The Various Sendai Virus C Proteins Are Not Functionally Equivalent and Exert both Positive and Negative Effects on Viral RNA Accumulation during the Course of Infection

Cell cultures and viruses.

LLC-MK2 and BHK cell lines were grown in minimal essential medium supplemented with 5% fetal calf serum. Wild-type (wt) and rSeV stocks were prepared in the allantoic cavity of 9-day-old embryonated chicken eggs and harvested after 3 days at 33°C. Titer determination and plaque isolation of rSeV were carried out for 3 to 9 days at 33°C in LLC-MK2 cells covered with a 0.3% agarose overlay containing 1.2 μg of acetyl-trypsin per ml. The 50% egg infective dose (EID₅₀) of each viral stock was determined by injecting serial dilutions into the allantoic cavity of hen eggs as above. The presence of virus in the allantoic fluids was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (10% polyacrylamide) and staining with Coomassie brilliant blue on material pelleted at 10,000 × g for 30 min through a TNE (10 mM Tris-Cl, pH 7.4, 100 mM NaCl, 1 mM EDTA)–25% glycerol cushion in an Eppendorf centrifuge. To determine the 50% tissue culture infective dose (TCID₅₀), 4-cm petri dishes of BHK cells were infected in duplicate with serial dilutions of the virus stocks, and the cytopathic effect was monitored visually until 40 h postinfection (p.i.). At this time, cytoplasmic extracts were prepared and the levels of N protein contained in three different amounts of the extracts were determined by Western blotting with monoclonal anti-N⁸⁷⁷ antibody (25).

Generation of mutant SeV (DNA) genomes.

pGem-P/C carrying TCT^81/C′ and GCG^114/C mutations in the initiation codons of the P/C mRNA have been described previously (8). pGem-P/C combining these mutations was constructed by fusion PCR on pGem P/C-TCT^81/C′ DNA. The product was digested with SacI (in the upstream polylinker) and EagI (position 1005 on the P/C mRNA) and then subcloned into pGem P/C-TCT^/C′. Sendai viruses containing the various mutations in the C protein start sites were recovered from DNA by taking advantage of the recombinogenic nature of the vaccinia virus-based recovery system, as previously described (12, 13). Briefly, pFL3 (full-length DNA clone) was modified to contain a deletion encompassing most of the N and P genes (pFL3-Δ1), such that a rSeV could not be generated simply by the recombination of pFL3-Δ1 DNA with that of the individual pGEM-N and pGEM-P support plasmids. A shuttle vector (pN/P^Xho/M) containing the deleted region plus flanking sequences into which the mutated P/C genes were cloned was then constructed as follows. PCR was performed with a positive-sense primer carrying an XhoI site at position 69 (of the untranslated region of the P/C mRNA) and a negative-sense primer complementary to position 1178. The products were digested with XhoI and EagI and inserted into the same sites of pN/P^XhoI/M. The various mutated P/C genes were then recovered in viruses via recombination of the various pN/P^Xho/M vectors with pFL3-Δ1. In all cases, the relevant regions were verified by reverse transcription-PCR and DNA sequencing.

Generation of rSeV with an alternate expression of C proteins.

The recovery system was essentially as described previously (12, 13). Briefly, one 9-cm dish of HeLa cells (ca. 80% confluent) was infected with 3 PFU of vaccinia virus TF7-3 per cell (11). The cultures were transfected 1 h later with 1.5 μg of pGEM-L, 2.5 μg of pGEM-N, 4.5 μg of pGEM-^HAP/C^off (which do not express C proteins), 15 μg of pFL3-Δ1, and 5 μg of one of the pN/P^Xho/M shuttle vectors carrying the desired mutation. At 24 h later, 1-β-d-arabinofuranosylcytosine (100 μg/ml) was added to inhibit vaccinia virus replication, and 24 h after that, the cells were scraped into their medium and injected into two or three 10-day-old embryonated chicken eggs. At 3 days later, the allantoic fluids were harvested and reinjected undiluted into eggs. For further passages, the stocks were generally diluted 1/1,000 before injection. The presence of viruses in the allantoic fluids was determined as above.

Primer extension analysis of viral RNAs.

Total RNA was extracted from virus-infected cells with Trizol (Gibco-BRL) and analyzed by primer extension using with Moloney murine leukemia virus reverse transcriptase (Gibco-BRL) and 200,000 cpm of each of the following ³²P-5′- primers, which had been purified on sequencing gels: NP126 (5′-¹²⁶CGGCCATCGTGAACTTTGGC¹⁰⁷-3′ [numbers refer to map coordinates of the entire genome]) for estimation of antigenomes and N mRNAs and L15,270 (5′-^15,270GAAGCTCCGCGGTACC^15,285-3′) for genomes.

