Mucosal Immunization of Cynomolgus Macaques with Two Serotypes of Live Poliovirus Vectors Expressing Simian Immunodeficiency Virus Antigens: Stimulation of Humoral, Mucosal, and Cellular Immunity^†

Recombinant poliovirus construction and DNA procedures.

PCRs to construct the recombinant viruses used recombinant Tth (rTth) polymerase (Perkin-Elmer, Branchburg, N.J.) under conditions recommended by the manufacturer. Poliovirus type 1 (Polio1) cDNA (Mahoney strain) was used as the template DNA to generate the type 1 poliovirus recombinants. The Sabin 2 (Sabin2) cDNA template was generated by infecting HeLa cells with an S0+3 stock (the original Sabin virus isolate passaged three additional times), which was the kind gift of Konstantin Chumakov (Food and Drug Administration, Bethesda, Md.). Total RNA from infected cells was prepared by phenol-chloroform extraction at 9 h postinfection and precipitated with ethanol. Reverse transcription was carried out with Superscript II (Life Technologies, Gaithersburg, Md.) with either random hexamer or oligo(dT) primers. This Sabin2 cDNA was used as template DNA to generate the Sabin2 poliovirus recombinants. SIVmac239 plasmids p239SpSp5′ and p239SpE3′ (obtained from the AIDS Research and Reference Reagent Program, courtesy of Ronald Desrosiers [22]) were used as PCR templates to generate SIV inserts. The 5′ half of the Polio1 genome (Polio 5′ Arm) was amplified with primers 1 and 2, and Polio 3′ Arm was amplified with primers 3 and 4. An EcoRI restriction site was introduced at the P1-P2 junction of Polio 5′ Arm, and a XhoI site was introduced at the P1-P2 junction of Polio 3′ Arm. Proteolytic cleavage sites flanking the restriction sites were designed to be nonhomologous, and a five-glycine linker was introduced upstream of the EcoRI site on the 5′ side of the P1-P2 junction, creating a construct comparable in design to pMov2.11 (61). Restriction enzyme cleavage of the PCR products was done prior to hybrid PCR to generate clean termini at the SIV gene fragment insertion site. When necessary, PCR products were purified by agarose gel electrophoresis and recovered with a Qiagen (Valencia, Calif.) gel extraction kit. Polio1 SIV inserts were generated with primers 5 and 6 (p17), 7 and 8 (gp41), and 9 and 10 (p28). For Sabin2, Polio 5′ Arm was amplified with primers 11 and 12, and Polio 3′ Arm was amplified with primers 13 and 14. Sabin2 inserts were generated with primers 15 and 16 (gp41), 17 and 18 (p17), and 19 and 20 (p28). The Sabin2 insert cloning site was identical to that of Polio1, except the restriction sites were reversed (XhoI at 5′ and EcoRI at 3′).

Hybrid PCRs were carried out with approximately 200 ng of Polio 5′ Arm template DNA and equimolar amounts of Polio 3′ Arm and the SIV DNA fragment. PCR conditions were as follows: 95°C for 3 min, and then rTth polymerase was added and 11 cycles of PCR were carried out at 95°C for 1 min, 50°C for 1 min, and 72°C for 4 min. Primers 1 and 4 were used to amplify the Polio1 recombinants, and primers 11 and 14 were used to amplify the Sabin2 recombinants.

Full-length viral RNA was generated from hybrid PCR DNA with T7 RNA polymerase and 1 μg of the template in a standard in vitro transcription reaction mixture (10× transcription buffer from Roche Molecular Biochemicals [Indianapolis, Ind.] and 20 U of RNasin [Promega, Madison, Wis.]) at 37°C for 1 h. The presence of full-length RNA was confirmed by agarose gel electrophoresis.

Replication-competent recombinant polioviruses were recovered by transfecting adherent HeLa S3 cells with 5 μg of RNA by the DEAE-dextran method (61), overlaying the monolayer with 1% agar–Dulbecco modified Eagle medium (DMEM) plus 10% newborn calf serum (Life Technologies), incubating the cells at 32°C, and picking individual viral plaques 5 days posttransfection. Individual plaques were then passaged twice on HeLa cells, with the first passage at a multiplicity of infection (MOI) of 0.001 and the second at an MOI of 1, to generate the P2 stocks of 10 to 100 ml of virus used for immunizations.

Viral infections and stocks.

