammatory response, including the proinflammatory cytokines IL-1 and TNF. Allogeneic stimulation results in activation of TH1 cells and release of inflammatory cytokines. We therefore analyzed RNAs from transplanted kidneys for expression of TNF, IL-2, IFN-γ, and IL-1 (Fig. 4). Expression of IL-1 was present in control kidneys and was not significantly induced in allogeneic or syngeneic transplants. In contrast, little or no expression of TNF, IL-2, and IFN-γ was observed in control kidneys. Expression of these cytokines was specifically induced after 24 h in allogeneic but not in syngeneic transplants. Induction of ie1 gene expression was observed 24 to 48 h after allogeneic transplantation. Thus, expression of these cytokines was induced prior to or coincident with induction of ie1 gene expression. These data are consistent with the hypothesis that inflammatory cytokines activate transcription factors which induce expression of the ie1 gene. TNF is known to induce activation of both NF-κB and AP-1 (42, 52, 65, 73), and TNF has been shown to induce expression of HCMV ie promoter-driven reporter constructs in vitro via activation of NF-κB (54, 67). These observations suggest that TNF could mediate induction of MCMV ie1 gene expression in vivo in response to allogeneic transplantation.

TNF induces MCMV ie1 gene expression in the lung.

In order to test this hypothesis directly, latently infected mice were injected with recombinant murine TNF and analyzed for ie1 gene expression at various times after injection. Induction of IE1 RNA was consistently observed in lung tissue from latently infected mice 8 to 24 h after injection of TNF (Fig. 5), although the kinetics of induction varied somewhat. No expression of IE1 RNA was detected in the lung at 48 h after injection, and no induction of E-1 or gB transcripts was observed at any time point (data not shown). This is likely to be due to immune destruction of cells expressing IE1 protein in these immunocompetent mice with immunological memory of MCMV. Surprisingly, no induction of IE1 transcripts was observed in kidney, heart, liver, or spleen from latently infected mice injected with TNF.

Gel shift analysis of nuclear extracts of lung and kidney tissue from mice injected with TNF was performed to identify the transcription factors activated by TNF (Fig. 5). As was the case with transplanted kidneys (Fig. 3), two complexes with NF-κB-binding activity were observed. Both complexes bound specifically to the consensus NF-κB binding site, since binding was abolished by excess unlabeled NF-κB oligonucleotide (Fig. 5B, lane 9) but not by a mutant NF-κB oligonucleotide (Fig. 5B, lane 8). Supershift analysis demonstrated that the more slowly migrating complex contained p65 and p50 (data not shown) subunits of NF-κB, while the more rapidly migrating complex was not recognized by antibodies specific for any NF-κB subunit, including p65, p50, p52, c-Rel, and RelB. Injection with TNF induced significant activation of NF-κB in both the lung and the kidney (Fig. 5B). The mobility of the NF-κB complex appeared to be slightly different in kidney and lung extracts, suggesting that the composition of the complex could be different. However, supershift analysis indicated no obvious differences in the compositions of the lung and kidney complexes (data not shown). In contrast, examination of AP-1 activation demonstrated that TNF activated AP-1 in the lung but not in the kidney (Fig. 5C). The mobility of this complex was significantly greater than that present in transplanted kidneys, suggesting that the composition of the AP-1 complex could differ between lung and kidney. Thus, our gel shift analysis indicates that induction of ie1 gene expression correlates with activation of both NF-κB and AP-1, suggesting that NF-κB and AP-1 may act cooperatively to induce MCMV ie1 gene expression. TNF can substitute for allogeneic transplantation in inducing MCMV ie1 gene expression in tissues where both AP-1 and NF-κB are activated.

TNF and allogeneic transplantation induce HCMV ie gene expression.

Both the HCMV and MCMV ie promoter/enhancer regions contain multiple NF-κB consensus binding sites (20, 32, 60, 68, 72). Previous studies have demonstrated that HCMV ie promoter-driven reporter constructs are induced by TNF in vitro by activation of NF-κB (54, 67). To investigate the response of the HCMV ie promoter/enhancer region to TNF and allogeneic transplantation, we used MIEP-lacZ transgenic mice carrying a β-galactosidase reporter gene under the control of the HCMV ie promoter/enhancer (4). As reported previously, expression of the transgene was observed in the kidneys of untreated transgenic mice (4). Injection with TNF induced a higher level of expression of the transgene (Fig. 6A). The extent of induction was determined using a quantitative chemiluminescence assay for β-galactosidase activity. Injection with TNF resulted in a statistically significant induction in β-galactosidase activity which is more than twofold higher than that found in controls (P = 0.01) (Fig. 6B). Preliminary studies with injection of IL-1, which also induces activation of NF-κB, and with IFN-γ, which activates JAK/STAT signaling, did not show any induction of the transgene and were not pursued further.

In order to investigate the response of the HCMV ie promoter/enhancer to allogeneic stimulation, kidneys from transgenic mice were transplanted into allogeneic C3H/HeSnJ (H-2^k) recipients, and the level of β-galactosidase activity was compared with that found in the control contralateral kidney. Because the transgenic mice were derived by injecting the transgene into the ova of mice heterozygous at the H2 locus, it was not possible to perform syngeneic transplants with these mice. However, it is clear from a comparison of the transplanted and contralateral control kidneys that allogeneic transplantation resulted in a statistically significant induction of ie promoter/enhancer activity of approximately threefold at 2 days posttransplant (P = 0.001). While differences in the context of a gene may influence its expression, the results with the MIEP-lacZ transgenic mice indicate that both TNF and allogeneic transplantation induce HCMV ie gene expression. These results are consistent with our studies of latently MCMV-infected mice, in which the ie promoter/enhancer is in its natural context in the viral genome, and with previous studies of regulation of the HCMV ie promoter/enhancer (54, 67).