Immunoblotting.

C protein levels were determined by Western blotting of cytoplasmic extracts of BHK cells infected with the various viral stocks, using a rabbit anti-C polyclonal antiserum with the CSPD light detection system (Boehringer). Immunoblotting was also carried out on viruses released from cell cultures, purified by being pelleted through a TNE–25% glycerol cushion from the medium of infected BHK cells, with monoclonal anti-N877 antibody (25).

Determination of mouse pathogenicity.

Specific-pathogen-free 7-week-old (female) C57BL/6 mice (Iffo Credo) were infected intranasally with 10⁶ PFU of the various viruses. The mice were observed for symptoms and weighed daily. Groups of three mice were sacrificed on days 2, 5, 7, and 8 or 9, and the number of PFU present in 10% lung homogenates was determined on LLC-MK2 cells. The lung homogenates were also injected into 9-day-old embryonated hen eggs and passaged twice. BHK cells were infected with this allantoic fluid, and viral protein expression was monitored by immunoblotting for the N and C proteins. Total RNA was also extracted from the lung homogenates with Trizol (Gibco-BRL). cDNA was prepared with Moloney murine leukemia virus reverse transcriptase (Gibco) and amplified with the Expand high-fidelity PCR system (Boehringer) with the primers mentioned above. The PCR product DNA was sequenced.

Specific-pathogen-free, 3-week-old male mice [ICR/CRJ(CD-1) strain; Clea, Inc.] were infected intranasally with 25 μl of serially diluted virus under ether anesthesia. The mice were observed for symptoms and weighed daily. The 50% lethal dose (LD₅₀) was calculated by the method of Reed and Muench (29). The cell infectious unit (CIU) was essentially equivalent to PFU.

Failure to recover a totally C-minus Sendai virus.

Measles virus (MeV) expresses a single C protein from its P gene, and Radecke and Billeter (28) have recovered a rMeV which cannot express its C protein due to the introduction of a stop codon into this ORF. This rMeV-C^minus strain replicated normally in cell culture, indicating that the MeV C protein does not play an essential role in the cellular replication of this paramyxovirus, at least in cell culture. A similar situation has also been found for the more distantly related rhabdovirus vesicular stomatitis virus (21). We have also attempted to recover a rSeV which cannot express any of its four C proteins, by placing a stop codon in the C ORF just downstream of the Y2 start codon (ATG^201/Y2) to terminate all four C proteins (8). A full-length SeV genome expression plasmid containing the C^stop mutation was constructed by exchanging the SalI fragment of pFL3 (which includes the N-terminal region of the P/C gene) with one containing the C^stop mutation (Fig. 2). As a positive control, the SalI fragment was always exchanged with itself at the same time. Virus recoveries from pFL3 and pFL3-C^stop were carried out in parallel (by using the pGEM-P/C^stop support plasmid, so that the C^stop mutation of pFL3-C^stop could not be lost by recombination), and the resulting viruses were amplified in hen eggs. In four separate attempts, sufficient virus was present in the pFL3 recoveries that 60 μl of the second-passage allantoic fluid showed a strong pattern of SeV structural proteins when analyzed by SDS-PAGE and Coomassie blue staining. This corresponded to reference stocks containing ca. 10⁹ to 10¹⁰ EID₅₀/ml (Fig. 3). However, we were unable to detect virus from the pFL3-C^stop transfections by this test, even when 200 μl of sixth-passage allantoic fluid was examined.