In all experiments, 80%-confluent 10-cm-diameter dishes of HeLa cells containing approximately 5 × 10⁶ cells were used. Dishes were washed with phosphate-buffered saline (PBS), and virus was added at the desired MOI in a volume of 200 μl. Dishes were incubated at room temperature for 15 min to allow viral adsorption, and then 3 ml of medium was added and dishes were incubated at 32°C (5% CO₂) until cytopathic effect was visible. Virus was recovered by centrifugation of the cells and medium at 3,000 × g for 5 min followed by three quick freeze-thaw cycles. After recentrifugation, the cleared supernatant containing recombinant poliovirus was transferred to a fresh tube and stored at −20°C.

Neutralization assays were carried out with the desired volume of monkey serum (25 to 90 μl) mixed with 1,000 PFU of the appropriate virus (Polio1 [Mahoney strain] or Sabin2) in a 100-μl total volume (brought to volume with PBS). Serum was incubated with virus for 30 min at room temperature, and then serial dilutions were made and added to HeLa cell dishes for 15 min to allow for viral adsorption. Plates were washed once with PBS before adding 1× DMEM–F12 and 1% agar overlay. Plaque assays were then incubated at 37°C for 2 days (Polio1 assays) or 3 days (Sabin2 assays). Agar overlays were then removed, and plates were stained with a vital dye (0.1% crystal violet, 20% ethanol) to reveal the viral plaques, which were counted. Ninety percent neutralization was established as a 10× reduction in the number of plaques compared to the number of plaques counted on a control plate lacking monkey serum or containing preimmune monkey serum.

RT-PCR.

The presence of the SIV gene fragments in the recombinant polioviruses was confirmed by reverse transcription-PCR (RT-PCR). Total RNA was isolated from cells at 9.5 h postinfection with RNeasy (Qiagen) per the manufacturer’s protocol. cDNA was generated by RT with Superscript II (Life Technologies) and oligo(dT) primers by following the manufacturer’s recommended protocol. PCR was carried out with PfuTurbo (Stratagene, La Jolla, Calif.) with the manufacturer’s recommended reagents and under the following conditions: 95°C for 3 min and then 30 cycles of 95°C for 1 min, 50°C for 1 min, and 72°C for 1 min. PCR products were analyzed on a 1.2% agarose gel buffer. Primers used for Polio1 recombinants were designated primers 21 and 22. Primers for Sabin2 were designated primers 23 and 24.

Western blotting and immunofluorescence.

Expression of the SIV antigens by the recombinant polioviruses was confirmed by Western blotting and immunofluorescence assays. For Western blotting, HeLa cells infected with wild-type or SIV-recombinant polioviruses (MOIs of 1 to 5) were incubated for 9 h at 37°C. Cells were harvested and lysed on ice for 1 min (lysis buffer consisted of 10 mM Tris [pH 7.5], 140 mM NaCl, 5 mM KCl, and 1% NP-40), and nuclei were removed by centrifugation (3). Four micrograms of total lysates was loaded on a sodium dodecyl sulfate–12% polyacrylamide gel and analyzed by immunoblotting. The anti-SIV antiserum used was obtained as a pool of serum from SIV-infected rhesus macaques (Macaca mulatta). Antiserum directed against poliovirus capsid proteins was obtained by inoculating rabbits with purified poliovirus. Horseradish peroxidase-conjugated secondary antibodies (both anti-human and anti-rabbit), and enhanced-chemiluminescence detection kits were obtained from Amersham (Arlington Heights, Ill.).

Western blots were also used to test for monkey anti-poliovirus antibodies. In these experiments, HeLa cells were infected at an MOI of 5 with Polio1 (Mahoney strain) or Sabin2 or left uninfected. Cells were harvested at 5 h (Polio1) or 5.5 h (Sabin2) postinfection and lysed, and nuclei were removed by centrifugation. The protein concentrations were quantified by Bradford assay, and 25 μg of total lysate was run on a sodium dodecyl sulfate–12% polyacrylamide gel before being blotted. Blots were probed with 1:200-diluted monkey serum in TBST (10 mM Tris-HCl [pH 7.5], 150 mM NaCl, 0.1% Tween 20), washed three times, probed with the horseradish peroxidase anti-human antibody (1:2,000 dilution), and then detected by enhanced chemiluminescence. Images were digitally scanned and exported to Photoshop 3.0 and Illustrator 7.0 (Adobe, San Jose, Calif.).

For immunofluorescence assays, adherent HeLa cells infected with wild-type and SIV-recombinant polioviruses (MOI of 0.3) were incubated for 9 h at 37°C. Cells were then fixed with 2% paraformaldehyde and stained with the appropriate primary antibody for 1 h at 25°C in a PBS buffer supplemented with 3% bovine serum albumin and 0.2% saponin buffer. After three PBS washes, cells were stained with secondary antibody for 1 h at 25°C in an identical buffer. Anti-SIV and anti-poliovirus antibodies were as described above. Anti-rabbit immunoglobulin G (IgG) conjugated to Texas Red and anti-monkey IgG conjugated to fluorescein isothiocyanate (FITC) secondary antibodies were obtained from Amersham. Stained cells were visualized for immunofluorescence with a Leica DMLB microscope, and images were captured via a charge-coupled-device camera and exported to Adobe Photoshop 3.0.

Oligonucleotides.

The oligonucleotides used were as follows: 1 (TAATACGACTCACTATAGGTTAAAACAGCTCTGGGGTTGT [S1-T7]), 2 (GAGTTTCTCACGCCGAATTCACCTCCCCCACCTCCGCCATGACCAAAACCGTAAGTCGTTAAGTCCTTGGTGGAGAGGGGTG [RA5′3′]), 3 (GAAATTACCTCGAGGATCTGACCACATATGGATTCGGACACCAAAACAA[RA3′ 5′]), 4 (TTTTTTTTTTTTTTTTTTCTCCGAATTAAAGAAAAATTTACCCC [Mo3′]), 5 (GGAGGTGGGGGAGGTGAATTCGGCGTGAGAAACTCC GTC [Sp175′]), 6 (ATAGTGGGTCCTCGAGGTAATTTCCTCCTCTGCC [Sp173′]), 7 (GGAGGTGGGGGAGGTGAATTCCCATGGCCAAATGCA [Gp41.b5′]), 8 (ATAGTGGGTCAGATCCTCGAGGGAAGAGAACACTGG [Gp41.b3′]), 9 (GGAGGTGGGGGAGGTGAATTCCCAGTACAACAAATAGGT [Sp275′]), 10 (ATAGTGGGTCAGATCCTCGAGCATTAATCTAGCCTTCTG [Sp283′]), 11 (TAATACGACTCACTATAGGTTAAAACAGCTCTGGGGTTG [S2-T7]), 12 (TTTGGCCATGGCTCGAGACCTCCCCCACCTCCGCCATGACCAAAACCATAAGTCGTTAATCCCTTTTC [S25′3′]), 13 (CTCTTCCGAAT TCGAC T TAACGAC T TACGGAT T TGGACACCAAAACAAAGCTGTGTACACAGCTGGCTA [S23′5′]), 14 (TTTTTTTTTTTTTTTTTTTCCCCGAATTAAAGAAAAATTTACCCC [S23′]), 15 (GAAAAGGGATTAACGACTTATGGTTTTGGTCATGGCGGAGGTGGGGGAGGTCTCGAGCCATGGCCAAATGCAAGT [S2gp41.5′], 16 (GTACACAGCTTTGTTTTGGTGTCCAAATCCGTAAGTCGTTAAGTCG AATTCGGAAGAGAACACTG GCCT [S2gp41.3′]), 17 (GAAAAGGGATTAACGACTTATGGTTTTGGTCATGGCGGAGGTGGGGGAGGTCTCGAGGGCGTGAGAAACTCCGTC  [S2sp17.5′]),18 (GTACACAGCTTTGTTTTGGTGTCCAAATCCGTAAGTCGTTAAGTCGAATTCGTAATTTCCTCCTCTGCC [S2sp17.3′]), 19 (GAAAAGGGATTAACGACTTATGGTTTTGGTCATGGCGGAGGTGGGGGAG GTCTCGAGCCAGTACAACAAATAGGT [S2sp28.5′]), 20 (GTACACAGCTTTGTTTTGGTGTCCAAATCCGTAAGTCGTTAAGTCGAATTCCATTAA TCTAGCCTTCTG [S2sp28.3′]), 21 (CCTCCAAAATCAGAGTGTATC [P1-3240F]), 22 (GCCCTGGGCTCTTGATTCTGT [P1-3580R]), 23 (CACCTCCAAGATCAGAGTGTA [S2-3240F]), and 24 (ATCGAGTCGGTGCCAAGGGCC [S2-3540R]).

Animals.