As mentioned above, expression of (wt) C proteins from the pGEM-P/C support plasmid adversely affects the recovery of rSeV from DNA. However, we and others have successfully used other pGEM-P support plasmids in rSeV recoveries (6, 19), namely, (i) pGEM-^HAP/C^off, in which the influenza virus HA tag was fused between the C^prime and P protein start codons in one continuous ORF, which eliminates almost all C protein expression; and (ii) pGEM-P/C^MVC, containing the gene of the avirulent cell culture-derived mutant virus. The C^MVC proteins have mostly lost their ability to inhibit viral RNA synthesis, and their electrophoretic mobility can also be distinguished from those coded for by the silenced C ORF of pGEM-^HAP/C^off (6). We were particularly interested in the results with pGEM-^HAP/C^off, which performs better than the other P/C gene support plasmids in genome amplification and virus recoveries (data not shown, and see below). Virus recoveries from pFL3 and pFL3-C^stop were again carried out in parallel with either the pGEM-^HAP/C^off or pGEM-P/C^MVC support plasmid. rSeV was routinely recovered from pFL3 as before, and in these cases the virus could also be recovered at low frequency (one in four attempts) from the pFL3-C^stop transfections. However, in both of these cases it is possible that the C^stop mutation of pFL3-C^stop was lost by recombination with the pGEM-P/C support plasmids, even though the conditions for recombination were not favorable in either case and recombination would be expected to occur only at low frequency. Virus recovered from these pFL3-C^stop transfections was therefore used to infect BHK cells, and the presence or absence of C proteins intracellularly was monitored by immunoblotting. As shown in Fig. 2, the C^prime and C proteins were clearly expressed by the recovered viruses. Moreover, their electrophoretic mobility in each case was identical to that of the particular pGEM-P/C used; i.e., these viruses had presumably arisen by DNA recombination between pFL3-P/C^stop and the P/C gene support plasmid. Therefore, we have been unable to prepare a totally C-minus virus that can be amplified in eggs, even after multiple passages. While this paper was under review, we learned that Kurotani et al. (21a) were eventually able to prepare a virus slightly different from C^stop [named 4C(−)], which was detectable only at extremely low PFU.

rSeV expressing two or three C proteins.

To eliminate the expression of individual C proteins, we mutated their start codons individually or in combination, as detailed in Fig. 1. The mutations were first constructed in the pGEM-P/C support plasmids, so that these genes could be controlled for their ability to express the various C proteins. Mutation of ACG^81/C′ to TCT and ATG^114/C to GCG eliminated expression of the C^prime and C proteins respectively, as expected (data not shown [cf. Fig. 1]). Mutation of ATG^114/C to GCG introduces an Asp4Gly substitution in the P protein, but the only suitable P-silent mutation (ATG^114/C to ACG) is unreliable in this case. The Asp4Gly substitution had no noticeable effect on the ability of P to support minigenome RNA synthesis in transfected cells. Our attempts to eliminate Y1 and Y2 expression by simultaneously mutating ATG^183/Y1 and ATG^201/Y2 to ACG (both silent in the P ORF) were unsuccessful. These mutations had only a minor effect in reducing Y1 and Y2 expression. Further, their simultaneous mutation to GCG more strongly reduced but did not eliminate Y1 and Y2 expression (data not shown). The Y proteins appear to be initiated by an unusual mechanism, in which the codon-anticodon interactions at the ribosomal start site are considerably less important than at standard start sites (23). Hence, we have so far been unable to prepare rSeV strains which express C^prime and C but not Y1 and Y2.

Recombinant SeV-[C^prime-minus] was routinely recovered from the transfections with either pGEM-^HAP/C^off or pGEM-P/C^stop as the support plasmid, and this virus grew to the same levels as that recovered from the wt control (by the second passage in eggs). Immunoblots of BHK cells infected with this virus showed that C^prime protein expression was specifically ablated whereas C, Y1, and Y2 protein levels were normal (Fig. 1). Recombinant SeV-[C-minus] was also routinely recovered from the transfections but only with pGEM-^HAP/C^off as the support plasmid. Immunoblots of BHK cells infected with [C-minus] showed that C protein expression was specifically ablated whereas C^prime protein accumulation was normal. However, Y1, and Y2 protein levels had risen strongly, so that their combined level easily replaced that of the missing C protein (Fig. 1). [C^prime/C-minus], the start codon double mutant, in contrast, was recovered from the transfections in only one-third of the attempts and again only with pGEM-^HAP/C^off as the support plasmid, and it reached titers suitable for high-multiplicity cell culture infection by passage 4 (see below). Immunoblots of extracts of cells infected with [C^prime/C-minus] showed that C^prime and C protein expression was specifically ablated and that Y2 protein levels alone had risen strongly. It is possible that some of the increase in Y1 and Y2 levels when C or C^prime plus C expression is ablated is simply due to increased initiation at ATG^183/Y1 and ATG^201/Y2 when ATG^114/C is no longer functional. The increasing difficulty in recovering rSeV strains which do not express the C^prime, C, and C^prime plus C proteins is in line with our inability to recover a totally C-minus virus.

Titers of the rSeV stocks.