All animals used in this study were mature, cycling, female cynomolgus macaques (Macaca fascicularis, referred to as Macaca iris in older literature) from the California Regional Primate Research Center. The animals were housed in accordance with American Association for Accreditation of Laboratory Animal Care standards. When necessary, animals were immobilized with 10 mg of ketamine HCl (Parke-Davis, Morris Plains, N.J.) per kg of body weight, injected intramuscularly. The investigators adhered to the Guide for the Care and Use of Laboratory Animals prepared by the Committee on Care and Use of Laboratory Animals of the Institute of Laboratory Resources, National Resource Council. Prior to use, animals were negative for antibodies to HIV-2, SIV, type D retrovirus, and simian T-cell leukemia virus type 1.

Intranasal inoculations were done in a total volume of 1 ml. The animals were anesthetized and placed in dorsal recumbancy with the head tilted back. One-half milliliter of virus was instilled dropwise into each nostril. The animals were kept in this position for 10 min and then placed in lateral recumbancy until recovery from the anesthesia (21). Intravenous inoculations were administered in the arm in a volume of 1 ml. Five cynomolgus macaques originally received the first series of intranasal inoculations with Polio1-p17 and Polio1-gp41. One monkey developed paralytic disease 3 weeks later and was euthanized; the central nervous system infection of this monkey was most likely via direct infection of the olfactory bulb, which is a specific alternative pathway of poliovirus infection of macaques and irrelevant to this study since it is not a route of infection in humans (10, 36).

Serum antibody and vaginal and rectal lavage antibody responses.

Anti-SIV IgG and IgA responses in vaginal and rectal washes and serum were measured at regular time points during the study. Vaginal and rectal wash samples were collected and analyzed as previously described (27, 34). Briefly, vaginal washes were collected by infusing 6 ml of sterile PBS into the vaginal canal and aspirating the instilled volume. Rectal washes were collected in a comparable manner. Samples were immediately snap-frozen on dry ice and stored at −80°C until analysis. To account for the presence of IgG interfering with and reducing the detection of IgA, sera were first depleted of IgG with protein G-Sepharose beads (Pharmacia Biotech, Uppsala, Sweden) prior to use in the IgA enzyme-linked immunosorbent assay (ELISA). To deplete IgG, 25 μl of a serum sample was incubated with 100 μl of protein G-Sepharose beads for 1 h at 37°C and then at 4°C overnight; next, the protein G-Sepharose was pelleted and the supernatant was collected. Dilution of sample during this process was 1:3. All serum and secretion samples were initially screened for reactivity against whole SIV with 1:100 final dilutions of sera and 1:4 dilutions of vaginal or rectal washes. The change in optical density at 490 nm (ΔOD) between test and control wells was defined as the difference between the mean OD of the sample tested in two antigen-coated wells and the mean OD of the sample tested in two antigen-free control wells. The negative-control OD value was determined from 12 uninfected monkey serum samples and defined stringently as the average OD plus 3 standard deviations. Endpoint titers were determined if the ΔOD of the test sample exceeded the negative-control value by a factor of 2. To then quantify anti-SIV antibody titers, serial fourfold dilutions of duplicate samples of serum, vaginal wash, or rectal wash were tested by ELISA with whole pelleted SIVmac251 (Advanced Biologics Industries, Columbia, Md.). Antibody binding was detected with peroxidase-conjugated goat anti-monkey IgG (Fc) or IgA (Fc) (Nordic Laboratories, San Juan Capistrano, Calif.) and developed with o-phenylenediamine dihydrochloride (Sigma). The endpoint titer was defined as the reciprocal of the last dilution giving a ΔOD greater than 0.1.

Lymphocyte proliferative responses to SIV antigens.

Antigen-specific proliferative responses against SIV Gag and Env proteins were measured in peripheral blood mononuclear cells (PBMCs) from fresh blood samples (31). PBMCs were purified from heparinized blood with Accu-Paque cell separation medium (Accurate Chemical & Scientific Corp., Westbury, N.Y.). The cells were suspended at 2 × 10⁶ per ml in RPMI 1640 medium supplemented with 10% fetal calf serum and plated in triplicate in volumes of 50 μl in a 96-well round-bottomed plate. SIV or control antigens at a concentration of 10, 1.0, and 0.01 μg/ml were added to the cells in 50 μl of complete medium. One hundred microliters of fresh medium was added after 48 h, and the plates were incubated for 5 days at 37°C in a CO₂ incubator. The cell cultures were pulsed with [³H]thymidine (1 μCi per well; NEN-DuPont, Wilmington, Del.) overnight prior to harvesting of the cells. The SIV antigens were SIVmac239 p55^gag and SIV gp140^env (provided by F. Vogel [National Institutes of Health] via Biomolecular Technology, Frederick, Md.). A lysate of the fall armyworm ovary cell line, Sf9, used for the production of baculovirus-expressed p55^gag, was used as a negative control for p55^gag, and the medium alone was the control for gp140^env. The stimulation index was defined as the mean radioactive counts per minute from replicate SIV antigen wells divided by the mean counts per minute from control wells and was considered significant if it was ≥2.0. In a series of preliminary experiments, the proliferative responses to SIV antigens of 10 macaques that had not been exposed to SIV were tested. It was determined that a level of 200 cpm in the negative-control wells was required to eliminate false-positive stimulation indexes (31).

Detection of SIV-specific CTL activity.

The details of culture and detection of bulk, secondary CTL responses have been previously reported (25, 26, 33). Briefly, PBMCs from immunized monkeys were stimulated with 10 μg of concanavalin A (Sigma) per ml and cultured for 14 days in complete medium supplemented with 5% human lymphocyte-conditioned medium (human interleukin 2; Hemagen Diagnostics, Waltham, Mass.). Autologous B cells were transformed with herpesvirus papio (594Sx1055 producer cell line, provided by M. Sharp, Southwest Foundation for Biomedical Research, San Antonio, Tex.) and infected overnight at an MOI of 30 with wild-type vaccinia virus (vvWR) or recombinant vaccinia virus expressing the p55^gag (vv-gag) or gp160^env (vv-env) of SIVmac239 (provided by L. Giavedoni and T. Yilma, University of California, Davis). The level of vaccinia virus infection of target cells was estimated by indirect immunofluorescence with monkey anti-vaccinia virus antibody and then with fluoresceinated goat anti-human IgG (Vector Laboratories, Burlingame, Calif.). The level of vaccinia virus infection of target cells in this series of experiments was estimated to fall between 5 and 15%.

Target cells were labeled with 50 μCi of ⁵¹Cr (Na₂CrO₄; Amersham Holdings, Arlington Heights, Ill.) per 10⁶ cells. Effector and target cells were added together at multiple effector/target ratios in a 4-h chromium release assay. Specific lysis was considered positive if its level was greater than twofold above that of vvWR targets and if it was at least 10%. For two animals at the time of necropsy (71 weeks postinoculation), a limiting-dilution assay for virus-specific CTL precursors was preformed. The assay was based on previously described methods (21, 26). Briefly, isolated PBMCs or mesenteric lymph node mononuclear cells were diluted 11 times over the range of 10,000 cells per well to 100 cells per well and cultured in replicate plates with 24 wells. The cells were stimulated with concanavalin A (5 μg/ml; Sigma) and supplemented with irradiated human PBMCs as feeder cells at a concentration of 4 × 10⁵/well. The percentages of CD3⁺ CD8⁺ T cells were identified by flow cytometry by using double surface immunofluorescence staining with FITC-conjugated anti-human CD3 (Gibco) and phycoerythrin-conjugated anti-human CD8 (Gibco). The cultures were maintained in AIM-V medium (Gibco), supplemented with 20% fetal calf serum and 5% human interleukin 2 (Hemagen Diagnostics). The level of cytolytic activity was measured on day 14, when wells were split three ways and incubated for 5 h with an autologous target cell infected with vvWR, vv-gag, or vv-env, as described above. Positive wells were identified as wells in which cytolysis exceeded that of the negative control (the mean chromium release from wells without effector cells) by 3 standard deviations. Wells containing cells that lysed uninfected autologous targets were eliminated from the calculations. The precursor frequency was determined by chi-square analysis based on maximum likelihood by a computer program provided by R. Miller (University of Michigan, Ann Arbor).

In vitro construction of recombinant polioviruses.