Allantoic fluid stocks suitable for high-multiplicity infections of cell cultures (5 × 10⁸ to 20 × 10⁸ PFU/ml) were routinely prepared in recoveries of [C^prime-minus] and [C-minus], as in the parallel rSeV^Z or rSeV^Z-N^H wt controls [Ge (MK2), Fig. 3]. These virus stocks also contained roughly similar amounts of virus proteins (data not shown; see Materials and Methods). [C^prime/C-minus] (the double mutant) was recovered twice (dm1 and dm2), and although fourth- passage stocks of these viruses contained considerable amounts of viral proteins (only ca. 10-fold less than the wt stock [Fig. 3]), we were unable to determine the titers of the double-mutant stocks in Geneva. In contrast to the three other rSeV strains, which formed clear plaques 1 to 2 mm in diameter by day 4, the double mutant did not form visible plaques by day 5, when our serum-free monolayers began to disintegrate. A fresh stock of dm2, however, did form very small plaques by day 7 in Kobe (Fig. 4), albeit with a titer of only 4 × 10⁶ PFU/ml, i.e., 3 log units lower than that for the wt control (6 × 10⁹ PFU/ml) (Fig. 3).

The PFU titer (on MK2 cells) of the dm2 stock, however, was inconsistent with the finding that 10⁷ BHK cells infected with 1 ml of a 1/5 dilution of dm2^Ge accumulated roughly as much C proteins as did those infected with 10 PFU of wt virus (or either of the single mutants) per cell (Fig. 1). We therefore estimated the titer of the dm2^Ge stock by infecting BHK cells with serial dilutions and determining the levels of N protein intracellularly at 40 h pi (see Materials and Methods), i.e., its TCID₅₀. The dm2^Ge stock was estimated to contain ca. 10⁸ (BHK) TCID₅₀/ml, and our wt stock was estimated to contain 10¹⁰ (BHK) TCID₅₀/ml. The relative infectivities of these stocks were further estimated by performing limiting dilutions in eggs (EID₅₀ determinations; see Materials and Methods). The wt stock contained 6 × 10⁹ EID₅₀/ml, whereas the dm2^Ge stock contained only 1 × 10³ EID₅₀/ml. Thus, in contrast to the wt and single-mutant virus stocks, whose PFU, TCID₅₀, and EID₅₀ titers were relatively constant (2 × 10⁹ to 10 × 10⁹ and 5 × 10⁸ to 6 × 10⁸ IU/ml, respectively), the titer of the dm stock depended heavily on the method by which the numbers of infectious units were determined (Fig. 3). Relative to the wt virus stocks, the dm stocks contained ca. 10-fold less protein, 100-fold less (BHK) TCID₅₀, 1,000-fold less PFU, and 1,000,000-fold less EID₅₀.

Infection of cells in culture.

Parallel 4-cm-diameter BHK cultures (ca. 10⁷ cells) were infected with 2 (MK2) PFU of wt, [C^prime-minus], or [C-minus] per cell and 2 (BHK) TCID₅₀ of dm2^Ge per cell [2 PFU of wt virus per cell is equivalent to 10 to 20 (BHK) TCID₅₀/cell (Fig. 3)]. Infected cultures were harvested at various times after infection, and the relative amounts of viral genomes, antigenomes, and N mRNAs present in equal samples of the total RNA (one-quarter of each dish) were estimated by duplex primer extension (Fig. 5A and B). Relative to the wt infection, the [C^prime-minus] and [C-minus] infections led to the accumulation of significantly more viral RNA, and this was most apparent in the [C^prime-minus] infections, where the accumulation occurred earlier and to higher levels. The double-mutant infection, in contrast, led to the accumulation of relatively little viral RNA by 20 h p.i. From 20 to 30 h p.i., however, a large increase in the amounts of the three viral RNAs occurred in this infection. In particular, N mRNAs had now accumulated to higher levels than in the wt and [C-minus] infections (but remained below those of the [C^prime-minus] infection) and the genome and antigenome levels approached those of the wt infection by 30 h p.i. N mRNA levels continued to increase until 40 h p.i. in the double-mutant infection and reached levels equivalent to the peak of the [C^prime-minus] infection, whereas the N mRNA levels decreased from 30 to 40 h p.i. infection in the three other infections. Similarly, genomes continued to accumulate from 30 to 40 h p.i. in the double-mutant infection, such that their abundance was equal to those in the [C^prime-minus] and [C-minus] infections at this time, which were all fourfold higher than in the wt infection at 40 h p.i. Independent isolates of all three mutant viruses (e.g., dm1 and dm2) behaved similarly in cell culture infections (data not shown).

The supernatants of the various infections were also harvested, and the relative numbers of virus particles in these fluids were estimated by immunoblotting for N protein (see Materials and Methods). As shown in Fig. 6, the [C-minus] and dm2^Ge infections liberated slightly less virion N protein into the medium than did the wt infection, but with similar kinetics, even though both these mutant infections led to fourfold more viral genomes intracellularly than did the wt infection (Fig. 5A and B). The [C^prime-minus] infection, in contrast, liberated virion N protein into the medium at earlier times and in larger amounts than did the wt infection, consistent with the amounts of C^prime-minus genomes intracellularly. The [C-minus] and double-mutant infections may thus be defective in virus maturation; if this is so, this defect is presumably due to the absence of the C protein. These results also suggest that the inhibition of viral RNA synthesis at the beginning of the wt and [C-minus] infections is due primarily to the presence of C^prime.