We generated recombinant polioviruses containing SIV gene fragments by a novel in vitro PCR-based approach. Briefly, Polio 5′ Arm and Polio 3′ Arm were amplified as two separate PCR products from Polio1 cDNA (Fig. 1A and B). An SIV gene fragment coding for the Gag protein p17 was amplified from an SIVmac239 plasmid clone and flanked by poliovirus 2A^pro cleavage sites plus 45 bp of sequence identity with the 3′ terminus of Polio 5′ Arm and 45 bp of overlap with the 5′ terminus of Polio 3′ Arm. These three separate DNA fragments—Polio 5′ Arm, SIV p17^gag, and Polio 3′ Arm—were mixed together and amplified into a single full-length recombinant virus DNA clone by hybrid PCR in which the termini of each overlapping DNA fragment served as a primer for the synthesis of the complementary strands of its neighboring DNA fragment, resulting in the ligation of the three DNA fragments. Further amplification of full-length Polio1-p17 was provided by 10 cycles of standard PCR with 5′ and 3′ primers terminal to the full-length product (see Materials and Methods). This amplified full-length Polio1-p17 recombinant virus DNA contained the p17^gag gene fragment (SIV Gag amino acids [aa] 2 to 135) at the P1-P2 junction, between the genes for the structural and nonstructural proteins of the virus. Infectious RNA was then generated by a standard in vitro T7 transcription reaction (Fig. 1C). The transcribed RNA was then transfected into HeLa cells, and virus was recovered. Recovered Polio1-p17 exhibited growth characteristics comparable to those of other recombinant polioviruses we have previously generated (61). Two additional type 1 recombinant polioviruses containing fragments of SIV p28^gag (SIV Gag aa 136 to 364) and gp41^env (SIV Env aa 523 to 628) were generated by the same in vitro construction technique. Each of the viruses grew to titers of ∼3 × 10⁸ and generated plaques that were 50 to 80% as large as those of wild-type Polio1 (data not shown). Expression of SIV protein in HeLa cells infected with Polio1-p17, Polio1-gp41, and Polio1-p28 was confirmed by Western blotting (Fig. 1D). This SIV protein expression is equimolar to that of each of the endogenous poliovirus proteins, as the single poliovirus open reading frame is initially translated as a polyprotein (Fig. 1A).

This novel in vitro method for constructing recombinant polioviruses was then used to generate a poliovirus live virus vector with the Sabin2 vaccine strain, which is a type 2 serotype poliovirus and is not neutralized by antibodies directed against Polio1 (36). Sabin2-p17, Sabin2-gp41, and Sabin2-p28 viruses were produced this way, and expression of their respective SIV gene fragments in human HeLa cells was confirmed by Western blotting (data not shown) and fluorescence immunodetection (Fig. 2) (see Materials and Methods). Each of the Sabin2 recombinant viruses grew to titers of ∼5 × 10⁸ and generated plaques that were 50 to 80% as large as those of Sabin2 (data not shown).

Genetic stability can be an issue with live poliovirus vectors (38, 61). Therefore, we quantified the percentages of viruses still expressing SIV protein in immunodetection assays done on the P1 viral stocks. The immunodetection was done at an MOI of 0.3, and greater than 90% of the HeLa cells positive for poliovirus proteins were also positive for SIV proteins (Fig. 2 and data not shown), indicating that the P1 viral stocks were greater than 90% pure. This percentage were confirmed by RT-PCR with primers flanking the P1-P2 junction. Polio1-p17, Polio1-gp41, Sabin2-p17, and Sabin2-gp41 were passaged one additional time (P2) at an MOI of 1 to generate the viral stocks used for immunization of monkeys. RT-PCR of the P2 virus stocks indicated that 60 to 80% of each viral population still contained the full SIV insert.

Monkey immunizations.

Our primary goal was to determine whether these recombinant polioviruses expressing SIV gene fragments stimulated a mucosal anti-SIV immune response at multiple locations in macaques. Cynomolgus macaques (M. fascicularis) are known to be orally and intranasally susceptible to poliovirus, whereas most other Old World primate monkey species are not orally or intranasally susceptible to poliovirus infection and present clinical symptoms only after intracerebral or intraspinal inoculation (9, 10, 12, 51). Therefore, we first titrated poliovirus in a group of cynomolgus monkeys and established that a dose of 10⁶ PFU of Polio1 was the minimal dose necessary to reliably seroconvert 100% of cynomolgus macaques when they are inoculated intranasally (data not shown).

We then designed our recombinant poliovirus immunization as follows: four 2 × 10⁷-PFU intranasal inoculations of a mixture of Polio1-p17 and Polio1-gp41 (one dose every three days), followed 11 weeks later by three 1 × 10⁷-PFU intranasal inoculations of a mixture of Sabin2-p17 and Sabin2-gp41. By using poliovirus live virus vectors derived from two different serotypes (1 and 2), we hoped to avoid vector neutralization problems and increase our ability to boost the immune response against the SIV fragments. The SIV fragments used in these experiments were previously shown to be immunogenic in mice when they were expressed by a recombinant poliovirus; therefore, we had reason to believe that they may be immunogenic in macaques as well (61).

An intravenous booster inoculation was given to all four monkeys 38 weeks into the experiment and will be discussed later.

Intranasal immunization induced serum anti-SIV IgG and IgA responses.

The results of ELISAs for serum IgG and IgA responses against SIV are shown in Fig. 3. Three of four monkeys (monkeys 25136, 25137, and 26394) developed strong anti-SIV IgG responses after intranasal inoculation with Polio1-p17 and Polio1-gp41 (Fig. 3A). The second set of intranasal immunizations with Sabin2-p17 and Sabin2-gp41 induced an anamnestic response in two monkeys (monkeys 25136 and 26394) as evidenced by enhanced levels of anti-SIV IgG in sera. Both of these monkeys then maintained a strong long-term anti-SIV IgG response, with titers between 1:1,000 and 1:10,000 (Fig. 3A). In addition to this IgG response, monkey 25136 developed a strong and persistent serum anti-SIV IgA response after intranasal immunization (Fig. 3B).

In summary, intranasal immunization with these four recombinant polioviruses elicited anti-SIV IgG in the sera of three of four monkeys and anti-SIV IgA in the serum of one monkey. Therefore, the recombinant polioviruses replicated in vivo and effectively expressed immunogenic SIV antigens.

Intranasal immunization induced rectal and vaginal anti-SIV antibody responses.

The common mucosal immune system theory proposes that immunization at one mucosal site will induce immunity detectable in other mucosal sites (40). Looking for evidence of such a broad mucosal response with poliovirus, we measured anti-SIV antibody titers in rectal washes and vaginal secretions after intranasal inoculations with Polio1-p17, Polio1-gp41, Sabin2-p17, and Sabin2-gp41.

Following a single intranasal immunization, three of the four monkeys generated a rectal anti-SIV IgA response, and every monkey tested positive for rectal IgA after both sets of intranasal immunizations (Fig. 4A). One monkey (monkey 26394) had detectable anti-SIV IgA levels in vaginal lavage after the Sabin2-gp41 and Sabin2-p17 intranasal immunizations (Fig. 4B). This monkey also exhibited a vaginal anti-SIV IgG response (Fig. 4B). The vaginal and rectal lavages from the other three monkeys tested negative for anti-SIV IgG in the screening ELISA and were not analyzed further. Thus, intranasal immunization with recombinant polioviruses expressing SIV antigens generated a substantial IgA response in rectal secretions, even though only one monkey tested positive for serum IgA. In contrast, the IgA response to the SIV antigens was more limited in vaginal secretions.

Surprisingly, intranasal immunization induced a pure mucosal anti-SIV antibody response in one monkey. The anti-SIV antibody response of monkey 22701 consisted only of IgA in rectal secretions (Fig. 4A).

All monkeys seroconverted to poliovirus.

Anti-poliovirus antibodies were detected in the sera of all four monkeys after the intranasal inoculations (Fig. 5A). These antibodies readily detected both type 1 and type 2 polioviruses (Fig. 5A). Three of the four monkeys generated neutralizing antibodies against Polio1 that were detectable after the intranasal inoculations with Polio1-gp41 and Polio1-p17, and these neutralizing antibodies were maintained for at least 3 months (Fig. 5B). Two of the monkeys also developed neutralizing antibodies against Sabin2 (monkeys 22701 and 26394). The strong vaginal anti-SIV IgA response seen in monkey 26394 was detected only after the Sabin2-gp41 and Sabin2-p17 inoculations. Therefore, neutralizing antibodies specific for Polio1 did not prohibit replication of the Sabin2 recombinant viruses in this monkey. Monkey 22701 appears to have generated uncommon cross-neutralizing antibodies after the Polio1-gp41 and Polio1-p17 infections.

Intranasal immunization induced anti-SIV T-cell proliferative responses.

Anti-poliovirus helper T-cell immune responses have been reported for humans and mice immunized with the Sabin poliovirus vaccine (14, 28, 57). To determine if immunization of monkeys with our recombinant polioviruses elicited SIV-specific T-helper lymphocytes, the proliferative response of PBMCs was determined following in vitro stimulation with SIV antigens (see Materials and Methods). Data from all four monkeys are shown in Table 1. Two monkeys (monkeys 25137 and 26394) generated an SIV Gag-specific lymphoproliferative response after the intranasal immunizations.

Intravenous booster immunization induced an anamnestic anti-SIV antibody response in the intranasally primed monkeys.

To augment the humoral and cellular responses generated after intranasal immunization, the monkeys were boosted intravenously with a mixture of all four recombinant polioviruses expressing the SIV antigens p17^gag and gp41^env. The intravenous boost given 38 weeks after the initial intranasal immunization generated a rapid but transient increase in serum anti-SIV IgG titers in three of the four monkeys (monkeys 25136, 25137, and 26394) and an increase in serum anti-SIV IgA in two of the four monkeys (monkeys 25136 and 26394), with levels soon returning to the pre-intravenous boost levels (Fig. 3).