The wt, [C^prime-minus], and [C-minus] infections were all carried out at 2 to 20 IU/cell, and the vast majority of these cells were thus infected. The dm2-infected cultures must then have been infected with at least 1 IU/cell [consistent with the (BHK) TCID₅₀ titer of the stock], since these infections lead to accumulation of the same levels of genomes as those found in the other mutant infections at 40 h p.i. The dm2 infections in Fig. 5A and B were nevertheless initiated at a 10-fold-lower (BHK) TCID₅₀/cell than the other infections, and some of the 10-h delay in RNA accumulation in the experiment in Fig. 5B may be due to the lower MOI. To determine whether the simultaneous absence of the C^prime and C proteins also played a role in this delay, cultures infected with 2 TCID₅₀ of each of the four viruses per cell were also compared as above. As shown in Fig. 5C, the dm infection again led to a significantly smaller number of genomes than did the three other infections at 20 h p.i., but the difference had been made up by 30 h p.i. The simultaneous absence of both the C^prime and C proteins during infection thus appears to result in a delay in the accumulation of the viral RNAs.

Infection of mice.

Groups of 7-week-old, specific-pathogen-free C57BL/6 mice were inoculated intranasally with 10⁶ PFU of [C^prime-minus] or [C-minus], as well as SeV^Z as a virulent wt virus control. As an avirulent virus control, the same mice were also infected with SeV^MVC, which is avirulent for 3-week-old (outbred) ICR mice (18, 37). All the mice were weighed daily as a general indicator of their health (Fig. 7A), since loss of body weight is a useful indicator of SeV pathogenicity in these animals (20). Groups of three mice were sacrificed at various times p.i., and the virus titers (PFU on MK2 cells) in their lungs homogenates were determined.

As shown in Fig. 7A, [C^prime-minus] was highly virulent like the SeV^Z-wt control, since these virus-infected mice all steadily lost weight starting on day 3 and either died or were killed in extremis by day 8. Mice infected with [C-minus] or SeV^MVC also began to lose weight starting on day 3. However, in contrast to the [C^prime-minus]- and wt-infected animals, all these mice stopped losing weight by day 4 or 5 and then quickly regained weight, so that their body weight was similar to that of the mock-infected control animals by day 5 or 6. None of these mice died, and they all appeared to be in good health at day 8. Consistent with these results, infectious virus accumulated during the course of the [C^prime-minus] and wt infections, reaching 10⁶ PFU/lobe (but was somewhat delayed in the [C^prime-minus] infection). On the other hand, detectable virus (>10² PFU/lobe) was present only on day 2 of the [C-minus] or SeV^MVC infections and was absent by day 5 (Fig. 7B). As a more sensitive test for the presence of virus, eggs were infected with the lung homogenates and passaged twice. Two of three mice were still virus positive on day 5 of the [C-minus] or SeV^MVC infections (Fig. 7B), but all three were virus negative by day 9. The virus present in the lungs was amplified and used to infect BHK cells. In all cases, the pattern of C protein accumulation was found to be identical to that of the rSeV that had initiated the mouse infection (data not shown [cf. Fig. 1]). The relevant region of the viral genomes was also amplified by RT/PCR and sequenced, and in all cases the mutations introduced to alter the start codons were found to be stable (not shown). The LD₅₀s of these viruses for 3-week-old (outbred) ICR mice were determined (Table 1). Relative to rSeV^Z-N^H (our wt control), the LD₅₀ of [C^prime-minus] was very similar whereas that of [C-minus] had increased by ca. 2 log units, consistent with the results (weight loss and lung virus titer) obtained in inbred C57BL/6 mice. None of the mice died after infection with the highest titer of the dm2^Kobe stock.

Thus, rSeV strains which cannot specifically express C^prime but whose expression of C, Y1, and Y2 is normal, grows to high titers in mouse lungs like wt virus and remains highly virulent for these animals. On the other hand, rSeV strains which specifically cannot express C but which express C^prime normally and whose levels of Y1 and Y2 are increased is quickly cleared from the mouse lungs and is no longer highly virulent for these animals. The C protein (i.e., that initiated at ATG¹¹⁴) is thus specifically required for virulence in mice.