Following the intravenous boost, monkeys 25136 and 26394 had low but detectable titers of anti-SIV IgA (1:2 to 1:4) in the vaginal lavages collected between 2 and 12 weeks after the intravenous boost (Fig. 4B). Interestingly, monkey 26394 was the same monkey that showed a vaginal IgA response after the intranasal inoculations. Monkeys 25136 and 26394 exhibited not only vaginal anti-SIV IgA responses but also vaginal anti-SIV IgG responses several weeks after the intravenous boost (Fig. 4B).

At the time of the intravenous boost, 9 months after the initial intranasal inoculation, anti-SIV IgA levels were undetectable in the rectal washes of all monkeys. The intravenous immunization resulted in a return of detectable rectal anti-SIV IgA in two of the four animals (monkeys 25136 and 25137), present for at least 3 months after the immunization. As expected, the intravenous boost had no effect on specific IgG levels in rectal washes.

Animal 22701, which made a purely IgA anti-SIV response after the intranasal inoculations, did not produce detectable antibodies after the intravenous boost (Fig. 3 and 4). However, this animal did make notable anti-SIV lymphoproliferative responses to both the p17^gag and gp41^env antigens after the intravenous boost (Table 1).

Intravenous booster immunization induced anti-SIV CTLs.

CTL responses have not been previously reported for live-poliovirus vaccinations in humans or other primates (60). We have reported the ability of our poliovirus live virus vectors to generate a CTL response against a model antigen (chicken ovalbumin) in mice (29, 56). Additionally, anti-HIV CTLs may be an important part of an AIDS vaccine. Therefore, we were interested in whether our poliovirus vectors expressing SIV proteins would stimulate anti-SIV CTLs in macaques.

Each monkey was tested at several time points for anti-SIV cytotoxic T cells by a bulk PBMC cytolytic assay. Anti-SIV CTLs specific for Env were consistently detected in monkey 25136 from week 19 through week 42, though it was difficult to obtain greater than 10% specific lysis (Fig. 6A). This was the only monkey with detectable Env-specific CTLs by bulk culture assay. Anti-SIV CTLs specific for Gag were not detected in any monkeys after the two intranasal inoculations. However, after the intravenous booster inoculation, Gag-specific CTLs were detected in monkeys 25137 and 25136 (Fig. 6A and data not shown) by the bulk culture assay. These were the same two monkeys that made substantial rectal IgA and rapid serum IgG responses following the intravenous inoculation (Fig. 3A and 4A).

At 71 weeks after the initial immunization, all four monkeys were euthanized. Our bulk culture CTL assays appeared to have limited sensitivity; therefore, we tested for the presence of cytotoxic T cells by limiting dilution assay using cells isolated from mesenteric lymph nodes (monkey 26394) and peripheral blood (monkey 25137). PBMCs from monkey 25137 contained T cells with a substantial amount of anti-Env CTL activity (Fig. 6B), giving a calculated Env-specific CTL precursor frequency of 3,539 per 10⁶ CD8⁺ cells. Gag-specific cytotoxic T cells were detectable at the lower frequency of 178 per 10⁶ CD8⁺ cells. These data, though striking, are partly inconsistent with the results obtained by bulk culture assay. We were able to detect Gag-specific CTLs in monkey 25137 by bulk culture assay at week 42, which is in agreement with the detection of Gag-specific CTLs by limiting dilution assay at week 71. However, we were unable to detect Env-specific CTLs in monkey 25137 by bulk culture at any time point, whereas we detected a high level of Env-specific CTLs in blood by the limiting dilution assay. The limiting dilution assay is a more sensitive assay, supporting the outgrowth of low frequency antigen-specific precursors, while the bulk culture method is more dependent on initial strong stimulation of the T cells. Env-specific CTLs were not detectable in the mesenteric lymph nodes of monkey 26394, which had no detectable Gag- or Env-specific CTLs at any time point by bulk PBMC culture assay.

The results presented here indicate that inoculation of nonhuman primates with poliovirus recombinants results in both humoral and cellular immune responses. The vaccinated monkeys were not challenged with SIV because only two partial SIV proteins constituted our immunization cocktails, and it is likely that a more complex composition of antigens would be required to afford protection. We are currently developing a cocktail of recombinant polioviruses containing most of the SIV proteins, which will be much more suitable for a vaccination and challenge experiment.